#!/usr/bin/env python from os import getcwd, remove, rmdir import tempfile, shutil from cogent.util.unit_test import TestCase, main from cogent.app.vienna_package import RNAfold, RNAsubopt, RNAplot,\ plot_from_seq_and_struct, DataError, get_constrained_fold, \ get_secondary_structure __author__ = "Sandra Smit" __copyright__ = "Copyright 2007-2012, The Cogent Project" __credits__ = ["Sandra Smit", "Rob Knight", "Jeremy Widmann"] __license__ = "GPL" __version__ = "1.5.3" __maintainer__ = "Sandra Smit" __email__ = "sandra.smit@colorado.edu" __status__ = "Development" class RNAfoldTests(TestCase): """Tests for the RNAfold application controller""" def setUp(self): self.unnamed_seq = ['AUAGCUAGCUAUGCGCUAGC','ACGGCUAUAGCUAGCGA',\ 'gcuagcuauuauauaua'] self.named_seq = ['>namedseq1','AUAGCUAGCUAUGCGCUAGC','>namedseq2',\ 'ACGGCUAUAGCUAGCGA'] self.mixed_seq = ['>namedseq1','AUAGCUAGCUAUGCGCUAGC', 'ACGGCUAUAGCUAGCGA','gcuagcuauuauauaua'] self.mixed_seq2 = ['>namedseq2','AUAGCUAGCUAUGCGCUAGC', 'ACGGCUAUAGCUAGCGA','gcuagcuauuauauaua'] self.temp_dir = '/tmp/test_rnafold' def test_base_command(self): """RNAfold: BaseCommand should be ok for different parameter settings""" r = RNAfold() working_dir = getcwd() obs = r.BaseCommand.split() exp = ['cd','"%s/";' % getcwd(),'RNAfold','-d1','-T','37','-S','1.07'] self.assertEqualItems(obs, exp) r.Parameters['-noLP'].on() obs = r.BaseCommand.split() exp = ['cd','"%s/";' % getcwd(),'RNAfold','-d1','-noLP','-T','37',\ '-S','1.07'] self.assertEqualItems(obs, exp) r.Parameters['Temp'].on(15) obs = r.BaseCommand.split() exp = ['cd','"%s/";' % getcwd(),'RNAfold','-d1','-noLP','-T','15', \ '-S','1.07'] self.assertEqualItems(obs, exp) r.Parameters['-d'].off() obs = r.BaseCommand.split() exp = ['cd','"%s/";' % getcwd(),'RNAfold','-noLP','-T','15','-S','1.07'] self.assertEqualItems(obs, exp) def test_changing_working_dir(self): """RNAfold: BaseCommand should be ok after changing the working dir""" #changing in initialization temp_dir = tempfile.mkdtemp() r = RNAfold(WorkingDir=temp_dir) self.assertEqual(r.BaseCommand,\ 'cd "%s/"; RNAfold -d1 -T 37 -S 1.07'%(temp_dir)) #changing afterwards r = RNAfold() r.WorkingDir = temp_dir self.assertEqual(r.BaseCommand,\ 'cd "%s/"; RNAfold -d1 -T 37 -S 1.07'%(temp_dir)) rmdir(temp_dir) def test_stdout(self): """RNAfold: StdOut should be as expected""" r = RNAfold() exp = '\n'.join(['>namedseq1','AUAGCUAGCUAUGCGCUAGC',\ '...((((((.....)))))) ( -8.30)','ACGGCUAUAGCUAGCGA',\ '...((((....)))).. ( -3.20)','GCUAGCUAUUAUAUAUA',\ '................. ( 0.00)'])+'\n' res = r(self.mixed_seq) obs = res['StdOut'].read() self.assertEqual(obs,exp) res.cleanUp() def test_stdout_input_as_path(self): """RNAfold: StdOut with input_as_path""" r = RNAfold(InputHandler='_input_as_path') f = open('/tmp/rnatestfile','w') f.write('\n'.join(self.mixed_seq2)) f.close() exp = '\n'.join(['>namedseq2','AUAGCUAGCUAUGCGCUAGC',\ '...((((((.....)))))) ( -8.30)','ACGGCUAUAGCUAGCGA',\ '...((((....)))).. ( -3.20)','GCUAGCUAUUAUAUAUA',\ '................. ( 0.00)'])+'\n' res = r('/tmp/rnatestfile') obs = res['StdOut'].read() self.assertEqual(obs,exp) res.cleanUp() remove('/tmp/rnatestfile') def test_stdout_input_as_path_space(self): """RNAfold: StdOut with input_as_path and space in filename""" r = RNAfold(InputHandler='_input_as_path') f = open('/tmp/rna test file','w') f.write('\n'.join(self.mixed_seq2)) f.close() exp = '\n'.join(['>namedseq2','AUAGCUAGCUAUGCGCUAGC',\ '...((((((.....)))))) ( -8.30)','ACGGCUAUAGCUAGCGA',\ '...