1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128
|
/* sub_example.c libabpoa usage example
To compile:
gcc -g sub_example.c -I ./include -L ./lib -labpoa -lz -lm -o sub_example
or:
gcc -g sub_example.c -I ./include ./lib/libabpoa.a -lz -lm -o sub_example
*/
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <stdint.h>
#include "include/abpoa.h"
// AaCcGgTtNn ... ==> 0,1,2,3,4 ...
// BbDdEeFf ... ==> 5,6,7,8 ...
unsigned char _char26_table[256] = {
0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 0, 5, 1, 6, 7, 8, 2, 9, 10, 11, 12, 13, 14, 4, 15,
16, 17, 18, 19, 3, 20, 21, 22, 23, 24, 25, 26, 26, 26, 26, 26,
26, 0, 5, 1, 6, 7, 8, 2, 9, 10, 11, 12, 13, 14, 4, 15,
16, 17, 18, 19, 3, 20, 21, 22, 23, 24, 25, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26
};
int main(void) {
int i, j, n_seqs = 6;
char seqs[100][1000] = {
// 0 1 2 3
// 23456789012345678901234567890123
"CGTCAATCTATCGAAGCATACGCGGGCAGAGC",
"CCACGTCAATCTATCGAAGCATACGCGGCAGC",
"AATCTATCGAAGCATACG",
"CAATGCTAGTCGAAGCAGCTGCGGCAG",
"CGTCAATCTATCGAAGCATTCTACGCGGCAGAGC",
"CGTCAATCTAGAAGCATACGCGGCAAGAGC",
"CGTCAATCTATCGGTAAAGCATACGCTCTGTAGC",
"CGTCAATCTATCTTCAAGCATACGCGGCAGAGC",
"CGTCAATGGATCGAGTACGCGGCAGAGC",
"CGTCAATCTAATCGAAGCATACGCGGCAGAGC"
};
int beg_end_id[100][2] = {
{0, 1},
{2, 33},
{6, 23},
{5, 30},
{0, 1},
{0, 1},
{0, 1},
{0, 1},
{0, 1},
{0, 1},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52}
};
// initialize variables
abpoa_t *ab = abpoa_init();
abpoa_para_t *abpt = abpoa_init_para();
// alignment parameters
// abpt->align_mode = 0; // 0:global 1:local, 2:extension
// abpt->match = 2; // match score
// abpt->mismatch = 4; // mismatch penalty
// abpt->gap_mode = ABPOA_CONVEX_GAP; // gap penalty mode
// abpt->gap_open1 = 4; // gap open penalty #1
// abpt->gap_ext1 = 2; // gap extension penalty #1
// abpt->gap_open2 = 24; // gap open penalty #2
// abpt->gap_ext2 = 1; // gap extension penalty #2
// gap_penalty = min{gap_open1 + gap_len * gap_ext1, gap_open2 + gap_len * gap_ext2}
// abpt->bw = 10; // extra band used in adaptive banded DP
// abpt->bf = 0.01;
// output options
abpt->out_msa = 1; // generate Row-Column multiple sequence alignment(RC-MSA), set 0 to disable
abpt->out_cons = 1; // generate consensus sequence, set 0 to disable
abpoa_post_set_para(abpt);
// collect sequence length, trasform ACGT to 0123
int *seq_lens = (int*)malloc(sizeof(int) * n_seqs);
uint8_t **bseqs = (uint8_t**)malloc(sizeof(uint8_t*) * n_seqs);
for (i = 0; i < n_seqs; ++i) {
seq_lens[i] = strlen(seqs[i]);
bseqs[i] = (uint8_t*)malloc(sizeof(uint8_t) * seq_lens[i]);
for (j = 0; j < seq_lens[i]; ++j)
bseqs[i][j] = _char26_table[(int)seqs[i][j]];
}
// perform abpoa-msa
ab->abs->n_seq = n_seqs;
abpoa_res_t res;
for (i = 0; i < n_seqs; ++i) {
res.graph_cigar = 0, res.n_cigar = 0;
int exc_beg, exc_end;
if (i != 0) abpoa_subgraph_nodes(ab, abpt, beg_end_id[i][0], beg_end_id[i][1], &exc_beg, &exc_end);
else exc_beg = 0, exc_end = 1;
fprintf(stderr, "i: %d, beg: %d, end: %d\n", i, exc_beg, exc_end);
abpoa_align_sequence_to_subgraph(ab, abpt, exc_beg, exc_end, bseqs[i], seq_lens[i], &res);
abpoa_add_subgraph_alignment(ab, abpt, exc_beg, exc_end, bseqs[i], NULL, seq_lens[i], NULL, res, i, n_seqs, 0);
if (res.n_cigar) free(res.graph_cigar);
}
abpoa_output(ab, abpt, stdout);
/* generate DOT partial order graph plot */
abpt->out_pog = strdup("sub_example.png"); // dump parital order graph to file
if (abpt->out_pog != NULL) abpoa_dump_pog(ab, abpt);
for (i = 0; i < n_seqs; ++i) free(bseqs[i]); free(bseqs); free(seq_lens);
abpoa_free(ab); abpoa_free_para(abpt);
return 0;
}
|