# Copyright 2013 by Kai Blin. # Revisions copyright 2015-2016 by Peter Cock. # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. import unittest from os import path import warnings from datetime import datetime from Bio import BiopythonParserWarning from Bio import BiopythonWarning from Bio import GenBank from Bio.GenBank import Scanner from Bio import SeqIO from Bio.SeqRecord import SeqRecord from Bio.Seq import Seq from Bio.Alphabet import generic_dna from Bio._py3k import StringIO class GenBankTests(unittest.TestCase): """GenBank tests.""" def test_invalid_product_line_raises_value_error(self): """Parsing invalid product line.""" def parse_invalid_product_line(): rec = SeqIO.read(path.join('GenBank', 'invalid_product.gb'), 'genbank') self.assertRaises(ValueError, parse_invalid_product_line) def test_genbank_read(self): """GenBank.read(...) simple test.""" with open(path.join("GenBank", "NC_000932.gb")) as handle: record = GenBank.read(handle) self.assertEqual(['NC_000932'], record.accession) def test_genbank_read_multirecord(self): """GenBank.read(...) error on multiple record input.""" with open(path.join("GenBank", "cor6_6.gb")) as handle: self.assertRaises(ValueError, GenBank.read, handle) def test_genbank_read_invalid(self): """GenBank.read(...) error on invalid file (e.g. FASTA file).""" with open(path.join("GenBank", "NC_000932.faa")) as handle: self.assertRaises(ValueError, GenBank.read, handle) def test_genbank_read_no_origin_no_end(self): """GenBank.read(...) error on malformed file.""" with open(path.join("GenBank", "no_origin_no_end.gb")) as handle: self.assertRaises(ValueError, GenBank.read, handle) # Evil hack with 000 to manipulate sort order to ensure this is tested # first (otherwise something silences the warning) def test_000_genbank_bad_loc_wrap_warning(self): """Feature line wrapping warning.""" with warnings.catch_warnings(): warnings.simplefilter("error", BiopythonParserWarning) with open(path.join("GenBank", "bad_loc_wrap.gb")) as handle: # self.assertRaises(BiopythonParserWarning, GenBank.read, handle) try: record = GenBank.read(handle) except BiopythonParserWarning as e: self.assertEqual(str(e), "Non-standard feature line wrapping (didn't break on comma)?") else: self.assertTrue(False, "Expected specified BiopythonParserWarning here.") # Similar hack as we also want to catch that warning here def test_001_negative_location_warning(self): """Un-parsable feature location warning.""" with warnings.catch_warnings(): warnings.simplefilter("error", BiopythonParserWarning) try: SeqIO.read(path.join("GenBank", "negative_location.gb"), "genbank") except BiopythonParserWarning as e: self.assertEqual(str(e), "Couldn't parse feature location: '-2..492'") else: self.assertTrue(False, "Expected specified BiopythonParserWarning here.") def test_001_genbank_bad_origin_wrapping_location(self): """Bad origin wrapping.""" with warnings.catch_warnings(): warnings.simplefilter("error", BiopythonParserWarning) try: SeqIO.read(path.join("GenBank", "bad_origin_wrap_linear.gb"), "genbank") except BiopythonParserWarning as e: self.assertEqual(str(e), "Ignoring invalid location: '6801..100'") else: self.assertTrue(False, "Expected specified BiopythonParserWarning here.") def test_implicit_orign_wrap_fix(self): """Attempt to fix implied origin wrapping.""" with warnings.catch_warnings(): warnings.simplefilter("error", BiopythonParserWarning) try: SeqIO.read(path.join("GenBank", "bad_origin_wrap.gb"), "genbank") except BiopythonParserWarning as e: self.assertEqual(str(e), "Attempting to fix invalid location " "'6801..100' ""as it looks like " "incorrect origin wrapping. Please " "fix input file, this could have " "unintended behavior.") else: self.assertTrue(False, "Expected specified BiopythonParserWarning here.") def