#!/usr/bin/env python # Copyright 2000 by Thomas Sicheritz-Ponten. # Copyrigth 2016 by Markus Piotrowski. # All rights reserved. # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. # Created: Thu Jul 13 14:07:25 2000 # thomas@cbs.dtu.dk, http://www.cbs.dtu.dk/thomas """BLAST code for graphical Xbbtools tool.""" import glob import os import sys import subprocess import tkinter as tk import tkinter.ttk as ttk from tkinter import filedialog from tkinter import messagebox from xbb_utils import NotePad import xbb_blastbg class BlastIt: """Local BLAST integration for xbbtools.""" nin, pin = [], [] blast_ok = False blast_path = "" def __init__(self, seq, parent=None): """Set up new top-level window for BLAST search.""" self.seq = seq self.parent = parent self.toplevel = tk.Toplevel(parent) self.toplevel.title("BLAST parameters") if not self.get_blast_databases() or not self.get_blast_binaries(): return self.Choices() self.dbs.bind("<>", self.Validate) self.blasts.bind("<>", self.Validate) def get_blast_databases(self): """Try to locate the BLAST databases and put into lists.""" if not (BlastIt.nin and BlastIt.pin): pin, nin = [], [] try: pin.extend(glob.glob(os.environ["BLASTDB"] + "/*.pin")) except KeyError: pass pin.extend(glob.glob("C:*.pin")) try: nin.extend(glob.glob(os.environ["BLASTDB"] + "/*.nin")) except KeyError: pass # If no system variable BLASTDB exists, give user the chance to # locate his database folder: if not (nin and pin): database_folder = filedialog.askdirectory( title="Please locate your BLAST database(s) folder:" ) nin.extend(glob.glob(database_folder + "/*.nin")) pin.extend(glob.glob(database_folder + "/*.pin")) if not (nin and pin): messagebox.showerror( "xbb tools", "This folder does not contain any BLAST databases!" ) self.toplevel.destroy() return False self.pin = [os.path.splitext(x)[0] for x in pin] self.nin = [os.path.splitext(x)[0] for x in nin] BlastIt.pin = self.pin BlastIt.nin = self.nin return True def get_blast_binaries(self): """Test if BLAST binaries are in PATH or let user locate them.""" if not BlastIt.blast_ok: # Test if blast binaries are in path if subprocess.call( ["blastn", "-version"] ): # Return of non-zero means error self.blast_path = filedialog.askdirectory( title="Please locate your BLAST program folder:" ) if subprocess.call( [os.path.join(self.blast_path, "blastn"), "-version"] ): messagebox.showerror( "xbb tools", "Wrong folder or missing BLAST" " binaries!\n To run BLAST you must install the " " standalone BLAST binaries.", ) self.toplevel.destroy() return False else: BlastIt.blast_ok = True else: # BLAST binaries are in PATH BlastIt.blast_ok = True self.blast_path = "" BlastIt.blast_path = self.blast_path self.toplevel.lift() return True def database_readable(self, db_paths): """Return the name of the blast database without path and extension.""" db_names = [entry.split(os.sep)[-1].split(".")[0] for entry in db_paths] return db_names def convert_dbname_to_dbpath(self, db_name): """Return the full path for a given blast database name.""" database_path = "" for database in self.nin: if database.endswith(db_name): database_path = database break for database in self.pin: if database.endswith(db_name): database_path = database break return database_path def Choices(self): """Set up window to select BLAST program and database.""" self.blast_string = tk.StringVar() self.blast_string.set("blastn") self.cf = ttk.Frame(self.toplevel) self.cf.pack(side="top", expand=1, fill="x") self.dbs_frame = ttk.LabelFrame(self.cf, text="Databases") self.dbs_frame.pack(side="left", padx=5, pady=5, expand=1, fill="x") nin_values = self.database_readable(self.nin) pin_values = self.database_readable(self.pin) self.dbs = ttk.Combobox( self.dbs_frame, exportselection=0, values=nin_values + pin_values ) self.dbs.current(0) self.blast_frame = ttk.LabelFrame(self.cf, text="BLAST programs") self.blast_frame.pack(side="left", padx=5, pady=5, expand=1, fill="x") self.blasts = ttk.Combobox( self.blast_frame, exportselection=0, textvariable=self.blast_string, values=["blastn", "blastp", "blastx", "tblastn", "tblastx"], ) self.dbs.pack(side="left", padx=5, pady=5, expand=1, fill="x") self.blasts.pack(side="left", padx=5, pady=5, expand=1, fill="x") self.option_f = ttk.LabelFrame(self.cf, text="Command line options") self.option_f.pack(side="left", padx=5, pady=5, expand=1, fill="x") self.option = ttk.Entry(self.option_f) self.option.pack(side="left", padx=5, pady=5, fill="x", expand=1) self.ok = ttk.Button(self.cf, text="Run", command=self._Run, state="disabled") self.ok.pack(side="right") self.Validate() def Validate(self, *args): """Check everything and enable/disable 'Run' button.""" db = self.convert_dbname_to_dbpath(self.dbs.get()) prog = self.blasts.get() if (prog in ["blastn", "tblastx", "tblastn"]) == (db in self.nin): self.ok.config(state="normal") elif (prog in ["blastp", "blastx"]) == (db in self.pin): self.ok.config(state="normal") else: self.ok.config(state="disabled") def _Run(self): """Initialise options for Blast commandline (PRIVATE).""" command_options = self.option.get() options = "" if len(command_options.strip()): options = command_options.strip() db = self.convert_dbname_to_dbpath(self.dbs.get()) prog = self.blast_path + self.blasts.get() self.command_data = [self.seq, prog, db, options] self.Run() def Run(self): """Open new notepad and initialize running BLAST.""" self.notepad = NotePad() tid = self.notepad.tid self.toplevel.destroy() blastbg = xbb_blastbg.BlastDisplayer(self.command_data, tid) blastbg.RunCommand() if __name__ == "__main__": try: seq = sys.argv[1] except IndexError: # Started script without providing a sequence seq = "ATGACAAAGCTAATTATTCACTTGGTTTCAGACTCTTCTGTGCAAACTGC" win = tk.Tk() win.title("Dummy windows for BLAST test") test = BlastIt(seq) win.mainloop()