#!/usr/bin/env python '''unit testing code for pysam. Execute in the :file:`tests` directory as it requires the Makefile and data files located there. ''' import pysam import pysam.samtools import unittest import os import shutil import sys import collections import subprocess import logging import array from TestUtils import checkBinaryEqual, checkURL, force_str DATADIR = "pysam_data" class BasicTestBAMFetch(unittest.TestCase): '''basic first test - detailed testing if information in file is consistent with information in AlignedRead object.''' def setUp(self): self.samfile = pysam.Samfile( os.path.join(DATADIR, "ex3.bam"), "rb") self.reads = list(self.samfile.fetch()) def testARqname(self): self.assertEqual( self.reads[0].qname, "read_28833_29006_6945", "read name mismatch in read 1: %s != %s" % ( self.reads[0].qname, "read_28833_29006_6945")) self.assertEqual( self.reads[1].qname, "read_28701_28881_323b", "read name mismatch in read 2: %s != %s" % ( self.reads[1].qname, "read_28701_28881_323b")) def testARflag(self): self.assertEqual( self.reads[0].flag, 99, "flag mismatch in read 1: %s != %s" % ( self.reads[0].flag, 99)) self.assertEqual( self.reads[1].flag, 147, "flag mismatch in read 2: %s != %s" % ( self.reads[1].flag, 147)) def testARrname(self): self.assertEqual( self.reads[0].rname, 0, "chromosome/target id mismatch in read 1: %s != %s" % (self.reads[0].rname, 0)) self.assertEqual( self.reads[1].rname, 1, "chromosome/target id mismatch in read 2: %s != %s" % (self.reads[1].rname, 1)) def testARpos(self): self.assertEqual( self.reads[0].pos, 33 - 1, "mapping position mismatch in read 1: %s != %s" % (self.reads[0].pos, 33 - 1)) self.assertEqual( self.reads[1].pos, 88 - 1, "mapping position mismatch in read 2: %s != %s" % (self.reads[1].pos, 88 - 1)) def testARmapq(self): self.assertEqual( self.reads[0].mapq, 20, "mapping quality mismatch in read 1: %s != %s" % (self.reads[0].mapq, 20)) self.assertEqual( self.reads[1].mapq, 30, "mapping quality mismatch in read 2: %s != %s" % ( self.reads[1].mapq, 30)) def testARcigar(self): self.assertEqual( self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)], "read name length mismatch in read 1: %s != %s" % (self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)])) self.assertEqual( self.reads[1].cigar, [(0, 35)], "read name length mismatch in read 2: %s != %s" % (self.reads[1].cigar, [(0, 35)])) def testARcigarstring(self): self.assertEqual(self.reads[0].cigarstring, '10M1D25M') self.assertEqual(self.reads[1].cigarstring, '35M') def testARmrnm(self): self.assertEqual( self.reads[0].mrnm, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].mrnm, 0)) self.assertEqual( self.reads[1].mrnm, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].mrnm, 1)) self.assertEqual( self.reads[0].rnext, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].rnext, 0)) self.assertEqual( self.reads[1].rnext, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].rnext, 1)) def testARmpos(self): self.assertEqual(self.reads[ 0].mpos, 200 - 1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].mpos, 200 - 1)) self.assertEqual(self.reads[ 1].mpos, 500 - 1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].mpos, 500 - 1)) self.assertEqual(self.reads[ 0].pnext, 200 - 1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].pnext, 200 - 1)) self.assertEqual(self.reads[ 1].pnext, 500 - 1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].pnext, 500 - 1)) def testARisize(self): self.assertEqual(self.reads[0].isize, 167, "insert size mismatch in read 1: %s != %s" % ( self.reads[0].isize, 167)) self.assertEqual(self.reads[1].isize, 412, "insert size mismatch in read 2: %s != %s" % ( self.reads[1].isize, 412)) self.assertEqual(self.reads[0].tlen, 167, "insert size mismatch in read 1: %s != %s" % ( self.reads[0].tlen, 167)) self.assertEqual(self.reads[1].tlen, 412, "insert size mismatch in read 2: %s != %s" % ( self.reads[1].tlen, 412)) def testARseq(self): self.assertEqual(self.reads[0].seq, "AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 1: %s != %s" % ( self.reads[0].seq, "AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG")) self.assertEqual(self.reads[1].seq, "ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "sequence size mismatch in read 2: %s != %s" % ( self.reads[1].seq, "ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA")) self.assertEqual(self.reads[3].seq, "AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 4: %s != %s" % ( self.reads[3].seq, "AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG")) def testARqual(self): self.assertEqual(self.reads[0].qual, "<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 1: %s != %s" % (self.reads[0].qual, "<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<")) self.assertEqual(self.reads[1].qual, "<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "quality string mismatch in read 2: %s != %s" % ( self.reads[1].qual, "<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<")) self.assertEqual(self.reads[3].qual, "<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 3: %s != %s" % (self.reads[3].qual, "<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<")) def testARquery(self): self.assertEqual(self.reads[0].query, "AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "query mismatch in read 1: %s != %s" % ( self.reads[0].query, "AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG")) self.assertEqual(self.reads[1].query, "ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "query size mismatch in read 2: %s != %s" % ( self.reads[1].query, "ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA")) self.assertEqual(self.reads[3].query, "TAGCTAGCTACCTATATCTTGGTCTT", "query mismatch in read 4: %s != %s" % ( self.reads[3].query, "TAGCTAGCTACCTATATCTTGGTCTT")) def testARqqual(self): self.assertEqual( self.reads[0].qqual, "<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "qquality string mismatch in read 1: %s != %s" % (self.reads[0].qqual, "<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<")) self.assertEqual( self.reads[1].qqual, "<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "qquality string mismatch in read 2: %s != %s" % (self.reads[1].qqual, "<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<")) self.assertEqual( self.reads[3].qqual, "<<<<<<<<<<<<<<<<<:<9/,&,22", "qquality string mismatch in read 3: %s != %s" % (self.reads[3].qqual, "<<<<<<<<<<<<<<<<<:<9/,&,22")) def testPresentOptionalFields(self): self.assertEqual( self.reads[0].opt('NM'), 1, "optional field mismatch in read 1, NM: %s != %s" % (self.reads[0].opt('NM'), 