File: help.wrm

package info (click to toggle)
acedb 4.9.39+dfsg.02-5
  • links: PTS, VCS
  • area: main
  • in suites: bullseye, sid
  • size: 33,796 kB
  • sloc: ansic: 256,989; perl: 2,803; cpp: 2,534; csh: 1,712; python: 862; sh: 658; makefile: 300; awk: 249; lex: 225; yacc: 221
file content (2559 lines) | stat: -rw-r--r-- 92,803 bytes parent folder | download | duplicates (3)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
462
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
506
507
508
509
510
511
512
513
514
515
516
517
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
634
635
636
637
638
639
640
641
642
643
644
645
646
647
648
649
650
651
652
653
654
655
656
657
658
659
660
661
662
663
664
665
666
667
668
669
670
671
672
673
674
675
676
677
678
679
680
681
682
683
684
685
686
687
688
689
690
691
692
693
694
695
696
697
698
699
700
701
702
703
704
705
706
707
708
709
710
711
712
713
714
715
716
717
718
719
720
721
722
723
724
725
726
727
728
729
730
731
732
733
734
735
736
737
738
739
740
741
742
743
744
745
746
747
748
749
750
751
752
753
754
755
756
757
758
759
760
761
762
763
764
765
766
767
768
769
770
771
772
773
774
775
776
777
778
779
780
781
782
783
784
785
786
787
788
789
790
791
792
793
794
795
796
797
798
799
800
801
802
803
804
805
806
807
808
809
810
811
812
813
814
815
816
817
818
819
820
821
822
823
824
825
826
827
828
829
830
831
832
833
834
835
836
837
838
839
840
841
842
843
844
845
846
847
848
849
850
851
852
853
854
855
856
857
858
859
860
861
862
863
864
865
866
867
868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
884
885
886
887
888
889
890
891
892
893
894
895
896
897
898
899
900
901
902
903
904
905
906
907
908
909
910
911
912
913
914
915
916
917
918
919
920
921
922
923
924
925
926
927
928
929
930
931
932
933
934
935
936
937
938
939
940
941
942
943
944
945
946
947
948
949
950
951
952
953
954
955
956
957
958
959
960
961
962
963
964
965
966
967
968
969
970
971
972
973
974
975
976
977
978
979
980
981
982
983
984
985
986
987
988
989
990
991
992
993
994
995
996
997
998
999
1000
1001
1002
1003
1004
1005
1006
1007
1008
1009
1010
1011
1012
1013
1014
1015
1016
1017
1018
1019
1020
1021
1022
1023
1024
1025
1026
1027
1028
1029
1030
1031
1032
1033
1034
1035
1036
1037
1038
1039
1040
1041
1042
1043
1044
1045
1046
1047
1048
1049
1050
1051
1052
1053
1054
1055
1056
1057
1058
1059
1060
1061
1062
1063
1064
1065
1066
1067
1068
1069
1070
1071
1072
1073
1074
1075
1076
1077
1078
1079
1080
1081
1082
1083
1084
1085
1086
1087
1088
1089
1090
1091
1092
1093
1094
1095
1096
1097
1098
1099
1100
1101
1102
1103
1104
1105
1106
1107
1108
1109
1110
1111
1112
1113
1114
1115
1116
1117
1118
1119
1120
1121
1122
1123
1124
1125
1126
1127
1128
1129
1130
1131
1132
1133
1134
1135
1136
1137
1138
1139
1140
1141
1142
1143
1144
1145
1146
1147
1148
1149
1150
1151
1152
1153
1154
1155
1156
1157
1158
1159
1160
1161
1162
1163
1164
1165
1166
1167
1168
1169
1170
1171
1172
1173
1174
1175
1176
1177
1178
1179
