1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134
|
/* sub_example.c libabpoa usage example
To compile:
gcc -g sub_example.c -I ./include -L ./lib -labpoa -lz -lm -o sub_example
or:
gcc -g sub_example.c -I ./include ./lib/libabpoa.a -lz -lm -o sub_example
*/
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <stdint.h>
#include "include/abpoa.h"
// AaCcGgTtNn ... ==> 0,1,2,3,4 ...
// BbDdEeFf ... ==> 5,6,7,8 ...
unsigned char _char26_table[256] = {
0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 0, 5, 1, 6, 7, 8, 2, 9, 10, 11, 12, 13, 14, 4, 15,
16, 17, 18, 19, 3, 20, 21, 22, 23, 24, 25, 26, 26, 26, 26, 26,
26, 0, 5, 1, 6, 7, 8, 2, 9, 10, 11, 12, 13, 14, 4, 15,
16, 17, 18, 19, 3, 20, 21, 22, 23, 24, 25, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26,
26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26, 26
};
int main(void) {
int i, j, n_seqs = 5;
char seqs[100][1000] = {
// 0 1 2 3
// 23456789012345678901234567890123
"CGTCAATCTATCGAAGCATACGCGGGCAGAGC",
"CCACGTCAATCTATCGAAGCATACGCGGCAGC",
"AATCTATCGAAGCATACG",
"CAATGCTAGTCGAAGCAGCTGCGGCAG",
"CAATGCTAGTCGAAGCAGCTGCGGCAG",
"CGTCAATCTATCGAAGCATTCTACGCGGCAGAGC",
"CGTCAATCTAGAAGCATACGCGGCAAGAGC",
"CGTCAATCTATCGGTAAAGCATACGCTCTGTAGC",
"CGTCAATCTATCTTCAAGCATACGCGGCAGAGC",
"CGTCAATGGATCGAGTACGCGGCAGAGC",
"CGTCAATCTAATCGAAGCATACGCGGCAGAGC"
};
int beg_end_id[100][2] = {
{0, 1},
{2, 33},
{6, 23},
{5, 30},
{5, 30},
{0, 1},
{0, 1},
{0, 1},
{0, 1},
{0, 1},
{0, 1},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52},
//{2, 52}
};
// initialize variables
abpoa_t *ab = abpoa_init();
abpoa_para_t *abpt = abpoa_init_para();
// alignment parameters
// abpt->align_mode = 0; // 0:global 1:local, 2:extension
// abpt->match = 2; // match score
// abpt->mismatch = 4; // mismatch penalty
// abpt->gap_mode = ABPOA_CONVEX_GAP; // gap penalty mode
// abpt->gap_open1 = 4; // gap open penalty #1
// abpt->gap_ext1 = 2; // gap extension penalty #1
// abpt->gap_open2 = 24; // gap open penalty #2
// abpt->gap_ext2 = 1; // gap extension penalty #2
// gap_penalty = min{gap_open1 + gap_len * gap_ext1, gap_open2 + gap_len * gap_ext2}
// abpt->bw = 10; // extra band used in adaptive banded DP
// abpt->bf = 0.01;
// output options
abpt->out_msa = 1; // generate Row-Column multiple sequence alignment(RC-MSA), set 0 to disable
abpt->out_cons = 1; // generate consensus sequence, set 0 to disable
abpt->cons_algrm = ABPOA_MF; // most frequent base
abpt->inc_path_score = 1;
abpt->sub_aln = 1;
// abpt->max_n_cons = 2;
abpoa_post_set_para(abpt);
// collect sequence length, trasform ACGT to 0123
int *seq_lens = (int*)malloc(sizeof(int) * n_seqs);
uint8_t **bseqs = (uint8_t**)malloc(sizeof(uint8_t*) * n_seqs);
for (i = 0; i < n_seqs; ++i) {
seq_lens[i] = strlen(seqs[i]);
bseqs[i] = (uint8_t*)malloc(sizeof(uint8_t) * seq_lens[i]);
for (j = 0; j < seq_lens[i]; ++j)
bseqs[i][j] = _char26_table[(int)seqs[i][j]];
}
// perform abpoa-msa
ab->abs->n_seq = n_seqs;
abpoa_res_t res;
for (i = 0; i < n_seqs; ++i) {
res.graph_cigar = 0, res.n_cigar = 0;
int exc_beg, exc_end;
if (i != 0) abpoa_subgraph_nodes(ab, abpt, beg_end_id[i][0], beg_end_id[i][1], &exc_beg, &exc_end);
else exc_beg = 0, exc_end = 1;
fprintf(stderr, "i: %d, beg: %d, end: %d\n", i, exc_beg, exc_end);
abpoa_align_sequence_to_subgraph(ab, abpt, exc_beg, exc_end, bseqs[i], seq_lens[i], &res);
abpoa_add_subgraph_alignment(ab, abpt, exc_beg, exc_end, bseqs[i], NULL, seq_lens[i], NULL, res, i, n_seqs, 0);
if (res.n_cigar) free(res.graph_cigar);
}
abpoa_output(ab, abpt, stdout);
/* generate DOT partial order graph plot */
abpt->out_pog = strdup("sub_example.png"); // dump parital order graph to file
if (abpt->out_pog != NULL) abpoa_dump_pog(ab, abpt);
for (i = 0; i < n_seqs; ++i) free(bseqs[i]); free(bseqs); free(seq_lens);
abpoa_free(ab); abpoa_free_para(abpt);
return 0;
}
|