1)) self.assertEqual( self.reads[0].opt('RG'), 'L1', "optional field mismatch in read 1, RG: %s != %s" % (self.reads[0].opt('RG'), 'L1')) self.assertEqual( self.reads[1].opt('RG'), 'L2', "optional field mismatch in read 2, RG: %s != %s" % (self.reads[1].opt('RG'), 'L2')) self.assertEqual( self.reads[1].opt('MF'), 18, "optional field mismatch in read 2, MF: %s != %s" % (self.reads[1].opt('MF'), 18)) def testPairedBools(self): self.assertEqual(self.reads[0].is_paired, True, "is paired mismatch in read 1: %s != %s" % ( self.reads[0].is_paired, True)) self.assertEqual(self.reads[1].is_paired, True, "is paired mismatch in read 2: %s != %s" % ( self.reads[1].is_paired, True)) self.assertEqual(self.reads[0].is_proper_pair, True, "is proper pair mismatch in read 1: %s != %s" % ( self.reads[0].is_proper_pair, True)) self.assertEqual(self.reads[1].is_proper_pair, True, "is proper pair mismatch in read 2: %s != %s" % ( self.reads[1].is_proper_pair, True)) def testTags(self): self.assertEqual(self.reads[0].tags, [('NM', 1), ('RG', 'L1'), ('PG', 'P1'), ('XT', 'U')]) self.assertEqual(self.reads[1].tags, [('MF', 18), ('RG', 'L2'), ('PG', 'P2'), ('XT', 'R')]) def testAddTags(self): self.assertEqual(sorted(self.reads[0].tags), sorted([('NM', 1), ('RG', 'L1'), ('PG', 'P1'), ('XT', 'U')])) self.reads[0].setTag('X1', 'C') self.assertEqual(sorted(self.reads[0].tags), sorted([('X1', 'C'), ('NM', 1), ('RG', 'L1'), ('PG', 'P1'), ('XT', 'U'), ])) self.reads[0].setTag('X2', 5) self.assertEqual(sorted(self.reads[0].tags), sorted([('X2', 5), ('X1', 'C'), ('NM', 1), ('RG', 'L1'), ('PG', 'P1'), ('XT', 'U'), ])) # add with replacement self.reads[0].setTag('X2', 10) self.assertEqual(sorted(self.reads[0].tags), sorted([('X2', 10), ('X1', 'C'), ('NM', 1), ('RG', 'L1'), ('PG', 'P1'), ('XT', 'U'), ])) # add without replacement self.reads[0].setTag('X2', 5, replace=False) self.assertEqual(sorted(self.reads[0].tags), sorted([('X2', 10), ('X1', 'C'), ('X2', 5), ('NM', 1), ('RG', 'L1'), ('PG', 'P1'), ('XT', 'U'), ])) def testAddTagsType(self): self.reads[0].tags = None self.assertEqual(self.reads[0].tags, []) self.reads[0].setTag('X1', 5.0) self.reads[0].setTag('X2', "5.0") self.reads[0].setTag('X3', 5) self.assertEqual(sorted(self.reads[0].tags), sorted([('X1', 5.0), ('X2', "5.0"), ('X3', 5)])) # test setting float for int value self.reads[0].setTag('X4', 5, value_type='d') self.assertEqual(sorted(self.reads[0].tags), sorted([('X1', 5.0), ('X2', "5.0"), ('X3', 5), ('X4', 5.0)])) # test setting int for float value - the # value will be rounded. self.reads[0].setTag('X5', 5.2, value_type='i') self.assertEqual(sorted(self.reads[0].tags), sorted([('X1', 5.0), ('X2', "5.0"), ('X3', 5), ('X4', 5.0), ('X5', 5)])) # test setting invalid type code self.assertRaises(ValueError, self.reads[0].setTag, 'X6', 5.2, 'g') def testTagsUpdatingFloat(self): self.assertEqual(self.reads[0].tags, [('NM', 1), ('RG', 'L1'), ('PG', 'P1'), ('XT', 'U')]) self.reads[0].tags += [('XC', 5.0)] self.assertEqual(self.reads[0].tags, [('NM', 1), ('RG', 'L1'), ('PG', 'P1'), ('XT', 'U'), ('XC', 5.0)]) def testOpt(self): self.assertEqual(self.reads[0].opt("XT"), "U") self.assertEqual(self.reads[1].opt("XT"), "R") def testMissingOpt(self): self.assertRaises(KeyError, self.reads[0].opt, "XP") def testEmptyOpt(self): self.assertRaises(KeyError, self.reads[2].opt, "XT") def tearDown(self): self.samfile.close() class BasicTestBAMFile(BasicTestBAMFetch): def setUp(self): self.samfile = pysam.Samfile( os.path.join(DATADIR, "ex3.sam"), "r") self.reads = [r for r in self.samfile] class BasicTestSAMFile(BasicTestBAMFetch): def setUp(self): self.samfile = pysam.Samfile( os.path.join(DATADIR, "ex3.sam"), "r") self.reads = [r for r in self.samfile] class BasicTestSAMFetch(BasicTestBAMFetch): def setUp(self): self.samfile = pysam.Samfile( os.path.join(DATADIR, "ex3.sam"), "r") self.reads = list(self.samfile.fetch()) # needs to be implemented # class TestAlignedReadFromSamWithoutHeader(TestAlignedReadFromBam): # # def setUp(self): # self.samfile=pysam.Samfile( "ex7.sam","r" ) # self.reads=list(self.samfile.fetch()) class TestIO(unittest.TestCase): '''check if reading samfile and writing a samfile are consistent.''' def checkEcho(self, input_filename, reference_filename, output_filename, input_mode, output_mode, use_template=True): '''iterate through *input_filename* writing to *output_filename* and comparing the output to *reference_filename*. The files are opened according to the *input_mode* and *output_mode*. If *use_template* is set, the header is copied from infile using the template mechanism, otherwise target names and lengths are passed explicitly. ''' infile = pysam.Samfile(os.path.join(DATADIR, input_filename), input_mode) if use_template: outfile = pysam.Samfile(output_filename, output_mode, template=infile) else: outfile = pysam.Samfile(output_filename, output_mode, referencenames=infile.references, referencelengths=infile.lengths, add_sq_text=False) iter = infile.fetch() for x in iter: outfile.write(x) infile.close() outfile.close() self.assertTrue( checkBinaryEqual(os.path.join(DATADIR, reference_filename), output_filename), "files %s and %s are not the same" % (reference_filename, output_filename)) def testReadWriteBam(self): input_filename = "ex1.bam" output_filename = "pysam_ex1.bam" reference_filename = "ex1.bam" self.checkEcho(input_filename, reference_filename, output_filename, "rb", "wb", use_template=True) # Disabled - should work, files are not binary equal, but are # non-binary equal: # diff <(samtools view pysam_ex1.bam) <(samtools view pysam_data/ex1.bam) # def testReadWriteBamWithTargetNames(self): # input_filename = "ex1.bam" # output_filename = "pysam_ex1.bam" # reference_filename = "ex1.bam" # self.checkEcho(input_filename, reference_filename, output_filename, # "rb", "wb", use_template=False) def testReadWriteSamWithHeader(self): input_filename = "ex2.sam" output_filename = "pysam_ex2.sam" reference_filename = "ex2.sam" self.checkEcho(input_filename, reference_filename, output_filename, "r", "wh") # Release 0.8.0 # no samfiles without header def testReadWriteSamWithoutHeader(self): input_filename = "ex2.sam" output_filename = "pysam_ex2.sam" reference_filename = "ex1.sam" self.checkEcho(input_filename, reference_filename, output_filename, "r", "w") def testReadSamWithoutTargetNames(self): '''see issue 104.''' input_filename = os.path.join(DATADIR, "example_unmapped_reads_no_sq.sam") # raise exception in default mode self.assertRaises(ValueError, pysam.Samfile, input_filename, "r") # raise exception if no SQ files self.assertRaises(ValueError, pysam.Samfile, input_filename, "r", check_header=True) infile = pysam.Samfile( input_filename, check_header=False, check_sq=False) # TODO # result = list(infile.fetch(until_eof=True)) # self.assertEqual(2, len(result)) def testReadBamWithoutTargetNames(self): '''see issue 104.''' input_filename = os.path.join( DATADIR, "example_unmapped_reads_no_sq.bam") # raise exception in default mode self.assertRaises(ValueError, pysam.Samfile, input_filename, "r") # raise exception if no SQ files self.assertRaises(ValueError, pysam.Samfile, input_filename, "r", check_header=True) infile = pysam.Samfile( input_filename, check_header=False, check_sq=False) result = list(infile.fetch(until_eof=True)) # TODO def testReadSamWithoutHeader(self): input_filename = os.path.join(DATADIR, "ex1.sam") # reading from a samfile without header is not # implemented self.assertRaises(ValueError, pysam.Samfile, input_filename, "r") # TODO # without check_header header is no read # leading to segfault # self.assertRaises(ValueError, # pysam.Samfile, # input_filename, # "r", # check_header=False) # TODO # def testReadUnformattedFile(self): # '''test reading from a file that is not bam/sam formatted''' # input_filename = os.path.join(DATADIR, 'Makefile') # # bam - file raise error # self.assertRaises(ValueError, # pysam.Samfile, # input_filename, # "rb") # # sam - file error, but can't fetch # self.assertRaises(ValueError, # pysam.Samfile, # input_filename, # "r") # self.assertRaises(ValueError, # pysam.Samfile, # input_filename, # "r", # check_header=False) def testBAMWithoutAlignedReads(self): '''see issue 117''' input_filename = os.path.join(DATADIR, "test_unaligned.bam") samfile = pysam.Samfile(input_filename, "rb", check_sq=False) samfile.fetch(until_eof=True) def testBAMWithShortBAI(self): '''see issue 116''' input_filename = os.path.join(DATADIR, "example_bai.bam") samfile = pysam.Samfile(input_filename, "rb", check_sq=False) samfile.fetch('chr2') def testFetchFromClosedFile(self): samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") samfile.close() self.assertRaises(ValueError, samfile.fetch, 'chr1', 100, 120) def testClosedFile(self): '''test that access to a closed samfile raises ValueError.''' samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") samfile.close() self.assertRaises(ValueError, samfile.fetch, 'chr1', 100, 120) self.assertRaises(ValueError, samfile.pileup, 'chr1', 100, 120) self.assertRaises(ValueError, samfile.getrname, 0) # TODO self.assertRaises(ValueError, samfile.tell) self.assertRaises(ValueError, samfile.seek, 0) self.assertRaises(ValueError, getattr, samfile, "nreferences") self.assertRaises(ValueError, getattr, samfile, "references") self.assertRaises(ValueError, getattr, samfile, "lengths") self.assertRaises(ValueError, getattr, samfile, "text") self.assertRaises(ValueError, getattr, samfile, "header") # write on closed file self.assertEqual(0, samfile.write(None)) def testAutoDetection(self): '''test if autodetection works.''' # TODO # samfile = pysam.Samfile(os.path.join(DATADIR, "ex3.sam")) # self.assertRaises(ValueError, samfile.fetch, 'chr1') # samfile.close() samfile = pysam.Samfile(os.path.join(DATADIR, "ex3.bam")) samfile.fetch('chr1') samfile.close() # TOOD # def testReadingFromSamFileWithoutHeader(self): # '''read from samfile without header. # ''' # samfile = pysam.Samfile(os.path.join(DATADIR, "ex7.sam"), # check_header=False, # check_sq=False) # self.assertRaises(NotImplementedError, samfile.__iter__) def testReadingFromFileWithoutIndex(self): '''read from bam file without index.''' shutil.copyfile(os.path.join(DATADIR, "ex2.bam"), 'tmp_ex2.bam') samfile = pysam.Samfile('tmp_ex2.bam', "rb") self.assertRaises(ValueError, samfile.fetch) self.assertEqual(len(list(samfile.fetch(until_eof=True))), 3270) os.unlink('tmp_ex2.bam') # def testReadingUniversalFileMode(self): # '''read from samfile without header. # ''' # input_filename = "ex2.sam" # output_filename = "pysam_ex2.sam" # reference_filename = "ex1.sam" # self.checkEcho(input_filename, # reference_filename, # output_filename, # "rU", "w") def testHead(self): '''test IteratorRowHead''' samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") l10 = list(samfile.head(10)) l100 = list(samfile.head(100)) self.assertEqual(len(l10), 10) self.assertEqual(len(l100), 100) self.assertEqual(list(map(str, l10)), list(map(str, l100[:10]))) class TestFloatTagBug(unittest.TestCase): '''see issue 71''' def testFloatTagBug(self): '''a float tag before another exposed a parsing bug in bam_aux_get. Fixed in 0.1.19 ''' samfile = pysam.Samfile(os.path.join(DATADIR, "tag_bug.bam")) read = next(samfile.fetch(until_eof=True)) self.assertTrue(('XC', 1) in read.tags) self.assertEqual(read.opt('XC'), 1) class TestLargeFieldBug(unittest.TestCase): '''see issue 100''' def testLargeFileBug(self): '''when creating a read with a large entry in the tag field causes an errror: NotImplementedError: tags field too large ''' samfile = pysam.Samfile(os.path.join(DATADIR, "issue100.bam")) read = next(samfile.fetch(until_eof=True)) new_read = pysam.AlignedRead() new_read.tags = read.tags self.assertEqual(new_read.tags, read.tags) class TestTagParsing(unittest.TestCase): '''tests checking the accuracy of tag setting and retrieval.''' def makeRead(self): a = pysam.AlignedRead() a.qname = "read_12345" a.tid = 0 a.seq = "ACGT" * 3 a.flag = 0 a.rname = 0 a.pos = 1 a.mapq = 20 a.cigar = ((0, 10), (2, 1), (0, 25)) a.mrnm = 0 a.mpos = 200 a.isize = 0 a.qual = "1234" * 3 # todo: create tags return a def testNegativeIntegers(self): x = -2 aligned_read = self.makeRead() aligned_read.tags = [("XD", int(x))] # print (aligned_read.tags) def testNegativeIntegers2(self): x = -2 r = self.makeRead() r.tags = [("XD", int(x))] outfile = pysam.Samfile("test.bam", "wb", referencenames=("chr1",), referencelengths = (1000,)) outfile.write(r) outfile.close() def testCigarString(self): r = self.makeRead() self.assertEqual(r.cigarstring, "10M1D25M") r.cigarstring = "20M10D20M" self.assertEqual(r.cigar, [(0, 20), (2, 10), (0, 20)]) # unsetting cigar string r.cigarstring = None self.assertEqual(r.cigarstring, None) def testCigar(self): r = self.makeRead() self.assertEqual(r.cigar, [(0, 10), (2, 1), (0, 25)]) # unsetting cigar string r.cigar = None self.assertEqual(r.cigar, []) def testLongTags(self): '''see issue 115''' r = self.makeRead() rg = 'HS2000-899_199.L3' tags = [('XC', 85), ('XT', 'M'), ('NM', 5), ('SM', 29), ('AM', 29), ('XM', 1), ('XO', 1), ('XG', 4), ('MD', '37^ACCC29T18'), ('XA', '5,+11707,36M1I48M,2;21,-48119779,46M1I38M,2;hs37d5,-10060835,40M1D45M,3;5,+11508,36M1I48M,3;hs37d5,+6743812,36M1I48M,3;19,-59118894,46M1I38M,3;4,-191044002,6M1I78M,3;')] r.tags = tags r.tags += [("RG", rg)] * 100 tags += [("RG", rg)] * 100 self.assertEqual(tags, r.tags) class TestClipping(unittest.TestCase): def testClipping(self): self.samfile = pysam.Samfile(os.path.join(DATADIR, "softclip.bam"), "rb") for read in self.samfile: if read.qname == "r001": self.assertEqual(read.seq, 'AAAAGATAAGGATA') self.assertEqual(read.query, 'AGATAAGGATA') self.assertEqual(read.qual, None) self.assertEqual(read.qqual, None) elif read.qname == "r002": self.assertEqual(read.seq, 'GCCTAAGCTAA') self.assertEqual(read.query, 'AGCTAA') self.assertEqual(read.qual, '01234567890') self.assertEqual(read.qqual, '567890') elif read.qname == "r003": self.assertEqual(read.seq, 'GCCTAAGCTAA') self.assertEqual(read.query, 'GCCTAA') self.assertEqual(read.qual, '01234567890') self.assertEqual(read.qqual, '012345') elif read.qname == "r004": self.assertEqual(read.seq, 'TAGGC') self.assertEqual(read.query, 'TAGGC') self.assertEqual(read.qual, '01234') self.assertEqual(read.qqual, '01234') class TestIteratorRow(unittest.TestCase): def setUp(self): self.samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") def checkRange(self, rnge): '''compare results from iterator with those from samtools.''' ps = list(self.samfile.fetch(region=rnge)) sa = force_str( pysam.samtools.view( os.path.join(DATADIR, "ex1.bam"), rnge, raw=True)).splitlines(True) self.assertEqual( len(ps), len(sa), "unequal number of results for range %s: %i != %i" % (rnge, len(ps), len(sa))) # check if the same reads are returned and in the same order for line, (a, b) in enumerate(list(zip(ps, sa))): d = b.split("\t") self.assertEqual( a.qname, d[0], "line %i: read id mismatch: %s != %s" % (line, a.rname, d[0])) self.assertEqual( a.pos, int(d[3]) - 1, "line %i: read position mismatch: %s != %s, " "\n%s\n%s\n" % (line, a.pos, int(d[3]) - 1, str(a), str(d))) qual = d[10] self.assertEqual( a.qual, qual, "line %i: quality mismatch: %s != %s, \n%s\n%s\n" % (line, a.qual, qual, str(a), str(d))) def testIteratePerContig(self): '''check random access per contig''' for contig in self.samfile.references: self.checkRange(contig) def testIterateRanges(self): '''check random access per range''' for contig, length in zip(self.samfile.references, self.samfile.lengths): for start in range(1, length, 90): # this includes empty ranges self.checkRange("%s:%i-%i" % (contig, start, start + 90)) def tearDown(self): self.samfile.close() class TestIteratorRowAll(unittest.TestCase): def setUp(self): self.samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") def testIterate(self): '''compare results from iterator with those from samtools.''' ps = list(self.samfile.fetch()) sa = force_str( pysam.samtools.view( os.path.join(DATADIR, "ex1.bam"), raw=True)).splitlines(True) self.assertEqual( len(ps), len(sa), "unequal number of results: %i != %i" % (len(ps), len(sa))) # check if the same reads are returned for line, pair in enumerate(list(zip(ps, sa))): data = pair[1].split("\t") self.assertEqual(pair[0].qname, data[ 0], "read id mismatch in line %i: %s != %s" % (line, pair[0].rname, data[0])) def tearDown(self): self.samfile.close() class TestIteratorColumn(unittest.TestCase): '''test iterator column against contents of ex4.bam.''' # note that samfile contains 1-based coordinates # 1D means deletion with respect to reference sequence # mCoverages = {'chr1': [0] * 20 + [1] * 36 + [0] * (100 - 20 - 35), 'chr2': [0] * 20 + [1] * 35 + [0] * (100 - 20 - 35), } def setUp(self): self.samfile = pysam.Samfile(os.path.join(DATADIR, "ex4.bam"), "rb") def checkRange(self, contig, start=None, end=None, truncate=False): '''compare results from iterator with those from samtools.''' # check if the same reads are returned and in the same order for column in self.samfile.pileup(contig, start, end, truncate=truncate): if truncate: self.assertGreaterEqual(column.pos, start) self.assertLess(column.pos, end) thiscov = len(column.pileups) refcov = self.mCoverages[ self.samfile.getrname(column.tid)][column.pos] self.assertEqual( thiscov, refcov, "wrong coverage at pos %s:%i %i should be %i" % ( self.samfile.getrname(column.tid), column.pos, thiscov, refcov)) def testIterateAll(self): '''check random access per contig''' self.checkRange(None) def testIteratePerContig(self): '''check random access per contig''' for contig in self.samfile.references: self.checkRange(contig) def testIterateRanges(self): '''check random access per range''' for contig, length in zip( self.samfile.references, self.samfile.lengths): for start in range(1, length, 90): # this includes empty ranges self.checkRange(contig, start, start + 90) def testInverse(self): '''test the inverse, is point-wise pileup accurate.''' for contig, refseq in list(self.mCoverages.items()): refcolumns = sum(refseq) for pos, refcov in enumerate(refseq): columns = list(self.samfile.pileup(contig, pos, pos + 1)) if refcov == 0: # if no read, no coverage self.assertEqual( len(columns), refcov, "wrong number of pileup columns returned for position %s:%i, %i should be %i" % ( contig, pos, len(columns), refcov)) elif refcov == 1: # one read, all columns of the read are returned self.assertEqual( len(columns), refcolumns, "pileup incomplete at position %i: got %i, expected %i " % (pos, len(columns), refcolumns)) def testIterateTruncate(self): '''check random access per range''' for contig, length in zip(self.samfile.references, self.samfile.lengths): for start in range(1, length, 90): # this includes empty ranges self.checkRange(contig, start, start + 90, truncate=True) def tearDown(self): self.samfile.close() class TestIteratorColumn2(unittest.TestCase): '''test iterator column against contents of ex1.bam.''' def setUp(self): self.samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") def testStart(self): # print self.samfile.fetch().next().pos # print self.samfile.pileup().next().pos pass def testTruncate(self): '''see issue 107.''' # note that ranges in regions start from 1 p = self.samfile.pileup(region='chr1:170:172', truncate=True) columns = [x.pos for x in p] self.assertEqual(len(columns), 3) self.assertEqual(columns, [169, 170, 171]) p = self.samfile.pileup('chr1', 169, 172, truncate=True) columns = [x.pos for x in p] self.assertEqual(len(columns), 3) self.assertEqual(columns, [169, 170, 171]) def testAccessOnClosedIterator(self): '''see issue 131 Accessing pileup data after iterator has closed. ''' pcolumn = self.samfile.pileup('chr1', 170, 180).