1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789
|
Author: Andreas Tille <tille@debian.org>
Last-Update: Mon, 11 Aug 2014 16:33:56 +0200
Description: Debian can not package uclust for licensing reasons - skip tests
requiring uclust
--- a/tests/test_util.py
+++ b/tests/test_util.py
@@ -93,55 +93,6 @@ class PyNastTests(TestCase):
"""
remove_files(self.files_to_remove)
- def test_pynast_logging(self):
- """pynast_seqs() should write log file with correct contents
- """
- logger = NastLogger(self.log_filename)
- seqs = [('1','ACGTACGTTAATACCCTGGTAGT'),
- ('2','AA')]
- # testing for side effect - do not collect return value
- pynast_seqs(seqs, db_aln2, min_len=5, logger=logger)
-
- log_file = open(self.log_filename, 'r')
- header = log_file.readline()
- contents = log_file.read()
- log_file.close()
-
- self.assertEqual(contents, expected_logfile_contents)
-
- def test_pynast_logging_for_stringent_user_requirements(self):
- """pynast_seqs() should record info if best hit does not meet min requirements
- """
- logger = NastLogger(self.log_filename)
- seqs = [('1','ACGTACGTTAATACCCTGGTAGT')]
- # testing for side effect - do not collect return value
- pynast_seqs(seqs, db_aln2, min_len=500, logger=logger)
-
- log_file = open(self.log_filename, 'r')
- header = log_file.readline()
- contents = log_file.read()
- log_file.close()
-
- self.assertEqual(contents, expected_stringent_logfile_contents)
-
-
- def test_pynast_seqs_fail(self):
- """ pynast_seqs: returns expected fail list for sample data
- """
- actual = pynast_seqs(\
- MinimalFastaParser(self.full_length_test1_input_seqs_lines),\
- self.full_length_test1_template_aln,\
- min_len=1000,min_pct=75.0)
-
- # build the expected object - a list of sequence objects which
- # failed to align
- seq_id = 'FAKE1 here is some desc.73602 tag1;tag2, tag3:tag4'
- expected = [\
- DNA.makeSequence(self.full_length_test1_expected_fail.getSeq(seq_id),\
- Name=seq_id)]
-
- self.assertEqual(actual[1],expected)
-
def test_pynast_seqs_exact_matches(self):
""" pynast_seqs: perfectly aligns several exact template matches
"""
@@ -159,113 +110,7 @@ class PyNastTests(TestCase):
expected_aln = LoadSeqs(data=expected_seqs,\
moltype=DNA,aligned=DenseAlignment)
input_seqs = self.full_length_test1_template_aln.degap()
-
- # run pynast_seqs on the input sequences
- actual = pynast_seqs(input_seqs.todict().items(),\
- template_aln,\
- min_len=1000,min_pct=75.0,\
- align_unaligned_seqs_f=None)
-
- # Load the result into an alignment object
- actual_aln = LoadSeqs(data=actual[0],moltype=DNA,\
- aligned=DenseAlignment)
-
- # alignment length is correct
- self.assertEqual(len(actual_aln),len(template_aln))
-
- # correct number of sequences were aligned
- self.assertEqual(actual_aln.getNumSeqs(),expected_aln.getNumSeqs())
-
- # same collection of seq ids is returned
- actual_names = actual_aln.Names
- actual_names.sort()
- expected_names = expected_aln.Names
- expected_names.sort()
- self.assertEqual(actual_names,expected_names)
-
- # all sequence lengths match expected sequence lengths (ie, no
- # missing bases)
- for seq_id in actual_aln.Names:
- self.assertEqual(\
- len(actual_aln.getSeq(seq_id)),\
- len(expected_aln.getSeq(seq_id)))
-
- # resulting list of dna sequence objects is as expected
- # (this would take care of some of the above tests, but testing
- # aspects individually makes it easier to diagnose failures)
- actual[0].sort()
- expected_seqs.sort()
- self.assertEqual(actual[0],expected_seqs)
-
- # fail list is empty
- self.assertEqual(actual[1],[])
-
- def test_pynast_seqs_aligned_full_length(self):
- """ pynast_seqs: pynast results at least 95% identical to NAST results
-
- A note on this test: In the initial versions of PyNAST, I
- wanted the alignments to be exactly like those resulting from
- NAST (e.g., in PyNAST 1.0). I've since abandoned that, in favor
- of getting improved alignments. This test was modified after
- PyNAST 1.0, and I'm now only testing that the alignments
- are similar to those derived from NAST. This test may be
- of little use, but it is a nice test of the code on
- full-length sequences, so I hesitate to delete it.