test_implicit_orign_wrap_extract_and_translate(self): """Test that features wrapped around origin give expected data.""" with warnings.catch_warnings(): warnings.simplefilter("ignore", BiopythonParserWarning) with open(path.join("GenBank", "bad_origin_wrap_CDS.gb")) as handle: seq_record = SeqIO.read(handle, "genbank") seq_features = seq_record.features self.assertEqual(str(seq_features[1].extract(seq_record).seq.lower()), "atgccctataaaacccagggctgccttggaaaaggcgcaacccc" "aaccccctcgagccgcggcatataa") self.assertEqual(str(seq_features[2].extract(seq_record).seq.lower()), "atgccgcggctcgagggggttggggttgcgccttttccaaggca" "gccctgggttttatag") self.assertEqual(str(seq_features[1].extract(seq_record).seq.translate()), "MPYKTQGCLGKGATPTPSSRGI*") self.assertEqual(str(seq_features[2].extract(seq_record).seq.translate()), "MPRLEGVGVAPFPRQPWVL*") def test_genbank_bad_loc_wrap_parsing(self): """Bad location wrapping.""" with warnings.catch_warnings(): warnings.simplefilter("ignore", BiopythonParserWarning) with open(path.join("GenBank", "bad_loc_wrap.gb")) as handle: record = GenBank.read(handle) self.assertEqual(1, len(record.features)) loc = record.features[0].location self.assertEqual(loc, "join(3462..3615,3698..3978,4077..4307,4408..4797,4876..5028,5141..5332)") def test_negative_location(self): """Negative feature locations.""" with warnings.catch_warnings(): warnings.simplefilter("ignore", BiopythonParserWarning) rec = SeqIO.read(path.join("GenBank", "negative_location.gb"), "genbank") self.assertEqual(None, rec.features[-1].location) def test_dot_lineage(self): """Missing taxonomy lineage.""" with warnings.catch_warnings(): warnings.simplefilter("ignore", BiopythonParserWarning) rec = SeqIO.read("GenBank/bad_loc_wrap.gb", "genbank") self.assertEqual(rec.annotations["organism"], ".") self.assertEqual(rec.annotations["taxonomy"], []) def test_dblink(self): """Parse GenBank record with old DBLINK project entry.""" record = SeqIO.read("GenBank/NC_005816.gb", "gb") self.assertEqual(record.dbxrefs, ["Project:58037"]) gb = record.format("gb") self.assertIn("\nDBLINK Project: 58037\n", gb) embl = record.format("embl") self.assertIn("XX\nPR Project:58037;\nXX\n", embl) def test_dblink_two(self): """Parse GenBank record with old and new DBLINK project entries.""" record = SeqIO.read("GenBank/NP_416719.gbwithparts", "gb") self.assertEqual(record.dbxrefs, ["Project:57779", "BioProject:PRJNA57779"]) gb = record.format("gb") self.assertTrue(""" DBLINK Project: 57779 BioProject: PRJNA57779 KEYWORDS """ in gb, gb) embl = record.format("embl") self.assertIn("XX\nPR Project:PRJNA57779;\nXX\n", embl) def test_dbline_gb_embl(self): """Parse GenBank/EMBL paired records with PR project entry: GenBank""" record = SeqIO.read("GenBank/DS830848.gb", "gb") self.assertIn("BioProject:PRJNA16232", record.dbxrefs) gb = record.format("gb") self.assertTrue(""" DBLINK BioProject: PRJNA16232 BioSample: SAMN03004382 KEYWORDS """ in gb, gb) # Also check EMBL output embl = record.format("embl") self.assertIn("XX\nPR Project:PRJNA16232;\nXX\n", embl) def test_dbline_embl_gb(self): """Parse GenBank/EMBL paired records with PR project entry: EMBL""" record = SeqIO.read("EMBL/DS830848.embl", "embl") # TODO: Should we map this to BioProject:PRJNA16232 self.assertIn("Project:PRJNA16232", record.dbxrefs) gb = record.format("gb") self.assertTrue(""" DBLINK Project: PRJNA16232 MD5: 387e72e4f7ae804780d06f875ab3bc41 ENA: ABJB010000000 ENA: ABJB000000000 BioSample: SAMN03004382 KEYWORDS """ in gb, gb) embl = record.format("embl") self.assertIn("XX\nPR Project:PRJNA16232;\nXX\n", embl) def test_structured_comment_parsing(self): """Structued comment parsing.""" # GISAID_EpiFlu(TM)Data, HM138502.gbk has both 'comment' and 'structured_comment' record = SeqIO.read(path.join('GenBank', 'HM138502.gbk'), 