__next__() self.assertRaises(ValueError, getattr, pcolumn, "pileups") class TestHeaderSam(unittest.TestCase): header = {'SQ': [{'LN': 1575, 'SN': 'chr1', 'AH': 'chr1:5000000-5010000'}, {'LN': 1584, 'SN': 'chr2', 'AH': '*'}], 'RG': [{'LB': 'SC_1', 'ID': 'L1', 'SM': 'NA12891', 'PU': 'SC_1_10', "CN": "name:with:colon"}, {'LB': 'SC_2', 'ID': 'L2', 'SM': 'NA12891', 'PU': 'SC_2_12', "CN": "name:with:colon"}], 'PG': [{'ID': 'P1', 'VN': '1.0'}, {'ID': 'P2', 'VN': '1.1'}], 'HD': {'VN': '1.0'}, 'CO': ['this is a comment', 'this is another comment'], } def compareHeaders(self, a, b): '''compare two headers a and b.''' for ak, av in a.items(): self.assertTrue(ak in b, "key '%s' not in '%s' " % (ak, b)) self.assertEqual(av, b[ak]) def setUp(self): self.samfile = pysam.Samfile(os.path.join(DATADIR, "ex3.sam"), "r") def testHeaders(self): self.compareHeaders(self.header, self.samfile.header) self.compareHeaders(self.samfile.header, self.header) def testNameMapping(self): for x, y in enumerate(("chr1", "chr2")): tid = self.samfile.gettid(y) ref = self.samfile.getrname(x) self.assertEqual(tid, x) self.assertEqual(ref, y) self.assertEqual(self.samfile.gettid("chr?"), -1) self.assertRaises(ValueError, self.samfile.getrname, 2) def tearDown(self): self.samfile.close() class TestHeaderBam(TestHeaderSam): def setUp(self): self.samfile = pysam.Samfile(os.path.join(DATADIR, "ex3.bam"), "rb") class TestHeaderFromRefs(unittest.TestCase): '''see issue 144 reference names need to be converted to string for python 3 ''' # def testHeader( self ): # refs = ['chr1', 'chr2'] # tmpfile = "tmp_%i" % id(self) # s = pysam.Samfile(tmpfile, 'wb', # referencenames=refs, # referencelengths=[100]*len(refs)) # s.close() # self.assertTrue( checkBinaryEqual( 'issue144.bam', tmpfile ), # 'bam files differ') # os.unlink( tmpfile ) class TestHeader1000Genomes(unittest.TestCase): '''see issue 110''' # bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase2b_alignment/data/NA07048/exome_alignment/NA07048.unmapped.ILLUMINA.bwa.CEU.exome.20120522_p2b.bam" bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase3_EX_or_LC_only_alignment/data/HG00104/alignment/HG00104.chrom11.ILLUMINA.bwa.GBR.low_coverage.20130415.bam" def testRead(self): if not checkURL(self.bamfile): return f = pysam.Samfile(self.bamfile, "rb") data = f.header.copy() self.assertTrue(data) class TestUnmappedReads(unittest.TestCase): # TODO # def testSAM(self): # samfile = pysam.Samfile(os.path.join(DATADIR, "ex5.sam"), # "r") # self.assertEqual(len(list(samfile.fetch(until_eof=True))), 2) # samfile.close() def testBAM(self): samfile = pysam.Samfile(os.path.join(DATADIR, "ex5.bam"), "rb") self.assertEqual(len(list(samfile.fetch(until_eof=True))), 2) samfile.close() class TestPileupObjects(unittest.TestCase): def setUp(self): self.samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") def testPileupColumn(self): for pcolumn1 in self.samfile.pileup(region="chr1:105"): if pcolumn1.pos == 104: self.assertEqual( pcolumn1.tid, 0, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn1.tid, 0)) self.assertEqual( pcolumn1.pos, 105 - 1, "position mismatch in position 1: %s != %s" % (pcolumn1.pos, 105 - 1)) self.assertEqual( pcolumn1.n, 2, "# reads mismatch in position 1: %s != %s" % (pcolumn1.n, 2)) for pcolumn2 in self.samfile.pileup(region="chr2:1480"): if pcolumn2.pos == 1479: self.assertEqual( pcolumn2.tid, 1, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn2.tid, 1)) self.assertEqual( pcolumn2.pos, 1480 - 1, "position mismatch in position 1: %s != %s" % (pcolumn2.pos, 1480 - 1)) self.assertEqual( pcolumn2.n, 12, "# reads mismatch in position 1: %s != %s" % (pcolumn2.n, 12)) def testPileupRead(self): for pcolumn1 in self.samfile.pileup(region="chr1:105"): if pcolumn1.pos == 104: self.assertEqual( len(pcolumn1.pileups), 2, "# reads aligned to column mismatch in position 1" ": %s != %s" % (len(pcolumn1.pileups), 2)) # self.assertEqual( pcolumn1.pileups[0] # need to test additional # properties here def tearDown(self): self.samfile.close() def testIteratorOutOfScope(self): '''test if exception is raised if pileup col is accessed after iterator is exhausted.''' for pileupcol in self.samfile.pileup(): pass self.assertRaises(ValueError, getattr, pileupcol, "pileups") class TestContextManager(unittest.TestCase): def testManager(self): with pysam.Samfile(os.path.join(DATADIR, 'ex1.bam'), 'rb') as samfile: samfile.fetch() self.assertEqual(samfile.closed, True) class TestExceptions(unittest.TestCase): def setUp(self): self.samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") def testMissingFile(self): self.assertRaises(IOError, pysam.Samfile, "exdoesntexist.bam", "rb") self.assertRaises(IOError, pysam.Samfile, "exdoesntexist.sam", "r") self.assertRaises(IOError, pysam.Samfile, "exdoesntexist.bam", "r") self.assertRaises(IOError, pysam.Samfile, "exdoesntexist.sam", "rb") def testBadContig(self): self.assertRaises(ValueError, self.samfile.fetch, "chr88") def testMeaninglessCrap(self): self.assertRaises(ValueError, self.samfile.fetch, "skljf") def testBackwardsOrderNewFormat(self): self.assertRaises(ValueError, self.samfile.fetch, 'chr1', 100, 10) def testBackwardsOrderOldFormat(self): self.assertRaises(ValueError, self.samfile.fetch, region="chr1:100-10") def testOutOfRangeNegativeNewFormat(self): self.assertRaises(ValueError, self.samfile.fetch, "chr1", 5, -10) self.assertRaises(ValueError, self.samfile.fetch, "chr1", 5, 0) self.assertRaises(ValueError, self.samfile.fetch, "chr1", -5, -10) self.assertRaises(ValueError, self.samfile.count, "chr1", 5, -10) self.assertRaises(ValueError, self.samfile.count, "chr1", 5, 0) self.assertRaises(ValueError, self.samfile.count, "chr1", -5, -10) def testOutOfRangeNegativeOldFormat(self): self.assertRaises(ValueError, self.samfile.fetch, region="chr1:-5-10") self.assertRaises(ValueError, self.samfile.fetch, region="chr1:-5-0") self.assertRaises(ValueError, self.samfile.fetch, region="chr1:-5--10") self.assertRaises(ValueError, self.samfile.count, region="chr1:-5-10") self.assertRaises(ValueError, self.samfile.count, region="chr1:-5-0") self.assertRaises(ValueError, self.samfile.count, region="chr1:-5--10") def testOutOfRangNewFormat(self): self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999, 99999999999) self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999, 99999999999) def testOutOfRangeLargeNewFormat(self): self.assertRaises(ValueError, self.samfile.fetch, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999) self.assertRaises(ValueError, self.samfile.count, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999) def testOutOfRangeLargeOldFormat(self): self.assertRaises( ValueError, self.samfile.fetch, "chr1:99999999999999999-999999999999999999") self.assertRaises( ValueError, self.samfile.count, "chr1:99999999999999999-999999999999999999") def