- -Greg (24 Mar 2010)
-
- """
- template_aln = self.full_length_test1_template_aln
- expected_aln = self.full_length_test1_expected_aln
-
- actual = pynast_seqs(\
- MinimalFastaParser(self.full_length_test1_input_seqs_lines),\
- template_aln,\
- align_unaligned_seqs_f=None)
- # Build the expected result object, which is a list of
- # dna sequence objects where names include the aligned span
- expected_seqs = []
- for n in expected_aln.Names:
- expected_seqs.append(\
- DNA.makeSequence(str(expected_aln.getGappedSeq(n)),Name=n))
-
- actual_aln = LoadSeqs(data=actual[0],moltype=DNA,\
- aligned=DenseAlignment)
-
- # Resulting list of dna sequence objects is as expected
- # (this would take care of some of the above tests, but testing
- # aspects individually makes it easier to diagnose failures)
- # Only look at the unique id porition of the sequence description,
- # as NAST and PyNAST now handle terminal bases different. NAST
- # does local alignments, so sometimes loses terminal bases. PyNAST
- # does global alignments, so the candidate only lose terminal bases
- # if they introduce terminal gaps in the template alignments.
- a_list = [(a.Name.split()[0], a) for a in actual[0]]
- e_list = [(e.Name.split()[0], e) for e in expected_seqs]
- a_list.sort()
- e_list.sort()
-
- for a,e in zip(a_list,e_list):
- # first component of names are equal
- self.assertEqual(a[0],e[0])
- a_seq = a[1]
- e_seq = e[1]
- count_same = 0
- for i in range(len(a_seq)):
- if a_seq[i] == e_seq[i]: count_same += 1
- percent_same = count_same/len(a_seq)
- self.assertTrue(percent_same >= 0.95,
- "PyNAST and NAST alignments of %s are " % a[0] +\
- "less than 95%% identical")
-
- def test_pynast_seqs_error_on_gap(self):
- """ pynast_seqs: raises ValueError on gap in candidate sequence
- """
- self.assertRaises(ValueError,pynast_seqs,
- MinimalFastaParser(self.input_seqs_gaps),\
- self.full_length_test1_template_aln,\
- min_len=1000,min_pct=75.0)
-
def test_pynast_seqs_simple(self):
"""pynast_seqs: fns with simple test data
"""
@@ -279,10 +124,6 @@ class PyNastTests(TestCase):
DNA.makeSequence('ACGTACGT-TA--ATA-C-----CC-T-G-GTA-G-T---',Name='2')]
expected_fail = [DNA.makeSequence('AA',Name='3')]
- actual = pynast_seqs(candidate_seqs,db_aln2,min_len=5,min_pct=75.0)
- self.assertEqual(actual,(expected_aln,expected_fail))
-
-
# all fail when min_len restricts matches
expected_aln = []
expected_fail = [\
@@ -290,10 +131,7 @@ class PyNastTests(TestCase):
DNA.makeSequence('ACGTACGTTAATACCCTGGTAGT',Name='2'),\
DNA.makeSequence('AA',Name='3')]
- actual = pynast_seqs(candidate_seqs,db_aln2,min_len=5000,min_pct=75.0)
-
- self.assertEqual(actual,(expected_aln,expected_fail))
-
+
def test_pynast_seqs_simple_alt_pairwise(self):
"""pynast_seqs: fns with alt pairwise aligner
"""
@@ -306,11 +144,6 @@ class PyNastTests(TestCase):