((((....)))).. ( -3.20)','GCUAGCUAUUAUAUAUA',\ '................. ( 0.00)'])+'\n' res = r('/tmp/rna test file') obs = res['StdOut'].read() self.assertEqual(obs,exp) res.cleanUp() remove('/tmp/rna test file') def test_get_result_paths_unnamed_seq(self): """RNAfold: _get_result_paths() should work on unnamed seq""" r = RNAfold() res = r(self.unnamed_seq) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus','SS','DP']) self.failUnless(res['DP'] is None) self.failUnless(res['SS'] is not None) self.failUnless(res['StdOut'] is not None) self.failUnless(res['StdErr'] is None) self.assertEqual(res['ExitStatus'],0) res.cleanUp() def test_get_result_paths_named_seq(self): """RNAfold: _get_result_paths() should work on named seq""" r = RNAfold() res = r(self.named_seq) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus','SS','DP','namedseq1_ss',\ 'namedseq2_ss','namedseq1_dp','namedseq2_dp']) res.cleanUp() def test_get_result_paths_mixed_seq(self): """RNAfold: _get_result_paths() should work on partly named seq""" r = RNAfold() res = r(self.mixed_seq) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus','SS','DP','namedseq1_ss',\ 'namedseq1_dp']) res.cleanUp() def test_get_result_paths_parameter(self): """RNAfold: _get_result_paths() should work with diff parameters""" r = RNAfold() r.Parameters['-p'].on() res = r(self.unnamed_seq) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus','SS','DP']) self.failUnless(res['DP'] is not None) self.failUnless(res['SS'] is not None) self.failUnless(res['StdOut'] is not None) self.failUnless(res['StdErr'] is None) self.assertEqual(res['ExitStatus'],0) res.cleanUp() def test_get_result_paths_working_dir(self): """RNAfold: _get_result_paths() should work with diff working dir""" r = RNAfold(WorkingDir=self.temp_dir) res = r(self.unnamed_seq) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus','SS','DP']) self.failUnless(res['DP'] is None) self.failUnless(res['SS'] is not None) self.failUnless(isinstance(res['SS'],file)) self.failUnless(res['StdOut'] is not None) self.failUnless(res['StdErr'] is None) self.assertEqual(res['ExitStatus'],0) res.cleanUp() def test_get_constrained_fold_bad_data(self): """get_constrained_fold should handle bad data.""" test_seq = 'AAACCCGGGUUU' constraint = '(((...)))' #Test empty sequence. self.assertRaises(ValueError, get_constrained_fold,\ '', constraint) #Test empty constraint string. self.assertRaises(ValueError, get_constrained_fold,\ test_seq, '') #Test different length sequence and constraint. self.assertRaises(ValueError, get_constrained_fold,\ test_seq, constraint) def test_get_constrained_fold(self): """get_constrained_fold should give correct result.""" test_seq = 'AAACCCGGGUUU' constraint = '(((......)))' expected_struct = '((((....))))' obs_seq, obs_struct, obs_energy = \ get_constrained_fold(test_seq,constraint) #Test get back correct seq and struct self.assertEqual(obs_seq, test_seq) self.assertEqual(obs_struct, expected_struct) def test_get_secondary_structure(self): """get_secondary_structure should give correct result.""" test_seq = 'AAACCCGGGUUU' expected_struct = '((((....))))' expected_energy = -0.80 obs_seq, obs_struct, obs_energy = \ get_secondary_structure(test_seq) #Test get back correct seq and struct self.assertEqual(obs_seq, test_seq) self.assertEqual(obs_struct, expected_struct) self.assertEqual(obs_energy, expected_energy) def test_zzz_general_cleanup(self): """Executed last, clean up temp_dir""" shutil.rmtree(self.temp_dir) class RNAsuboptTests(TestCase): """Tests for the RNAsubopt application controller""" def test_base_command(self): """RNAsubopt: BaseCommand should be ok for different parameter settings """ r = RNAsubopt() obs = r.BaseCommand.split() exp = ['cd','"%s/";' % getcwd(),'RNAsubopt','-e','1','-d2','-T','37'] self.assertEqualItems(obs, exp) r.Parameters['-nsp'].on('GA') obs = r.BaseCommand.split() exp = ['cd','"%s/";' % getcwd(),'RNAsubopt','-e','1','-d2','-nsp','GA',\ '-T','37'] self.assertEqualItems(obs, exp) r.Parameters['Temp'].on(15) obs = r.BaseCommand.split() exp = ['cd','"%s/";' % getcwd(),'RNAsubopt','-e','1','-d2','-nsp','GA',\ '-T','15'] self.assertEqualItems(obs, exp) r.Parameters['-d'].off() obs = r.BaseCommand.split() exp = ['cd','"%s/";' % getcwd(),'RNAsubopt','-e','1','-nsp','GA','-T',\ '15'] self.assertEqualItems(obs, exp) def test_changing_working_dir(self): """RNAsubopt: BaseCommand should be ok after changing the working dir """ temp_dir = tempfile.mkdtemp() #changing in initialization r = RNAsubopt(WorkingDir=temp_dir) self.assertEqual(r.BaseCommand,\ 'cd "%s/"; RNAsubopt -e 1 -d2 -T 37'%(temp_dir)) #changing afterwards r = RNAsubopt() r.WorkingDir = temp_dir self.assertEqual(r.BaseCommand,\ 'cd "%s/"; RNAsubopt -e 1 -d2 -T 37'%(temp_dir)) rmdir(temp_dir) def test_stdout(self): """RNAsubopt: StdOut should be as expected""" r = RNAsubopt() seq = ['AUAGCUAGCUAUGCGCUAGCGGAUUAGCUAGCUAGCGA',\ 'ucgaucgaucagcuagcuauuauauaua'] exp = '\n'.join( ['AUAGCUAGCUAUGCGCUAGCGGAUUAGCUAGCUAGCGA -1720 100', '.(((((((((.(((....)))....))))))))).... -16.20', '.(((((((((((.((....)).)).))))))))).... -17.20', '.((((((((((..((....))...)))))))))).... -16.60', '.((((((((((.((....))....)))))))))).... -16.40', '.(((((((((((((....)))...)))))))))).... -16.90', '.(((((((((((.((....)).).)))))))))).... -17.20', 'UCGAUCGAUCAGCUAGCUAUUAUAUAUA 0 100', '......(((.((....)))))....... 0.70', '..........((....)).......... 0.60', '..((....)).................. 0.90', '............................ 0.00']) + '\n' res = r(seq) obs = res['StdOut'].read() self.assertEqual(obs,exp) res.cleanUp() def test_stdout_input_as_path_space(self): """RNAsubopt: StdOut with input_as_path and space in filename""" mixed_seq2 = ['>namedseq2','AUAGCUAGCUAUGCGCUAGC', 'ACGGCUAUAGCUAGCGA','gcuagcuauuauauaua'] r = RNAsubopt(InputHandler='_input_as_path') f = open('/tmp/rna test file','w') f.write('\n'.join(mixed_seq2)) f.close() exp = '\n'.join(['> namedseq2 [100]', 'AUAGCUAGCUAUGCGCUAGC -830 100', '...((((((.....)))))) -8.30', 'ACGGCUAUAGCUAGCGA -320 100', '...(((......))).. -2.30', '...((((....)))).. -3.20', 'GCUAGCUAUUAUAUAUA 0 100', '................. 0.00'])+'\n' res = r('/tmp/rna test file') obs = res['StdOut'].read() self.assertEqual(obs,exp) res.cleanUp() remove('/tmp/rna test file') def test_get_result_paths(self): """RNAsubopt: _get_result_paths() should create the right dict entries """ r = RNAsubopt() seq = ['AUAGCUAGCUAUGCGCUAGCGGAUUAGCUAGCUAGCGA',\ 'ucgaucgaucagcuagcuauuauauaua'] res = r(seq) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus']) self.failUnless(res['StdOut'] is not None) self.failUnless(res['StdErr'] is None) self.assertEqual(res['ExitStatus'],0) res.cleanUp() r = RNAsubopt({'-s':None,'-lodos':None,'-d':3,'-logML':None,\ '-noLP':None,'-4':None,'-noGU':None,'-noCloseGU':None}) res = r(seq) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus']) self.failUnless(res['StdOut'] is not None) self.failUnless(res['StdErr'] is None) #self.assertEqual(res['ExitStatus'],0) #platform-dependent? res.cleanUp() class RNAplotTests(TestCase): """Tests for the RNAplot application controller""" def setUp(self): self.unnamed_seqs = ['AUAGCUAGCUAUGCGCUAGC','...((((((.....))))))',\ 'ACGGCUAUAGCUAGCGA','...((((....))))..',\ 'gcuagcuauuauauaua','.................'] self.named_seqs = \ ['>namedseq1','AUAGCUAGCUAUGCGCUAGC','...((((((.....))))))',\ '>namedseq2','ACGGCUAUAGCUAGCGA','...((((....))))..'] self.mixed_seqs = \ ['>namedseq1','AUAGCUAGCUAUGCGCUAGC','...((((((.....))))))',\ 'ACGGCUAUAGCUAGCGA','...((((....))))