'genbank') self.assertEqual(record.annotations['comment'], "Swine influenza A (H1N1) virus isolated during human swine flu\noutbreak of 2009.") self.assertEqual(record.annotations['structured_comment']['GISAID_EpiFlu(TM)Data']['Lineage'], 'swl') self.assertEqual(len(record.annotations['structured_comment']['GISAID_EpiFlu(TM)Data']), 3) with open(path.join('GenBank', 'HM138502_output.gbk'), "r") as ifile: self.assertEqual(record.format("gb"), ifile.read()) # FluData structured comment record = SeqIO.read(path.join('GenBank', 'EU851978.gbk'), 'genbank') self.assertEqual(record.annotations['structured_comment']['FluData']['LabID'], '2008704957') self.assertEqual(len(record.annotations['structured_comment']['FluData']), 5) with open(path.join('GenBank', 'EU851978_output.gbk'), "r") as ifile: self.assertEqual(record.format("gb"), ifile.read()) # Assembly-Data structured comment record = SeqIO.read(path.join('GenBank', 'KF527485.gbk'), 'genbank') self.assertEqual(record.annotations['structured_comment']['Assembly-Data']['Assembly Method'], 'Lasergene v. 10') self.assertEqual(len(record.annotations['structured_comment']['Assembly-Data']), 2) with open(path.join('GenBank', 'KF527485_output.gbk'), "r") as ifile: self.assertEqual(record.format("gb"), ifile.read()) # No structured comment in NC_000932.gb, just a regular comment record = SeqIO.read(path.join('GenBank', 'NC_000932.gb'), 'genbank') self.assertFalse("structured_comment" in record.annotations) self.assertEqual(record.annotations['comment'], 'REVIEWED REFSEQ: This record has been curated by NCBI staff. The\n' 'reference sequence was derived from AP000423.\n' 'COMPLETENESS: full length.') def test_locus_line_topogoly(self): """Test if chromosome topology is conserved""" record = SeqIO.read('GenBank/DS830848.gb', 'genbank') self.assertEqual(record.annotations['topology'], 'linear') out_handle = StringIO() SeqIO.write([record], out_handle, 'genbank') first_line = out_handle.getvalue().split('\n')[0] self.assertIn('linear', first_line) with open('GenBank/DS830848.gb', 'r') as fh: orig_first_line = fh.readline().strip() self.assertEqual(first_line, orig_first_line) def test_qualifier_order(self): """Check the qualifier order is preserved.""" record = SeqIO.read("GenBank/DS830848.gb", "gb") f = record.features[0] self.assertEqual(list(f.qualifiers), ['organism', 'mol_type', 'strain', 'db_xref', 'dev_stage']) def test_qualifier_escaping_read(self): """Check qualifier escaping is preserved when parsing.""" # Make sure parsing improperly escaped qualifiers raises a warning with warnings.catch_warnings(record=True) as caught: warnings.simplefilter("always") record = SeqIO.read("GenBank/qualifier_escaping_read.gb", "gb") self.assertEqual(len(caught), 4) self.assertEqual(caught[0].category, BiopythonParserWarning) self.assertEqual(str(caught[0].message), 'The NCBI states double-quote characters like " should be escaped' ' as "" (two double - quotes), but here it was not: ' '%r' % 'One missing ""quotation mark" here') # Check records parsed as expected f1 = record.features[0] f2 = record.features[1] f3 = record.features[2] f4 = record.features[3] f5 = record.features[4] self.assertEqual(f1.qualifiers['note'][0], '"This" is "already" "escaped"') self.assertEqual(f2.qualifiers['note'][0], 'One missing "quotation mark" here') self.assertEqual(f3.qualifiers['note'][0], 'End not properly "escaped"') self.assertEqual(f4.qualifiers['note'][0], '"Start" not properly escaped') self.assertEqual(f5.qualifiers['note'][0], 'Middle not "properly" escaped') def test_qualifier_escaping_write(self): """Check qualifier escaping is preserved when writing.""" # Write some properly escaped qualifiers and test genbank_out = "GenBank/qualifier_escaping_write.gb" record = SeqIO.read(genbank_out, "gb") f1 = record.features[0] f2 = record.features[1] f1.qualifiers['note'][0] = '"Should" now "be" escaped in "file"' f2.qualifiers['note'][0] = '"Should also be escaped in file"' SeqIO.write(record, genbank_out, "gb") # Read newly escaped qualifiers and test record = SeqIO.read(genbank_out, "gb") f1 = record.features[0] f2 = record.features[1] self.assertEqual(f1.qualifiers['note'][0], '"Should" now "be" escaped in "file"') self.assertEqual(f2.qualifiers['note'][0], '"Should also be escaped in file"') def test_long_names(self): """Various GenBank names which push the column based LOCUS line.""" original = SeqIO.read("GenBank/iro.gb", "gb") self.assertEqual(len(original), 1326) for name, seq_len, ok in [ ("short", 1, True), ("max_length_of_16", 1000, True), ("overly_long_at_17", 1000, True), ("excessively_long_at_22", 99999, True), ("excessively_long_at_22", 100000, False), ("pushing_the_limits_at_24", 999, True), ("pushing_the_limits_at_24", 1000, False), ("longest_possible_len_of_26", 10, False), # 2 digits ("longest_possible_len_of_26", 9, True), # 1 digit ]: # Make the length match the desired target record = original[:] # TODO - Implement Seq * int record.seq = Seq("N" * seq_len, original.seq.alphabet) # Set the identifer to the desired name record.id = record.name = name # Attempt to output the record... if not ok: # e.g. ValueError: Locus identifier 'excessively_long_at_22' is too long self.assertRaises(ValueError, record.format, "gb") continue with warnings.catch_warnings(): # e.g. BiopythonWarning: Stealing space from length field to # allow long name in LOCUS line warnings.simplefilter("ignore", BiopythonWarning) # output = record.format("gb") handle = StringIO() self.assertEqual(1, SeqIO.write(record, handle, "gb")) handle.seek(0) line = handle.readline() self.assertIn(" %s " % name, line) self.assertIn(" %i bp " % seq_len, line) name_and_length = line[12:40] self.assertEqual(name_and_length.split(), [name, str(seq_len)], line) handle.seek(0) with warnings.catch_warnings(): # e.g. BiopythonParserWarning: GenBank LOCUS line # identifier over 16 characters warnings.simplefilter("ignore", BiopythonWarning) new = SeqIO.read(handle, "gb") self.assertEqual(name, new.name) self.assertEqual(seq_len, len(new)) def test_genbank_date_default(self): """Check if default date is handled correctly""" sequence_object = Seq("ATGC", generic_dna) # check if default value is inserted correctly record = SeqRecord(sequence_object, id='123456789', name='UnitTest', description='Test case for date parsing') handle = StringIO() SeqIO.write(record, handle, 'genbank') handle.seek(0) gb = SeqIO.read(handle, "gb") self.assertEqual(gb.annotations["date"], "01-JAN-1980") def test_genbank_date_correct(self): """Check if user provided date is inserted correctly""" sequence_object = Seq("ATGC", generic_dna) record = SeqRecord(sequence_object, id='123456789', name='UnitTest', description='Test case for date parsing') record.annotations["date"] = "24-DEC-2015" handle = StringIO() SeqIO.write(record, handle, 'genbank') handle.seek(0) gb = SeqIO.read(handle, "gb") self.assertEqual(gb.annotations["date"], "24-DEC-2015") def test_genbank_date_list(self): """Check if date lists are handled correctly""" sequence_object = Seq("ATGC", generic_dna) record = SeqRecord(sequence_object, id='123456789', name='UnitTest', description='Test case for date parsing') record.annotations["date"] = ["24-DEC-2015"] handle = StringIO() SeqIO.write(record, handle, 'genbank') handle.seek(0) gb = SeqIO.read(handle, "gb") self.assertEqual(gb.annotations["date"], "24-DEC-2015") record = SeqRecord(sequence_object, id='123456789', name='UnitTest', description='Test case for date parsing') record.annotations["date"] = ["24-DEC-2015", "25-JAN-2016"] handle = StringIO() SeqIO.write(record, handle, 'genbank') handle.seek(0) gb = SeqIO.read(handle, "gb") self.assertEqual(gb.annotations["date"], "01-JAN-1980") def test_genbank_date_datetime(self): """Check if datetime objects are handled correctly""" sequence_object = Seq("ATGC", generic_dna) record = SeqRecord(sequence_object, id='123456789', name='UnitTest', description='Test case for date parsing') record.annotations["date"] = datetime(2000, 2, 2) handle = StringIO() SeqIO.write(record, handle, 'genbank') handle.seek(0) gb = SeqIO.read(handle, "gb") self.assertEqual(gb.annotations["date"], "02-FEB-2000") def test_genbank_date_invalid(self): """Check if invalid dates are treated as default""" invalid_dates = ("invalid date", "29-2-1981", "35-1-2018", "1-1-80", "1-9-99") sequence_object = Seq("ATGC", generic_dna) for invalid_date in invalid_dates: record = SeqRecord(sequence_object, id='123456789', name='UnitTest', description='Test case for date parsing') record.annotations["date"] = invalid_date handle = StringIO() SeqIO.write(record, handle, 'genbank') handle.seek(0) gb = SeqIO.read(handle, "gb") self.assertEqual(gb.annotations["date"], "01-JAN-1980") class LineOneTests(unittest.TestCase): """Check GenBank/EMBL topology / molecule_type parsing.""" def test_topology_genbank(self): """Check GenBank LOCUS line parsing.""" # This is a bit low level, but can test pasing the LOCUS line only tests = [ ("LOCUS U00096", None, None, None, None), # This example is actually fungal, accession U49845 from Saccharomyces cerevisiae: ("LOCUS SCU49845 5028 bp DNA PLN 21-JUN-1999", None, "DNA", "PLN", None), ("LOCUS AB070938 6497 bp DNA linear BCT 11-OCT-2001", "linear", "DNA", "BCT", None), ("LOCUS NC_005816 9609 bp DNA circular BCT 21-JUL-2008", "circular", "DNA", "BCT", None), ("LOCUS SCX3_BUTOC 64 aa linear INV 16-OCT-2001", "linear", None, "INV", None), ("LOCUS pEH010 5743 bp DNA circular", "circular", "DNA", None, [BiopythonParserWarning]), ] for (line, topo, mol_type, div, warning_list) in tests: with warnings.catch_warnings(record=True) as caught: warnings.simplefilter("always") scanner = Scanner.GenBankScanner() consumer = GenBank._FeatureConsumer(1, GenBank.FeatureValueCleaner) scanner._feed_first_line(consumer, line) t = consumer.data.annotations.get('topology', None) self.assertEqual(t, topo, "Wrong topology %r not %r from %r" % (t, topo, line)) mt = consumer.data.annotations.get('molecule_type', None) self.assertEqual(mt, mol_type, "Wrong molecule_type %r not %r from %r" % (mt, mol_type, line)) d = consumer.data.annotations.get('data_file_division', None) self.assertEqual(d, div, "Wrong division %r not %r from %r" % (d, div, line)) if warning_list is None: self.assertEqual(len(caught), 0) else: self.assertEqual(len(caught), len(warning_list)) for i, warning_class in enumerate(warning_list): self.assertEqual(caught[i].category, warning_class) def test_topology_embl(self): """Check EMBL ID line parsing.""" # This is a bit low level, but can test pasing the ID line only tests = [ # Modern examples with sequence version ("ID X56734; SV 1; linear; mRNA; STD; PLN; 1859 BP.", "linear", "mRNA", "PLN"), ("ID CD789012; SV 4; linear; genomic DNA; HTG; MAM; 500 BP.", "linear", "genomic DNA", "MAM"), # Example to match GenBank example used above: ("ID U49845; SV 1; linear; genomic DNA; STD; FUN; 5028 BP.", "linear", "genomic DNA", "FUN"), # Old examples: ("ID BSUB9999 standard; circular DNA; PRO; 4214630 BP.", "circular", "DNA", "PRO"), ("ID SC10H5 standard; DNA; PRO; 4870 BP.", None, "DNA", "PRO"), # Patent example from 2016-06-10 # ftp://ftp.ebi.ac.uk/pub/databases/embl/patent/ ("ID A01679; SV 1; linear; unassigned DNA; PAT; MUS; 12 BP.", "linear", "unassigned DNA", "MUS"), # Old patent examples ("ID NRP_AX000635; PRT; NR1; 15 SQ", None, None, "NR1"), ("ID NRP0000016E; PRT; NR2; 5 SQ", None, None, "NR2"), # KIPO patent examples ("ID DI500001 