expected_aln = [DNA.makeSequence('AGCC-----CCTTTT',Name='1')]
expected_fail = []
- actual = pynast_seqs(candidate_seqs,template_aln,
- min_len=5,min_pct=75.0,\
- align_unaligned_seqs_f=pair_hmm_align_unaligned_seqs)
- self.assertEqual(actual,(expected_aln,expected_fail))
-
# tests that the aligner was actually applied, as it's
# nearly impossible to get different alignments with
@@ -326,12 +159,7 @@ class PyNastTests(TestCase):
moltype=DNA,aligned=DenseAlignment)
expected_aln = [DNA.makeSequence('AGGG-----GGTTTT',Name='1')]
expected_fail = []
- actual = pynast_seqs(candidate_seqs,template_aln,
- min_len=5,min_pct=75.0,\
- align_unaligned_seqs_f=fake_aligner)
- self.assertEqual(actual,(expected_aln,expected_fail))
-
def test_ipynast_seqs_simple(self):
"""ipynast_seqs: fns with simple test data
"""
@@ -347,66 +175,12 @@ class PyNastTests(TestCase):
'ACGTACGT-TA--ATA-C-----CC-T-G-GTA-G-T---',Name='2'),0),\
(DNA.makeSequence('AA',Name='3'),1)]
- actual = list(ipynast_seqs(\
- candidate_seqs,db_aln2,min_len=5,min_pct=75.0))
-
- self.assertEqual(actual,expected)
-
# all fail when min_len restricts matches
expected = [\
(DNA.makeSequence('ACGAACGTTAATACCCTGGAAGT',Name='1'),2),\
(DNA.makeSequence('ACGTACGTTAATACCCTGGTAGT',Name='2'),2),\
(DNA.makeSequence('AA',Name='3'),1)]
- actual = list(ipynast_seqs(\
- candidate_seqs,db_aln2,min_len=5000,min_pct=75.0))
-
- self.assertEqual(actual,expected)
-
- def test_ipynast_seqs_simple_value_error(self):
- """ipynast_seqs: handles value error gracefully
- """
- candidate_seqs = [\
- ('1','ACGTACGTTAATACCCTGGAAGT'),\
- ('2','ACGTACGTTAATACCCTGGT-AGT'),\
- ('3','AA')]
-
- pynast_iterator = ipynast_seqs(\
- candidate_seqs,db_aln2,min_len=5,min_pct=75.0)
-
- self.assertRaises(ValueError,list,pynast_iterator)
-
- def test_ipynast_seqs_real_data(self):
- """ipynast_seqs: sanity check with real data
- """
- actual = list(ipynast_seqs(\
- self.full_length_test2_input_seqs.items(),\
- self.full_length_test2_template_aln,\
- min_len=5,min_pct=75.0))
- # correct number of results returned
- self.assertEqual(len(actual),1)
-
- actual = list(ipynast_seqs(\
- self.full_length_test1_input_seqs.items(),\
- self.full_length_test1_template_aln,\
- min_len=5,min_pct=75.0))
- # correct number of results returned
- self.assertEqual(len(actual),6)
- self.assertTrue(0 in [a[1] for a in actual],
- "At least one result succeeds in being aligned.")
-
- def test_ipynast_seqs_handle_filepath_input(self):
- """ipynast_seqs: input filepaths handled as expected
- """
- actual = list(ipynast_seqs(\
- self.full_length_test1_input_seqs.items(),\
- self.full_length_test1_template_aln_fp,\
- min_len=5,min_pct=75.0))
- # correct number of results returned
- self.assertEqual(len(actual),6)
- self.assertTrue(0 in [a[1] for a in actual],
- "At least one result succeeds in being aligned.")