..',\ 'gcuagcuauuauauaua','.................'] self.named_seq = \ ['>namedseq','AUAGCUAGCUAUGCGCUAGC','...((((((.....))))))'] self.standard_name = 'namedseq' self.standard_seq = 'AUAGCUAGCUAUGCGCUAGC' self.standard_struct = '...((((((.....))))))' self.bad_pairing_struct = '...((((((.....)))...' self.bad_chars_struct = '...((((((.....)xx)))' self.short_struct = '...((((((..))))))' self.temp_dir = '/tmp/test_rnaplot' def test_base_command(self): """RNAplot: BaseCommand should be ok for different parameter settings""" r = RNAplot() working_dir = getcwd() self.assertEqual(r.BaseCommand,\ ''.join(['cd "',getcwd(),'/"; ','RNAplot'])) r.Parameters['-t'].on(0) self.assertEqual(r.BaseCommand,\ ''.join(['cd "',getcwd(),'/"; ','RNAplot -t 0'])) r.Parameters['-o'].on('svg') self.assertEqual(r.BaseCommand,\ ''.join(['cd "',getcwd(),'/"; ','RNAplot -t 0 -o svg'])) r.Parameters['-t'].off() self.assertEqual(r.BaseCommand,\ ''.join(['cd "',getcwd(),'/"; ','RNAplot -o svg'])) def test_changing_working_dir(self): """RNAplot: BaseCommand should be ok after changing the working dir""" #changing in initialization temp_dir = tempfile.mkdtemp() r = RNAplot(WorkingDir=temp_dir) self.assertEqual(r.BaseCommand,\ 'cd "%s/"; RNAplot'%(temp_dir)) #changing afterwards r = RNAplot() r.WorkingDir = temp_dir self.assertEqual(r.BaseCommand,\ 'cd "%s/"; RNAplot'%(temp_dir)) rmdir(temp_dir) def test_get_result_paths_unnamed_seq(self): """RNAplot: _get_result_paths() should work on unnamed seq""" r = RNAplot() res = r(self.unnamed_seqs) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus','SS']) self.failUnless(res['SS'] is not None) self.failUnless(res['StdOut'] is not None) self.failUnless(res['StdErr'] is None) self.assertEqual(res['ExitStatus'],0) res.cleanUp() def test_get_result_paths_named_seq(self): """RNAplot: _get_result_paths() should work on named seq""" r = RNAplot() res = r(self.named_seqs) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus','namedseq1_ss',\ 'namedseq2_ss']) res.cleanUp() def test_get_result_paths_mixed_seq(self): """RNAplot: _get_result_paths() should work on partly named seq""" r = RNAplot() res = r(self.mixed_seqs) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus','SS','namedseq1_ss']) res.cleanUp() def test_get_result_paths_parameter(self): """RNAplot: _get_result_paths() should work with diff parameters""" r = RNAplot() r.Parameters['-t'].on(0) res = r(self.unnamed_seqs) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus','SS']) self.failUnless(res['SS'] is not None) self.failUnless(res['StdOut'] is not None) self.failUnless(res['StdErr'] is None) self.assertEqual(res['ExitStatus'],0) res.cleanUp() def test_get_result_paths_working_dir(self): """RNAplot: _get_result_paths() should work with diff working dir""" r = RNAplot(WorkingDir=self.temp_dir) res = r(self.unnamed_seqs) self.assertEqualItems(res.keys(),\ ['StdOut','StdErr','ExitStatus','SS']) self.failUnless(res['SS'] is not None) self.failUnless(isinstance(res['SS'],file)) self.failUnless(res['StdOut'] is not None) self.failUnless(res['StdErr'] is None) self.assertEqual(res['ExitStatus'],0) res.cleanUp() def test_rnaplot_output(self): """RNAplot: calling RNAplot on data should give correct result.""" r = RNAplot(WorkingDir=self.temp_dir) res = r(self.named_seq) ps_plot = res['namedseq_ss'].read() observed_lines = ps_plot.split('\n') expected_lines = RNAPLOT_RES.split('\n') #First 8 lines depend on the runtime. Check after. self.assertEqual(observed_lines[8:],expected_lines[8:]) res.cleanUp() def test_plot_from_seq_and_struct_bad_data(self): """plot_from_seq_and_struct helper function should handle bad data. """ #Check bad Vienna Structure pairing