testZeroToZero(self): '''see issue 44''' self.assertEqual(len(list(self.samfile.fetch('chr1', 0, 0))), 0) def tearDown(self): self.samfile.close() class TestWrongFormat(unittest.TestCase): '''test cases for opening files not in bam/sam format.''' def testOpenSamAsBam(self): self.assertRaises(ValueError, pysam.Samfile, os.path.join(DATADIR, 'ex1.sam'), 'rb') def testOpenBamAsSam(self): # test fails, needs to be implemented. # sam.fetch() fails on reading, not on opening # self.assertRaises( ValueError, pysam.Samfile, 'ex1.bam', 'r' ) pass def testOpenFastaAsSam(self): # test fails, needs to be implemented. # sam.fetch() fails on reading, not on opening # self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'r' ) pass def testOpenFastaAsBam(self): self.assertRaises(ValueError, pysam.Samfile, os.path.join(DATADIR, 'ex1.fa'), 'rb') class ReadTest(unittest.TestCase): def checkFieldEqual(self, read1, read2, exclude=[]): '''check if two reads are equal by comparing each field.''' # add the . for refactoring purposes. for x in (".qname", ".seq", ".flag", ".rname", ".pos", ".mapq", ".cigar", ".mrnm", ".mpos", ".isize", ".qual", ".bin", ".is_paired", ".is_proper_pair", ".is_unmapped", ".mate_is_unmapped", ".is_reverse", ".mate_is_reverse", ".is_read1", ".is_read2", ".is_secondary", ".is_qcfail", ".is_duplicate"): n = x[1:] if n in exclude: continue self.assertEqual(getattr(read1, n), getattr(read2, n), "attribute mismatch for %s: %s != %s" % (n, getattr(read1, n), getattr(read2, n))) class TestAlignedRead(ReadTest): '''tests to check if aligned read can be constructed and manipulated. ''' def testEmpty(self): a = pysam.AlignedRead() self.assertEqual(a.qname, None) self.assertEqual(a.seq, None) self.assertEqual(a.qual, None) self.assertEqual(a.flag, 0) self.assertEqual(a.rname, -1) self.assertEqual(a.mapq, 0) self.assertEqual(a.cigar, []) self.assertEqual(a.tags, []) self.assertEqual(a.mrnm, -1) self.assertEqual(a.mpos, -1) self.assertEqual(a.isize, 0) def testStrOfEmptyRead(self): a = pysam.AlignedRead() s = str(a) self.assertEqual( "None\t0\t-1\t-1\t0\tNone\t-1\t-1\t0\tNone\tNone\t[]", s) def buildRead(self): '''build an example read.''' a = pysam.AlignedRead() a.qname = "read_12345" a.seq = "ACGT" * 10 a.flag = 0 a.rname = 0 a.pos = 20 a.mapq = 20 a.cigar = ((0, 10), (2, 1), (0, 9), (1, 1), (0, 20)) a.mrnm = 0 a.mpos = 200 a.isize = 167 a.qual = "1234" * 10 # todo: create tags return a def testUpdate(self): '''check if updating fields affects other variable length data ''' a = self.buildRead() b = self.buildRead() # check qname b.qname = "read_123" self.checkFieldEqual(a, b, "qname") b.qname = "read_12345678" self.checkFieldEqual(a, b, "qname") b.qname = "read_12345" self.checkFieldEqual(a, b) # check cigar b.cigar = ((0, 10), ) self.checkFieldEqual(a, b, "cigar") b.cigar = ((0, 10), (2, 1), (0, 10)) self.checkFieldEqual(a, b, "cigar") b.cigar = ((0, 10), (2, 1), (0, 9), (1, 1), (0, 20)) self.checkFieldEqual(a, b) # check seq b.seq = "ACGT" self.checkFieldEqual(a, b, ("seq", "qual")) b.seq = "ACGT" * 3 self.checkFieldEqual(a, b, ("seq", "qual")) b.seq = "ACGT" * 10 self.checkFieldEqual(a, b, ("qual",)) # reset qual b = self.buildRead() # check flags: for x in ( "is_paired", "is_proper_pair", "is_unmapped", "mate_is_unmapped", "is_reverse", "mate_is_reverse", "is_read1", "is_read2", "is_secondary", "is_qcfail", "is_duplicate"): setattr(b, x, True) self.assertEqual(getattr(b, x), True) self.checkFieldEqual(a, b, ("flag", x,)) setattr(b, x, False) self.assertEqual(getattr(b, x), False) self.checkFieldEqual(a, b) def testUpdate2(self): '''issue 135: inplace update of sequence and quality score. This does not work as setting the sequence will erase the quality scores. ''' a = self.buildRead() a.seq = a.seq[5:10] self.assertEqual(a.qual, None) a = self.buildRead() s = a.qual a.seq = a.seq[5:10] a.qual = s[5:10] self.assertEqual(a.qual, s[5:10]) def testLargeRead(self): '''build an example read.''' a = pysam.AlignedRead() a.qname = "read_12345" a.seq = "ACGT" * 200 a.flag = 0 a.rname = 0 a.pos = 20 a.mapq = 20 a.cigar = ((0, 4 * 200), ) a.mrnm = 0 a.mpos = 200 a.isize = 167 a.qual = "1234" * 200 return a def testTagParsing(self): '''test for tag parsing see http://groups.google.com/group/pysam-user-group/browse_thread/thread/67ca204059ea465a ''' samfile = pysam.Samfile(os.path.join(DATADIR, "ex8.bam"), "rb") for entry in samfile: before = entry.tags entry.tags = entry.tags after = entry.tags self.assertEqual(after, before) def testUpdateTlen(self): '''check if updating tlen works''' a = self.buildRead() oldlen = a.tlen oldlen *= 2 a.tlen = oldlen self.assertEqual(a.tlen, oldlen) def testPositions(self): a = self.buildRead() self.assertEqual(a.positions, [20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59]) self.assertEqual(a.aligned_pairs, [(0, 20), (1, 21), (2, 22), (3, 23), (4, 24), (5, 25), (6, 26), (7, 27), (8, 28), (9, 29), (None, 30), (10, 31), (11, 32), (12, 33), (13, 34), (14, 35), (15, 36), (16, 37), (17, 38), (18, 39), (19, None), (20, 40), (21, 41), (22, 42), (23, 43), (24, 44), (25, 45), (26, 46), (27, 47), (28, 48), (29, 49), (30, 50), (31, 51), (32, 52), (33, 53), (34, 54), (35, 55), (36, 56), (37, 57), (38, 58), (39, 59)]) self.assertEqual( a.positions, [x[1] for x in a.aligned_pairs if x[0] is not None and x[1] is not None]) # alen is the length of the aligned read in genome self.assertEqual(a.alen, a.aligned_pairs[-1][0] + 1) # aend points to one beyond last aligned base in ref self.assertEqual(a.positions[-1], a.aend - 1) def testBlocks(self): a = self.buildRead() self.assertEqual(a.blocks, [(20, 30), (31, 40), (40, 60)]) # Disabled as not backwards compatible # def testFancyStr(self): # a = self.buildRead() # output = a.fancy_str() # self.assertEqual(len(output), 9) class TestDeNovoConstruction(ReadTest): '''check BAM/SAM file construction using ex6.sam (note these are +1 coordinates): read_28833_29006_6945 99 chr1 33 20 10M1D25M = 200 167 AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG <<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<< NM:i:1 RG:Z:L1 read_28701_28881_323b 147 chr2 88 30 35M = 500 412 ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA <<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<< MF:i:18 RG:Z:L2 ''' header = {'HD': {'VN': '1.0'}, 'SQ': [{'LN': 1575, 'SN': 'chr1'}, {'LN': 1584, 'SN': 'chr2'}], } bamfile = os.path.join(DATADIR, "ex6.bam") samfile = os.path.join(DATADIR, "ex6.sam") def setUp(self): a = pysam.AlignedRead() a.qname = "read_28833_29006_6945" a.seq = "AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG" a.flag = 99 a.rname = 0 a.pos = 32 a.mapq = 20 a.cigar = ((0, 10), (2, 1), (0, 25)) a.mrnm = 0 a.mpos = 199 a.isize = 167 a.qual = "<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<" a.tags = (("NM", 1), ("RG", "L1")) b = pysam.AlignedRead() b.qname = "read_28701_28881_323b" b.seq = "ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA" b.flag = 147 b.rname = 1 b.pos = 87 b.mapq = 30 b.cigar = ((0, 35), ) b.mrnm = 1 b.mpos = 499 b.isize = 412 b.qual = "<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<" b.tags = (("MF", 18), ("RG", "L2")) self.reads = (a, b) # TODO # def testSAMWholeFile(self): # tmpfilename = "tmp_%i.sam" % id(self) # outfile = pysam.Samfile(tmpfilename, # "wh", # header=self.header) # for x in self.reads: # outfile.write(x) # outfile.close() # self.assertTrue(checkBinaryEqual(tmpfilename, self.samfile), # "mismatch when construction SAM file, see %s %s" % (tmpfilename, self.samfile)) # os.unlink(tmpfilename) def testBAMPerRead(self): '''check if individual reads are binary equal.''' infile = pysam.Samfile(self.bamfile, "rb") others = list(infile) for denovo, other in zip(others, self.reads): self.checkFieldEqual(other, denovo) self.assertEqual(other.compare(denovo), 0) # TODO # def testSAMPerRead(self): # '''check if individual reads are binary equal.''' # infile = pysam.Samfile(self.samfile, "r") # others = list(infile) # for denovo, other in zip(others, self.reads): # self.checkFieldEqual(other, denovo) # self.assertEqual(other.compare(denovo), 0) def testBAMWholeFile(self): tmpfilename = "tmp_%i.bam" % id(self) outfile = pysam.Samfile(tmpfilename, "wb", header=self.header) for x in self.reads: outfile.write(x) outfile.close() self.assertTrue(checkBinaryEqual(tmpfilename, self.bamfile), "mismatch when construction BAM file, see %s %s" % (tmpfilename, self.bamfile)) os.unlink(tmpfilename) class TestDeNovoConstructionUserTags(TestDeNovoConstruction): '''test de novo construction with a header that contains lower-case tags.''' header = {'HD': {'VN': '1.0'}, 'SQ': [{'LN': 1575, 'SN': 'chr1'}, {'LN': 1584, 'SN': 'chr2'}], 'x1': {'A': 2, 'B': 5}, 'x3': {'A': 6, 'B': 5}, 'x2': {'A': 4, 'B': 5}} bamfile = os.path.join(DATADIR, "example_user_header.bam") samfile = os.path.join(DATADIR, "example_user_header.sam") class TestEmptyHeader(unittest.TestCase): '''see issue 84.''' def testEmptyHeader(self): s = pysam.Samfile(os.path.join(DATADIR, 'example_empty_header.bam')) self.assertEqual(s.header, {'SQ': [{'LN': 1000, 'SN': 'chr1'}]}) COMPARE_BTAG = [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, 100, 103, 2, 81, 126, 0, 2, 90, 0, 15, 96, 15, 1, 0, 2, 0, 107, 92, 0, 0, 101, 3, 98, 15, 102, 13, 116, 116, 90, 93, 198, 0, 0, 0, 199, 92, 26, 495, 100, 5, 0, 100, 5, 209, 0, 92, 107, 90, 0, 0, 0, 0, 109, 194, 7, 94, 200, 0, 40, 197, 0, 11, 0, 0, 112, 110, 6, 4, 200, 28, 0, 196, 0, 203, 1, 129, 0, 0, 1, 0, 94, 0, 1, 0, 107, 5, 201, 3, 3, 100, 0, 121, 0, 7, 0, 1, 105, 306, 3, 86, 8, 183, 0, 12, 163, 17, 83, 22, 0, 0, 1, 8, 109, 103, 0, 0, 295, 0, 200, 16, 172, 3, 16, 182, 3, 11, 0, 0, 223, 111, 103, 0, 5, 225, 0, 95] class TestBTagSam(unittest.TestCase): '''see issue 81.''' compare = [COMPARE_BTAG, [-100, 200, -300, -400], [-100, 12], [12, 15], [-1.0, 5.0, 2.5]] filename = os.path.join(DATADIR, 'example_btag.sam') read0 = [('RG', 'QW85I'), ('PG', 'tmap'), ('MD', '140'), ('NM', 0), ('AS', 140), ('FZ', array.array('H', COMPARE_BTAG)), ('XA', 'map2-1'), ('XS', 53), ('XT', 38), ('XF', 1), ('XE', 0)] def testReadTags(self): s = pysam.Samfile(self.filename) for x, read in enumerate(s): tags = read.tags if x == 0: self.assertEqual(tags, self.read0) fz = list(dict(tags)["FZ"]) self.assertEqual(fz, self.compare[x]) self.assertEqual(list(read.opt("FZ")), self.compare[x]) self.assertEqual(tags, read.get_tags()) for tag, value in tags: self.assertEqual(value, read.get_tag(tag)) def testReadWriteTags(self): s = pysam.Samfile(self.filename) for read in s: before = read.tags read.tags = before self.assertEqual(read.tags, before) read.set_tags(before) self.assertEqual(read.tags, before) for tag, value in before: read.set_tag(tag, value) self.assertEqual(value, read.get_tag(tag)) class TestBTagBam(TestBTagSam): filename = os.path.join(DATADIR, 'example_btag.bam') class TestDoubleFetch(unittest.TestCase): '''check if two iterators on the same bamfile are independent.''' filename = os.path.join(DATADIR, 'ex1.bam') def testDoubleFetch(self): samfile1 = pysam.Samfile(self.filename, 'rb') for a, b in zip(samfile1.fetch(multiple_iterators=True), samfile1.fetch(multiple_iterators=True)): self.assertEqual(a.compare(b), 0) def testDoubleFetchWithRegion(self): samfile1 = pysam.Samfile(self.filename, 'rb') chr, start, stop = 'chr1', 200, 3000000 # just making sure the test has something to catch self.assertTrue(len(list(samfile1.fetch(chr, start, stop))) > 0) for a, b in zip(samfile1.fetch(chr, start, stop), samfile1.fetch(chr, start, stop, multiple_iterators=True)): self.assertEqual(a.compare(b), 0) def testDoubleFetchUntilEOF(self): samfile1 = pysam.Samfile(self.filename, 'rb') for a, b in zip(samfile1.fetch(until_eof=True), samfile1.fetch(until_eof=True, multiple_iterators=True)): self.assertEqual(a.compare(b), 0) class TestRemoteFileFTP(unittest.TestCase): '''test remote access. ''' # Need to find an ftp server without password on standard # port. url = "ftp://ftp.sanger.ac.uk/pub/rd/humanSequences/CV.bam" region = "1:1-1000" def testFTPView(self): return if not checkURL(self.url): return result = pysam.samtools.view(self.url, self.region) self.assertEqual(len(result), 36) def testFTPFetch(self): return if not checkURL(self.url): return samfile = pysam.Samfile(self.url, "rb") result = list(samfile.fetch(region=self.region)) self.assertEqual(len(result), 36) class TestRemoteFileHTTP(unittest.TestCase): url = "http://genserv.anat.ox.ac.uk/downloads/pysam/test/ex1.bam" region = "chr1:1-1000" local = os.path.join(DATADIR, "ex1.bam") def testView(self): if not checkURL(self.url): return samfile_local = pysam.Samfile(self.local, "rb") ref = list(samfile_local.fetch(region=self.region)) result = pysam.samtools.view( self.url, self.region).splitlines(True) self.assertEqual(len(result), len(ref)) def testFetch(self): if not checkURL(self.url): return samfile = pysam.Samfile(self.url, "rb") result = list(samfile.fetch(region=self.region)) samfile_local = pysam.Samfile(self.local, "rb") ref = list(samfile_local.fetch(region=self.region)) self.assertEqual(len(ref), len(result)) for x, y in zip(result, ref): self.assertEqual(x.compare(y), 