-
def test_pynast_seqs_simple_status_callback(self):
"""pynast_seqs: status callback functions as expected
"""
@@ -427,85 +201,7 @@ class PyNastTests(TestCase):
st = StatusTracker()
self.assertEqual(st.completed_seqs_count,0)
- results = pynast_seqs(candidate_seqs,db_aln2,min_len=5,min_pct=75.0,\
- status_callback_f=st.update_completed_seqs_count)
-
- self.assertEqual(st.completed_seqs_count,3)
- def test_pynast_seq_simple(self):
- """pynast_seq: fns as exp with simple example
- """
- candidate_sequence =\
- DNA.makeSequence('ACGTACGTTAATACCCTGGTAGT',Name='input')
- actual = pynast_seq(candidate_sequence,db_aln2,
- max_hits=30,min_pct=75.0,
- min_len=5,align_unaligned_seqs_f=None)
-
- # check individual components of result object
- expected_template_hit = '5'
- expected_aligned_seq = 'ACGTACGT-TA--ATA-C-----CC-T-G-GTA-G-T---'
- expected_aligned_seq_id = 'input 1..23'
-
- self.assertEqual(actual[0],expected_template_hit)
- self.assertEqual(str(actual[1]),expected_aligned_seq)
- self.assertEqual(actual[1].Name,expected_aligned_seq_id)
-
- # check full result object
- expected = ('5',\
- DNA.makeSequence('ACGTACGT-TA--ATA-C-----CC-T-G-GTA-G-T---',\
- Name='input 1..23'))
- self.assertEqual(actual,expected)
-
- def test_pynast_seq_simple_rc(self):
- """pynast_seq: fns as exp with simple rc example
- """
- # This sequence is the rev-complement of the sequence used in
- # test_pynast_seq_simple -- this test checks that the
- # same result is returned
- candidate_sequence =\
- DNA.makeSequence('ACTACCAGGGTATTAACGTACGT',Name='input')
- actual = pynast_seq(candidate_sequence,db_aln2,
- max_hits=30,min_pct=75.0,
- min_len=5,align_unaligned_seqs_f=None)
-
- # check individual components of result object
- expected_template_hit = '5'
- expected_aligned_seq = 'ACGTACGT-TA--ATA-C-----CC-T-G-GTA-G-T---'
- expected_aligned_seq_id = 'input RC:1..23'
-
- self.assertEqual(actual[0],expected_template_hit)
- self.assertEqual(str(actual[1]),expected_aligned_seq)
- self.assertEqual(actual[1].Name,expected_aligned_seq_id)
-
- # check full result object
- expected = ('5',\
- DNA.makeSequence('ACGTACGT-TA--ATA-C-----CC-T-G-GTA-G-T---',\
- Name='input RC:1..23'))
- self.assertEqual(actual,expected)
-
- def test_pynast_seq_10116(self):
- """pynast_seq: real seq that introduces 5' gaps in pw aligned template
-
- The pairwise alignment of this sequence to the template alignment
- results in five prime gaps in the pairwise aligned template. This
- caused a bug in early versions of PyNAST because too many terminal
- gaps were being reintroduced. Therefore keeping this as a real
- test case, essentially of the introduce_terminal_gaps
- functionality.
-
- """
- candidate_sequence =\
- LoadSeqs(data=input_seq_10116.split('\n'),moltype=DNA).\
- getSeq('10116')
- template_aln = self.full_length_test1_template_aln
-
- actual = pynast_seq(candidate_sequence,template_aln,\
- max_hits=30,min_pct=70.0,min_len=150,\
- align_unaligned_seqs_f=None)
-
- self.assertEqual(len(actual[1]),len(template_aln))
-
-
def test_pynast_seq_14990(self):
"""pynast_seq: aligning handles input seq longer than best template seq
"""
@@ -518,47 +214,6 @@ class PyNastTests(TestCase):
expected = ('14990_5_and_3_prime_lost_four_bases_each',\
template_aln.getGappedSeq('14990_5_and_3_prime_lost_four_bases_each'))
- actual = pynast_seq(candidate_sequence,template_aln,
- max_hits=30,min_pct=75.0,min_len=1000,
- align_unaligned_seqs_f=None)
-
- # put handles on result parts for easier access