STANDARD; PRT; 111 AA.", None, None, None), ("ID DI644510 standard; PRT; 1852 AA.", None, None, None), ] for (line, topo, mol_type, div) in tests: scanner = Scanner.EmblScanner() consumer = GenBank._FeatureConsumer(1, GenBank.FeatureValueCleaner) scanner._feed_first_line(consumer, line) t = consumer.data.annotations.get('topology', None) self.assertEqual(t, topo, "Wrong topology %r not %r from %r" % (t, topo, line)) mt = consumer.data.annotations.get('molecule_type', None) self.assertEqual(mt, mol_type, "Wrong molecule_type %r not %r from %r" % (mt, mol_type, line)) d = consumer.data.annotations.get('data_file_division', None) self.assertEqual(d, div, "Wrong division %r not %r from %r" % (d, div, line)) def test_first_line_imgt(self): """Check IMGT ID line parsing.""" # This is a bit low level, but can test pasing the ID line only tests = [ ("ID HLA00001 standard; DNA; HUM; 3503 BP.", None, "DNA", "HUM"), ("ID HLA00001; SV 1; standard; DNA; HUM; 3503 BP.", None, "DNA", "HUM"), ] for (line, topo, mol_type, div) in tests: scanner = Scanner._ImgtScanner() consumer = GenBank._FeatureConsumer(1, GenBank.FeatureValueCleaner) scanner._feed_first_line(consumer, line) t = consumer.data.annotations.get('topology', None) self.assertEqual(t, topo, "Wrong topology %r not %r from %r" % (t, topo, line)) mt = consumer.data.annotations.get('molecule_type', None) self.assertEqual(mt, mol_type, "Wrong molecule_type %r not %r from %r" % (mt, mol_type, line)) d = consumer.data.annotations.get('data_file_division', None) self.assertEqual(d, div, "Wrong division %r not %r from %r" % (d, div, line)) class OutputTests(unittest.TestCase): """GenBank output tests.""" def test_mad_dots(self): """Writing and reading back accesssion.version variants.""" for identifier in ["example", "example.1a", "example.1.2", "example.1-2", ]: old = SeqRecord(Seq("ACGT", generic_dna), id=identifier, name=identifier, description="mad dots") new = SeqIO.read(StringIO(old.format("gb")), "gb") self.assertEqual(old.id, new.id) self.assertEqual(old.name, new.name) self.assertEqual(old.description, new.description) self.assertEqual(old.seq, new.seq) def test_seqrecord_default_description(self): """Read in file using SeqRecord default description.""" old = SeqRecord(Seq("ACGT", generic_dna), id="example", name="short") self.assertEqual(old.description, "") txt = old.format("gb") self.assertIn("DEFINITION .\n", txt) new = SeqIO.read(StringIO(txt), "gb") self.assertEqual(old.id, new.id) self.assertEqual(old.name, new.name) self.assertEqual("", new.description) self.assertEqual(old.seq, new.seq) # Evil hack with 000 to manipulate sort order to ensure this is tested # first (otherwise something silences the warning) def test_000_write_invalid_but_parsed_locus_line(self): """Make sure we survive writing slightly invalid LOCUS lines we could parse.""" # grab a valid file with open(path.join('GenBank', 'NC_005816.gb'), 'r') as handle: lines = handle.readlines() # futz with the molecule type to make it lower case invalid_line = "LOCUS NC_005816 9609 bp dna circular BCT 21-JUL-2008\n" lines[0] = invalid_line fake_handle = StringIO("".join(lines)) # Make sure parsing this actually raises a warning with warnings.catch_warnings(record=True) as caught: warnings.simplefilter("always") rec = SeqIO.read(fake_handle, 'genbank') self.assertEqual(len(caught), 1) self.assertEqual(caught[0].category, BiopythonParserWarning) self.assertEqual(str(caught[0].message), "Non-upper case molecule type in LOCUS line: dna") out_handle = StringIO() ret = SeqIO.write([rec], out_handle, 'genbank') self.assertEqual(ret, 1) out_handle.seek(0) out_lines = out_handle.readlines() self.assertEqual(out_lines[0], invalid_line) if __name__ == "__main__": runner = unittest.TextTestRunner(verbosity=2) unittest.main(testRunner=runner)