0) def testFetchAll(self): if not checkURL(self.url): return samfile = pysam.Samfile(self.url, "rb") result = list(samfile.fetch()) samfile_local = pysam.Samfile(self.local, "rb") ref = list(samfile_local.fetch()) self.assertEqual(len(ref), len(result)) for x, y in zip(result, ref): self.assertEqual(x.compare(y), 0) class TestLargeOptValues(unittest.TestCase): ints = (65536, 214748, 2147484, 2147483647) floats = (65536.0, 214748.0, 2147484.0) def check(self, samfile): i = samfile.fetch() for exp in self.ints: rr = next(i) obs = rr.opt("ZP") self.assertEqual(exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) for exp in [-x for x in self.ints]: rr = next(i) obs = rr.opt("ZP") self.assertEqual(exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) for exp in self.floats: rr = next(i) obs = rr.opt("ZP") self.assertEqual(exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) for exp in [-x for x in self.floats]: rr = next(i) obs = rr.opt("ZP") self.assertEqual(exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) def testSAM(self): samfile = pysam.Samfile( os.path.join(DATADIR, "ex10.sam"), "r") self.check(samfile) def testBAM(self): samfile = pysam.Samfile( os.path.join(DATADIR, "ex10.bam"), "rb") self.check(samfile) class TestPileup(unittest.TestCase): '''test pileup functionality.''' samfilename = "pysam_data/ex1.bam" fastafilename = "pysam_data/ex1.fa" def setUp(self): self.samfile = pysam.Samfile(self.samfilename) self.fastafile = pysam.Fastafile(self.fastafilename) def checkEqual(self, references, iterator): for x, column in enumerate(iterator): (contig, pos, reference_base, read_bases, read_qualities, alignment_mapping_qualities) \ = references[x][:-1].split("\t") self.assertEqual(int(pos) - 1, column.pos) def testSamtoolsStepper(self): refs = force_str( pysam.samtools.mpileup( "-f", self.fastafilename, self.samfilename)).splitlines(True) iterator = self.samfile.pileup( stepper="samtools", fastafile=self.fastafile) self.checkEqual(refs, iterator) def testAllStepper(self): refs = force_str( pysam.samtools.mpileup( "-f", self.fastafilename, "-A", "-B", self.samfilename)).splitlines(True) iterator = self.samfile.pileup( stepper="all", fastafile=self.fastafile) self.checkEqual(refs, iterator) class TestLogging(unittest.TestCase): '''test around bug issue 42, failed in versions < 0.4 ''' def check(self, bamfile, log): if log: logger = logging.getLogger('franklin') logger.setLevel(logging.INFO) formatter = logging.Formatter( '%(asctime)s %(levelname)s %(message)s') log_hand = logging.FileHandler('log.txt') log_hand.setFormatter(formatter) logger.addHandler(log_hand) bam = pysam.Samfile(bamfile, 'rb') cols = bam.pileup() self.assertTrue(True) def testFail1(self): self.check(os.path.join(DATADIR, "ex9_fail.bam"), False) self.check(os.path.join(DATADIR, "ex9_fail.bam"), True) def testNoFail1(self): self.check(os.path.join(DATADIR, "ex9_nofail.bam"), False) self.check(os.path.join(DATADIR, "ex9_nofail.bam"), True) def testNoFail2(self): self.check(os.path.join(DATADIR, "ex9_nofail.bam"), True) self.check(os.path.join(DATADIR, "ex9_nofail.bam"), True) # TODOS # 1. finish testing all properties within pileup objects # 2. check exceptions and bad input problems (missing files, optional fields that aren't present, etc...) # 3. check: presence of sequence class TestSamfileUtilityFunctions(unittest.TestCase): def testCount(self): samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") for contig in ("chr1", "chr2"): for start in range(0, 2000, 100): end = start + 1 self.assertEqual( len(list(samfile.fetch(contig, start, end))), samfile.count(contig, start, end), 'number mismatch for %s:%i-%i %i != %i' % ( contig, start, end, len(list(samfile.fetch(contig, start, end))), samfile.count(contig, start, end))) # test empty intervals self.assertEqual( len(list(samfile.fetch(contig, start, start))), samfile.count(contig, start, start), 'number mismatch for %s:%i-%i %i != %i' % ( contig, start, start, len(list(samfile.fetch(contig, start, start))), samfile.count(contig, start, start))) # test half empty intervals self.assertEqual(len(list(samfile.fetch(contig, start))), samfile.count(contig, start)) self.assertEqual( len(list(samfile.fetch(contig, start))), samfile.count(contig, start), 'number mismatch for %s:%i %i != %i' % ( contig, start, len(list(samfile.fetch(contig, start))), samfile.count(contig, start))) def testMate(self): '''test mate access.''' with open(os.path.join(DATADIR, "ex1.sam"), "rb") as inf: readnames = [x.split(b"\t")[0] for x in inf.readlines()] if sys.version_info[0] >= 3: readnames = [name.decode('ascii') for name in readnames] counts = collections.defaultdict(int) for x in readnames: counts[x] += 1 samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") for read in samfile.fetch(): if not read.is_paired: self.assertRaises(ValueError, samfile.mate, read) elif read.mate_is_unmapped: self.assertRaises(ValueError, samfile.mate, read) else: if counts[read.qname] == 1: self.assertRaises(ValueError, samfile.mate, read) else: mate = samfile.mate(read) self.assertEqual(read.qname, mate.qname) self.assertEqual(read.is_read1, mate.is_read2) self.assertEqual(read.is_read2, mate.is_read1) self.assertEqual(read.pos, mate.mpos) self.assertEqual(read.mpos, mate.pos) def testIndexStats(self): '''test if total number of mapped/unmapped reads is correct.''' samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") self.assertEqual(samfile.mapped, 3235) self.assertEqual(samfile.unmapped, 35) self.assertEqual(samfile.nocoordinate, 0) class TestSamtoolsProxy(unittest.TestCase): '''tests for sanity checking access to samtools functions.''' def testIndex(self): self.assertRaises(IOError, pysam.samtools.index, "missing_file") def testView(self): # note that view still echos "open: No such file or directory" self.assertRaises(pysam.SamtoolsError, pysam.samtools.view, "missing_file") def testSort(self): self.assertRaises(pysam.SamtoolsError, pysam.samtools.sort, "missing_file") class TestSamfileIndex(unittest.TestCase): def testIndex(self): samfile = pysam.Samfile(os.path.join(DATADIR, "ex1.bam"), "rb") index = pysam.IndexedReads(samfile) index.build() reads = collections.defaultdict(int) for read in samfile: reads[read.qname] += 1 for qname, counts in reads.items(): found = list(index.find(qname)) self.assertEqual(len(found), counts) for x in found: self.assertEqual(x.qname, qname) if __name__ == "__main__": # build data files print ("building data files") subprocess.call("make -C %s" % DATADIR, shell=True) print ("starting tests") unittest.main() print ("completed tests")