- actual_seq_id, actual_seq = map(str,actual)
- expected_seq_id, expected_seq = map(str,expected)
-
- # correct seq id identified
- self.assertEqual(actual_seq_id,expected_seq_id)
-
- # correct ungapped length
- self.assertEqual(len(actual_seq.replace('-','')),\
- len(expected_seq.replace('-','')))
-
- # correct gapped length
- self.assertEqual(len(actual_seq),len(expected_seq))
-
- # the 8 flanking bases in input_seq were removed
- self.assertEqual(len(actual_seq.replace('-','')),\
- len(candidate_sequence)-8)
-
- # aligned seqs are equal
- self.assertEqual(actual_seq,expected_seq)
-
- def test_pynast_seq_error_on_gap(self):
- """ pynast_seq: raises ValueError on gap in candidate sequence
- """
- for seq_id, seq in MinimalFastaParser(self.input_seqs_gaps):
- # error when gap(s) in seq
- cs = DNA.makeSequence(seq,Name=seq_id)
- self.assertRaises(ValueError,pynast_seq,cs,db_aln2,\
- max_hits=1,min_pct=75.0,min_len=5,align_unaligned_seqs_f=None)
-
- seq = seq.replace('-','').replace('.','')
- # no error when no gaps in seq
- cs = DNA.makeSequence(seq,Name=seq_id)
- r = pynast_seq(cs,db_aln2,\
- max_hits=1,min_pct=70.0,min_len=5,align_unaligned_seqs_f=None)
-
-
def test_align_two_seqs_with_muscle(self):
""" align_two_seqs: fns for simple alignments with muscle
"""
@@ -814,13 +469,6 @@ class PyNastTests(TestCase):
s2 = DNA.makeSequence('ACGTACGTACATACCCTGGTAGT')
self.assertEqual(align_two_seqs(s1,s2,f),(s1,s2))
- # truncated sequence (3')
- s1 = DNA.makeSequence('ACGTACGTACATACCCTGGTAGT')
- s2 = DNA.makeSequence('ACGTACGTACATACCCT')
- exp1 = DNA.makeSequence('ACGTACGTACATACCCTGGTAGT')
- exp2 = DNA.makeSequence('ACGTACGTACATACCC------T')
- self.assertEqual(align_two_seqs(s1,s2,f),(exp1,exp2))
-
# truncated sequence (5')
s1 = DNA.makeSequence('ACGTACGTACATACCCTGGTAGT')
s2 = DNA.makeSequence('CGTACATACCCTGGTAGT')
@@ -833,7 +481,6 @@ class PyNastTests(TestCase):
s2 = DNA.makeSequence('CGTACATACCCTGGT')
exp1 = DNA.makeSequence('ACGTACGTACATACCCTGGTAGT')
exp2 = DNA.makeSequence('-----CGTACATACCCTG---GT')
- self.assertEqual(align_two_seqs(s1,s2,f),(exp1,exp2))
def test_align_two_seqs_with_fake_aligner(self):
""" align_two_seqs: fns for simple alignments with fake_aligner
@@ -1379,10 +1026,6 @@ class PyNastTests(TestCase):
with this seqeunce in later versions.
"""
template_alignment = LoadSeqs(data=template_128453.split('\n'))
- actual = pynast_seq(query_3037,template_alignment,min_len=150,
- align_unaligned_seqs_f=None)
- expected = ('128453',aligned_3037)
- self.assertEqual(actual,expected)
query_3037 = DNA.makeSequence("CTGGGCCGTGTCTCAGTCCCAGTGTGGCTGATCATCCTCTCAGACCAGCTAAGGATCGTCGCCTTGGTGCGCCTTTACCACACCAACTAGCTAAAGGCGATAAATCTTTGATCTCGCGATATCATCCGGTATTAGCAGCAATTTCTCGCTGTTATTCCGAACCTGAGGGCAGATTCCCACGCGTTACGCACCCGTGCGCCACTAAGGCCG",Name=">v15D30.1.08_100583")
--- a/tests/test_pycogent_backports/test_uclust.py
+++ b/tests/test_pycogent_backports/test_uclust.py
@@ -67,75 +67,7 @@ class UclustTests(TestCase):
def tearDown(self):
remove_files(self.files_to_remove,error_on_missing=False)
-
- def test_fasta_sorting(self):
- """ Should sort fasta seqs from largest to smallest in outfile
-
- Since a fasta file has to be passed to the app controller for uclust,
- a temporary fasta file is created, and the raw fasta seqs supplied
- in this module are written to it. This file is sent to the app
- controller, and the resulting sorted file is compared to the expected
- results to ensure proper function of uclust as called by this app
- controller."""
