# STOCKHOLM 1.0

#=GF AC   RF00115
#=GF ID   McaS
#=GF PI   IS061;
#=GF DE   McaS/IsrA RNA
#=GF AU   Argasinska J; 0000-0003-2678-2824
#=GF SE   Argasinska J
#=GF SS   Predicted; 22289118
#=GF GA   42.00
#=GF TC   42.10
#=GF NC   38.70
#=GF TP   Gene; sRNA;
#=GF BM   cmbuild -n -F CM SEED
#=GF CB   cmcalibrate --mpi CM
#=GF SM   cmsearch --cpu 4 --verbose --nohmmonly -T 30.00 -Z 604040.189692 --mxsize
#=GF SM   128 CM SEQDB
#=GF CL   CL00106
#=GF DR   SO; 0001263; ncRNA_gene;
#=GF DR   GO; 0005515; protein binding;
#=GF DR   GO; 0006417; regulation of translation;
#=GF RN   [1]
#=GF RM   12069726
#=GF RT   A bioinformatics based approach to discover small RNA genes in the
#=GF RT   Escherichia coli genome.
#=GF RA   Chen S, Lesnik EA, Hall TA, Sampath R, Griffey RH, Ecker DJ, Blyn LB
#=GF RL   Biosystems 2002;65:157-177.
#=GF RN   [2]
#=GF RM   23666921
#=GF RT   Dual function of the McaS small RNA in controlling biofilm formation.
#=GF RA   Jorgensen MG, Thomason MK, Havelund J, Valentin-Hansen P, Storz G
#=GF RL   Genes Dev. 2013;27:1132-1145.
#=GF RN   [3]
#=GF RM   22289118
#=GF RT   A small RNA that regulates motility and biofilm formation in response to
#=GF RT   changes  in nutrient availability in Escherichia coli.
#=GF RA   Thomason MK, Fontaine F, De Lay N, Storz G
#=GF RL   Mol Microbiol. 2012;84:17-35.
#=GF RN   [4]
#=GF RM   26609136
#=GF RT   Ribonucleoprotein particles of bacterial small non-coding RNA IsrA (IS61
#=GF RT   or McaS) and its interaction with RNA polymerase core may link
#=GF RT   transcription to mRNA fate.
#=GF RA   van Nues RW, Castro-Roa D, Yuzenkova Y, Zenkin N
#=GF RL   Nucleic Acids Res. 2016;44:2577-2592.
#=GF CC   This family consists of several bacterial RNA genes which are found
#=GF CC   between the abgR and ydaL genes in Escherichia coli and Shigella
#=GF CC   flexneri.[1] It was discovered using a computational screen of the E. coli
#=GF CC   genome.[1] Subsequent characterisation of ISO61 region has revealed that
#=GF CC   the reverse strand is actually a CsrA binding ncRNA called McaS and that
#=GF CC   it has a role in biofilm formation control.[2] Furthermore, it has been
#=GF CC   shown that McaS(IsrA) exists as a ribonucleoprotein particles (sRNPs),
#=GF CC   which involve a defined set of proteins including Hfq, S1, CsrA, ProQ and
#=GF CC   PNPase.[4]
#=GF WK   IS061_RNA
#=GF SQ   4



CP000036.1/1703842-1703937 ACCGGCGCAGAGGAGACAAUGCCGGACUUAAGACGCGGAUGCACUGCUGUGUGUACUGUAGAGUCUGGCGGAUGUCGACAGACUCUAUUUUUUUAU
U00096.3/1405751-1405656   ACCGGCGCAGAGGAGACAAUGCCGGAUUUAAGACGCGGAUGCACUGCUGUGUGUACUGUAGAGUCUGGCGGAUGUCGACAGACUCUAUUUUUUUAU
CP000034.1/1309299-1309204 ACCGGUCACCAGGACCCCAGGCCGGAUUUAAGACGAGGAUGCACUGCUGUGUGUACUGUAGAGUCUGGCGGAUGUCGACAGGCUCUAUUUUUUUAU
CP011132.1/1732716-1732810 ACCCGCCACACGGAAUAAUAACGGGAACACAUG-AAGGAUAAACUGCUGUGUGUACUGUAGAGUCUGGCGGAUGUCGACAGGCUCUAUUUUUUUAU
#=GC SS_cons               :<<<<<<____________>>>>>>,,,,,,,<<<<<<________>>>>>>-----<<<<<<<<<<-<<_____>>->>>>>>>>>>::::::::
#=GC RF                    ACCgGccaaaaGGAaacaaggCcGGAuuuaAgaCgcgGAUgcACUGCugcGuGUACUguaGaGuCuGGCGGAUGUCGACaGaCuCuauUUUUUUAU
//