self.assertRaises(IndexError, plot_from_seq_and_struct,\ self.standard_seq, self.bad_pairing_struct) #Check bad characters in Vienna Structure self.assertRaises(ValueError, plot_from_seq_and_struct,\ self.standard_seq, self.bad_chars_struct) #Check different lengths of seq and struct self.assertRaises(DataError, plot_from_seq_and_struct,\ self.standard_seq, self.short_struct) def test_plot_from_seq_and_struct(self): """plot_from_seq_and_struct helper function should give correct result. """ ps_plot = plot_from_seq_and_struct(self.standard_seq,\ self.standard_struct, seqname=self.standard_name) observed_lines = ps_plot.split('\n') expected_lines = RNAPLOT_RES.split('\n') #First 8 lines depend on the runtime. Check after. self.assertEqual(observed_lines[8:],expected_lines[8:]) def test_zzz_general_cleanup(self): """Executed last, clean up temp_dir""" shutil.rmtree(self.temp_dir) RNAPLOT_RES = """%!PS-Adobe-3.0 EPSF-3.0 %%Creator: PS_dot.c,v 1.38 2007/02/02 15:18:13 ivo Exp $, ViennaRNA-1.7.1 %%CreationDate: Tue Oct 21 15:44:50 2008 %%Title: RNA Secondary Structure Plot %%BoundingBox: 66 210 518 662 %%DocumentFonts: Helvetica %%Pages: 1 %%EndComments %Options: % to switch off outline pairs of sequence comment or % delete the appropriate line near the end of the file %%BeginProlog /RNAplot 100 dict def RNAplot begin /fsize 14 def /outlinecolor {0.2 setgray} bind def /paircolor {0.2 setgray} bind def /seqcolor {0 setgray} bind def /cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def /min { 2 copy gt { exch } if pop } bind def /max { 2 copy lt { exch } if pop } bind def /drawoutline { gsave outlinecolor newpath coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence currentdict /cutpoint known % check if cutpoint is defined {coor 0 cutpoint getinterval {aload pop lineto} forall % draw outline of 1st sequence coor cutpoint 1 add get aload pop 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence coor cutpoint 1 add coor length cutpoint 1 add sub getinterval {aload pop lineto} forall} % draw outline of 2nd sequence {coor {aload pop lineto} forall} % draw outline as a whole ifelse stroke grestore } bind def /drawpairs { paircolor 0.7 setlinewidth [9 3.01] 9 setdash newpath pairs {aload pop coor exch 1 sub get aload pop moveto coor exch 1 sub get aload pop lineto } forall stroke } bind def % draw bases /drawbases { [] 0 setdash seqcolor 0 coor { aload pop moveto dup sequence exch 1 getinterval cshow 1 add } forall pop } bind def /init { /Helvetica findfont fsize scalefont setfont 1 setlinejoin 1 setlinecap 0.8 setlinewidth 72 216 translate % find the coordinate range /xmax -1000 def /xmin 10000 def /ymax -1000 def /ymin 10000 def coor { aload pop dup ymin lt {dup /ymin exch def} if dup ymax gt {/ymax exch def} {pop} ifelse dup xmin lt {dup /xmin exch def} if dup xmax gt {/xmax exch def} {pop} ifelse } forall /size {xmax xmin sub ymax ymin sub max} bind def 72 6 mul size div dup scale size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div translate } bind def end %%EndProlog RNAplot begin % data start here /sequence (\\ AUAGCUAGCUAUGCGCUAGC\\ ) def /coor [ [100.992 114.290] [88.210 108.134] [86.994 93.999] [98.538 85.751] [105.046 72.236] [111.554 58.722] [118.062 45.207] [124.571 31.693] [131.079 18.178] [127.159 2.622] [136.992 -10.055] [153.034 -10.127] [162.981 2.461] [159.200 18.052] [144.593 24.686] [138.085 38.201] [131.577 51.716] [125.069 65.230] [118.560 78.745] [112.052 92.259] ] def /pairs [ [4 20] [5 19] [6 18] [7 17] [8 16] [9 15] ] def init % switch off outline pairs or bases by removing these lines drawoutline drawpairs drawbases % show it showpage end %%EOF """ if __name__ == '__main__': main()