-
- test_app = Uclust({'--tmpdir':self.tmpdir})
-
-
- test_app_res = test_app(data = \
- {'--mergesort':self.tmp_unsorted_fasta_filepath,\
- '--output':self.tmp_sorted_fasta_filepath})
-
- sorted_fasta_actual = [l.strip()
- for l in open(test_app_res['Output'].name,"U")]
- sorted_fasta_expected = [l.strip() for l in sorted_dna_seqs if l]
-
- self.assertEqual(sorted_fasta_actual,sorted_fasta_expected)
-
- test_app_res.cleanUp()
-
- def test_parameter_availability(self):
- """ Often used parameters are accessible
-
- This is just some basic sanity checking.
-
- """
- a = Uclust()
- # if a parameter is not accessible, trying to turn it on will
- # raise a KeyError
- a.Parameters['--allhits'].on()
- a.Parameters['--libonly'].on()
- a.Parameters['--maxaccepts'].on(42)
- a.Parameters['--maxrejects'].on(42)
- a.Parameters['--rev'].on()
- def test_clustering_fasta_filepath(self):
- """ Should create clusters in uclust format from sorted fasta file
-
- Since a fasta file has to be passed to the app controller for uclust,
- a temporary fasta file is created, and the sorted seqs supplied
- in this module are written to it. This file is sent to the app
- controller, and the resulting uclust file is compared to the expected
- results to ensure proper function of uclust as called by this app
- controller."""
-
-
-
- test_app = Uclust({'--id':0.9},HALT_EXEC=False)
- test_app_res = test_app(data = \
- {'--input':self.tmp_sorted_fasta_filepath,\
- '--uc':self.tmp_uc_filepath})
-
- uc_file = open(test_app_res['ClusterFile'].name,"U")
- # compare the actual and expect uc files, ignoring comment lines
- uc_file_actual = [l.strip() for l in uc_file
- if not l.startswith('#')]
- uc_file_expected = [l.strip() for l in uc_dna_clusters
- if not l.startswith('#')]
-
- self.assertEqual(uc_file_actual, uc_file_expected)
-
- test_app_res.cleanUp()
-
class UclustConvenienceWrappers(TestCase):
""" Unit tests for uclust convenience wrappers """
@@ -217,22 +149,6 @@ class UclustConvenienceWrappers(TestCase
def tearDown(self):
remove_files(self.files_to_remove,error_on_missing=False)
-
- def test_uclust_fasta_sort_from_filepath(self):
- """ Given an unsorted fasta filepath, will return sorted file """
-
- app_res = \
- uclust_fasta_sort_from_filepath(self.tmp_unsorted_fasta_filepath)
-
- sorted_fasta_actual = [l.strip()
- for l in open(app_res['Output'].name,"U")]
- sorted_fasta_expected = [l.strip() for l in sorted_dna_seqs if l]
-
- self.assertEqual(sorted_fasta_actual,sorted_fasta_expected)
-
- app_res.cleanUp()
-
-
def test_clusters_from_uc_file(self):
""" clusters_from_uc_file functions as expected """
@@ -269,27 +185,7 @@ class UclustConvenienceWrappers(TestCase
self.assertRaises(UclustParseError,
clusters_from_uc_file,
self.uc_lines_overlapping_lib_input_seq_ids)
-
-
- def test_uclust_cluster_from_sorted_fasta_filepath(self):
- """ Given a sorted fasta filepath, will return uclust (.uc) file """
-
- app_res = \
- uclust_cluster_from_sorted_fasta_filepath(self.tmp_sorted_fasta_filepath, \
- percent_ID = 0.90,HALT_EXEC=False)
-
-
- uc_file = open(app_res['ClusterFile'].name,"U")
- # compare the actual and expect uc files, ignoring comment lines
- uc_file_actual = [l.strip() for l in uc_file
- if not l.startswith('#')]
- uc_file_expected = [l.strip() for l in uc_dna_clusters
- if not l.startswith('#')]
-
- self.assertEqual(uc_file_actual, uc_file_expected)
- app_res.cleanUp()
-
def test_get_output_filepaths(self):
""" Properly generates output filepath names """
@@ -303,157 +199,6 @@ class UclustConvenienceWrappers(TestCase
obs = get_output_filepaths("/tmp", "test_seqs.filtered.fasta")
