# STOCKHOLM 1.0 #=GF AC RF01113 #=GF ID BMV3_UPD-PK3 #=GF DE Pseudoknot of upstream pseudoknot domain (UPD) of the 3'UTR #=GF AU Wilkinson A; 0000-0001-7406-0151 #=GF SE Pseudobase #=GF SS Pseudobase #=GF GA 36.00 #=GF TC 37.00 #=GF NC 33.30 #=GF TP Cis-reg; #=GF BM cmbuild -F CM SEED #=GF CB cmcalibrate --mpi CM #=GF SM cmsearch --cpu 4 --verbose --nohmmonly -T 28.00 -Z 549862.597050 CM SEQDB #=GF DR PKBASE; PKB00156; #=GF DR SO; 0005836; regulatory_region; #=GF DR GO; 1904973; positive regulation of viral translation; #=GF DR GO; 0046782; regulation of viral transcription; #=GF RN [1] #=GF RM 7684465 #=GF RT Contributions of the brome mosaic virus RNA-3 3'-nontranslated region to #=GF RT replication and translation. #=GF RA Lahser FC, Marsh LE, Hall TC #=GF RL J Virol. 1993;67:3295-3303. #=GF WK UPSK_RNA #=GF ** seedtax: Viruses; unclassified sequences #=GF SQ 2 X01678.1/2648-2670 ACUUUGGCUAAGUUUAAAAGCUU X58459.1/659-681 ACUUUGGCUAAGGUUAAAAGCUU #=GC SS_cons :<<<_AAAA>>>::::::aaaa: #=GC RF ACUUUGGCUAAGuUUAAAAGCUU //