self.assertEqual(obs, "/tmp/test_seqs.filtered_clusters.uc")
- def test_get_clusters_from_fasta_filepath(self):
- """ Tests for return of lists of OTUs from given fasta filepath """
-
- clusters_res = \
- get_clusters_from_fasta_filepath(self.tmp_unsorted_fasta_filepath, \
- original_fasta_path = None, percent_ID = 0.90, save_uc_files=False)
- expected_cluster_list.sort()
- expected_failure_list.sort()
- expected_new_seed_list.sort()
- clusters_res[0].sort()
- clusters_res[1].sort()
- clusters_res[2].sort()
- self.assertEqual(clusters_res,(expected_cluster_list,
- expected_failure_list,
- expected_new_seed_list))
-
- def test_get_clusters_from_fasta_filepath_reference_db_only(self):
- """ Correct clusters returned when clustering against a database only
- """
- clusters_res = get_clusters_from_fasta_filepath(
- self.tmp_unsorted_fasta_filepath,
- original_fasta_path = None,
- save_uc_files=False,
- max_accepts=7,max_rejects=12,
- percent_ID = 0.90,
- subject_fasta_filepath=self.ref_dna_seqs_fp,
- suppress_new_clusters=True,
- HALT_EXEC=False)
-
- self.ref_test_clusters1.sort()
- self.ref_test_failures1.sort()
- self.ref_test_new_seeds1.sort()
-
- clusters_res[0].sort()
- clusters_res[1].sort()
- clusters_res[2].sort()
- self.assertEqual(clusters_res,(self.ref_test_clusters1,
- self.ref_test_failures1,
- self.ref_test_new_seeds1))
-
- def test_get_clusters_from_fasta_filepath_extending_reference_db(self):
- """ Correct clusters when clustering against db and adding new clusters
- """
- clusters_res = get_clusters_from_fasta_filepath(
- self.tmp_unsorted_fasta_filepath,
- original_fasta_path = None,
- max_accepts=7,max_rejects=12,
- percent_ID = 0.90,
- subject_fasta_filepath=self.ref_dna_seqs_fp,
- suppress_new_clusters=False,enable_rev_strand_matching=True,
- HALT_EXEC=False,
- save_uc_files=False)
-
- self.ref_test_clusters2.sort()
- self.ref_test_failures2.sort()
- self.ref_test_new_seeds2.sort()
-
- clusters_res[0].sort()
- clusters_res[1].sort()
- clusters_res[2].sort()
- self.assertEqual(clusters_res,(self.ref_test_clusters2,
- self.ref_test_failures2,
- self.ref_test_new_seeds2))
-
-
- def test_get_clusters_from_fasta_filepath_optimal(self):
- """ Test OTUs from filepath functions with optimal
- """
- # need to compile a small test where optimal has an affect --
- # this currently is only testing that we don't get a failure with
- # optimal
- clusters_res = \
- get_clusters_from_fasta_filepath(self.tmp_unsorted_fasta_filepath,
- original_fasta_path = None, save_uc_files=False,
- percent_ID = 0.90, optimal = True)
- expected_cluster_list.sort()
- expected_failure_list.sort()
- expected_new_seed_list.sort()
- clusters_res[0].sort()
- clusters_res[1].sort()
- clusters_res[2].sort()
-
- self.assertEqual(clusters_res,(expected_cluster_list,
- expected_failure_list,
- expected_new_seed_list))
-
-
- def test_get_clusters_from_fasta_filepath_suppress_sort(self):
- """ Test OTUs from filepath functions with suppress sort
- """
- expected = [['uclust_test_seqs_0'], ['uclust_test_seqs_1'],
- ['uclust_test_seqs_2'], ['uclust_test_seqs_3'],
- ['uclust_test_seqs_4'], ['uclust_test_seqs_5'],
- ['uclust_test_seqs_6', 'uclust_test_seqs_8'],
- ['uclust_test_seqs_7'], ['uclust_test_seqs_9']]
- clusters_res = \
- get_clusters_from_fasta_filepath(self.tmp_unsorted_fasta_filepath,
- original_fasta_path = None,
- percent_ID = 0.90, suppress_sort = True, save_uc_files=False)
- expected_cluster_list.sort()
- expected_failure_list.sort()
- expected_new_seed_list.sort()
- clusters_res[0].sort()
- clusters_res[1].sort()
- clusters_res[2].sort()
-
- self.assertEqual(clusters_res,(expected_cluster_list,
- expected_failure_list,
- expected_new_seed_list))
-
- def test_get_clusters_from_fasta_filepath_rev_strand_match(self):
- """ Test OTUs from filepath functions with rev strand match
- """
- # seq and its rc don't cluster when enable_rev_strand_matching = False
- expected_cluster_list = [['uclust_test_seqs_0'], ['uclust_test_seqs_0_rc']]
- expected_failure_list = []
- expected_new_seed_list = ['uclust_test_seqs_0', 'uclust_test_seqs_0_rc']
- clusters_res = \
- get_clusters_from_fasta_filepath(self.tmp_raw_dna_seqs_rc_filepath,
- original_fasta_path = None, save_uc_files=False,
- percent_ID = 0.90, enable_rev_strand_matching = False)
-
- expected_cluster_list.sort()
- expected_failure_list.sort()
- expected_new_seed_list.sort()
- clusters_res[0].sort()
- clusters_res[1].sort()
- clusters_res[2].sort()
- self.assertEqual(clusters_res,(expected_cluster_list,
- expected_failure_list,
- expected_new_seed_list))
-
- # seq and its rc cluster when enable_rev_strand_matching = False
- expected_cluster_list = [['uclust_test_seqs_0', 'uclust_test_seqs_0_rc']]
- expected_failure_list = []
- expected_new_seed_list = ['uclust_test_seqs_0']
- clusters_res = \
- get_clusters_from_fasta_filepath(self.tmp_raw_dna_seqs_rc_filepath,
- original_fasta_path = None, save_uc_files=False,
- percent_ID = 0.90, enable_rev_strand_matching = True)
-
- expected_cluster_list.sort()
- expected_failure_list.sort()
- expected_new_seed_list.sort()
- clusters_res[0].sort()
- clusters_res[1].sort()
- clusters_res[2].sort()
- self.assertEqual(clusters_res,(expected_cluster_list,
- expected_failure_list,
- expected_new_seed_list))
-
def test_process_uclust_pw_alignment_results(self):
"""parsing of pairwise alignment fasta pairs file functions as expected
"""
@@ -468,42 +213,6 @@ class UclustConvenienceWrappers(TestCase
# make sure the full result objects are the same
self.assertEqual(actual,expected)
- def test_uclust_search_and_align_from_fasta_filepath(self):
- """ uclust_search_and_align_from_fasta_filepath functions as expected """
- # rev comp matches allowed (default)
- actual = list(uclust_search_and_align_from_fasta_filepath(
- self.search_align_query1_fp,self.search_align_template1_fp))
- self.assertEqual(actual,self.search_align_out1_expected)
-
- # rev comp matches not allowed
- actual = list(uclust_search_and_align_from_fasta_filepath(
- self.search_align_query1_fp,self.search_align_template1_fp,
- enable_rev_strand_matching=False))
- self.assertEqual(actual,self.search_align_out1_expected[:2])
-
- def test_uclust_search_and_align_from_fasta_filepath_protein(self):
- """ uclust_search_and_align_from_fasta_filepath functions with protein """
- # rev comp matches allowed (default)
- actual = list(uclust_search_and_align_from_fasta_filepath(
- self.search_align_query2_fp,self.search_align_template2_fp))
- self.assertEqual(actual,self.search_align_out2_expected)
-
- def test_uclust_supported_version(self):
- """uclust version is supported """
- command = 'uclust --version'
- proc = Popen(command,shell=True,universal_newlines=True,\
- stdout=PIPE,stderr=STDOUT)
- stdout = proc.stdout.read()
- version_string = stdout.strip().split('v')[-1].strip('q')
- try:
- version = tuple(map(int,version_string.split('.')))
- acceptable_version = version >= (1,2,22)
- except ValueError:
- acceptable_version = False
-
- self.assertTrue(acceptable_version,\
- "Unsupported uclust version. 1.2.22 or later "+\
- "is required, but running %s." % version_string)
raw_dna_seqs = """>uclust_test_seqs_0
ACGGTGGCTACAAGACGTCCCATCCAACGGGTTGGATACTTAAGGCACATCACGTCAGTTTTGTGTCAGAGCT
|