1180
1181
1182
1183
1184
1185
1186
1187
1188
1189
1190
1191
1192
1193
1194
1195
1196
1197
1198
1199
1200
1201
1202
1203
1204
1205
1206
1207
1208
1209
1210
1211
1212
1213
1214
1215
1216
1217
1218
1219
1220
1221
1222
1223
1224
1225
1226
1227
1228
1229
1230
1231
1232
1233
1234
1235
1236
1237
1238
1239
1240
1241
1242
1243
1244
1245
1246
1247
1248
1249
1250
1251
1252
1253
1254
1255
1256
1257
1258
1259
1260
1261
1262
1263
1264
1265
1266
1267
1268
1269
1270
1271
1272
1273
1274
1275
1276
1277
1278
1279
1280
1281
1282
1283
1284
1285
1286
1287
1288
1289
1290
1291
1292
1293
1294
1295
1296
1297
1298
1299
1300
1301
1302
1303
1304
1305
1306
1307
1308
1309
1310
1311
1312
1313
1314
1315
1316
1317
1318
1319
1320
1321
1322
1323
1324
1325
1326
1327
1328
1329
1330
1331
1332
1333
1334
1335
1336
1337
1338
1339
1340
1341
1342
1343
1344
1345
1346
1347
1348
1349
1350
1351
1352
1353
1354
1355
1356
1357
1358
1359
1360
1361
1362
1363
1364
1365
1366
1367
1368
1369
1370
1371
1372
1373
1374
1375
1376
1377
1378
1379
1380
1381
1382
1383
1384
1385
1386
1387
1388
1389
1390
1391
1392
1393
1394
1395
1396
1397
1398
1399
1400
1401
1402
1403
1404
1405
1406
1407
1408
1409
1410
1411
1412
1413
1414
1415
1416
1417
1418
1419
1420
1421
1422
1423
1424
1425
1426
1427
1428
1429
1430
1431
1432
1433
1434
1435
1436
1437
1438
1439
1440
1441
1442
1443
1444
1445
1446
1447
1448
1449
1450
1451
1452
1453
1454
1455
1456
1457
1458
1459
1460
1461
1462
1463
1464
1465
1466
1467
1468
1469
1470
1471
1472
1473
1474
1475
1476
1477
1478
1479
1480
1481
1482
1483
1484
1485
1486
1487
1488
1489
1490
1491
1492
1493
1494
1495
1496
1497
1498
1499
1500
1501
1502
1503
1504
1505
1506
1507
1508
1509
1510
1511
1512
1513
1514
1515
1516
1517
1518
1519
1520
1521
1522
1523
1524
1525
1526
1527
1528
1529
1530
1531
1532
1533
1534
1535
1536
1537
1538
1539
1540
1541
1542
1543
1544
1545
1546
1547
1548
1549
1550
1551
1552
1553
1554
1555
1556
1557
1558
1559
1560
1561
1562
1563
1564
1565
1566
1567
1568
1569
1570
1571
1572
1573
1574
1575
1576
1577
1578
1579
1580
1581
1582
1583
1584
1585
1586
1587
1588
1589
1590
1591
1592
1593
1594
1595
1596
1597
1598
1599
1600
1601
1602
1603
1604
1605
1606
1607
1608
1609
1610
1611
1612
1613
1614
1615
1616
1617
1618
1619
1620
1621
1622
1623
1624
1625
1626
1627
1628
1629
1630
1631
1632
1633
1634
1635
1636
1637
1638
1639
1640
1641
1642
1643
1644
1645
1646
1647
1648
1649
1650
1651
1652
1653
1654
1655
1656
1657
1658
1659
1660
1661
1662
1663
1664
1665
1666
1667
1668
1669
1670
1671
1672
1673
1674
1675
1676
1677
1678
1679
1680
1681
1682
1683
1684
1685
1686
1687
1688
1689
1690
1691
1692
1693
1694
1695
1696
1697
1698
1699
1700
1701
1702
1703
1704
1705
1706
1707
1708
1709
1710
1711
1712
1713
1714
1715
1716
1717
1718
1719
1720
1721
1722
1723
1724
1725
1726
1727
1728
1729
1730
1731
1732
1733
1734
1735
1736
1737
1738
1739
1740
1741
1742
1743
1744
1745
1746
1747
1748
1749
1750
1751
1752
1753
1754
1755
1756
1757
1758
1759
1760
1761
1762
1763
1764
1765
1766
1767
1768
1769
1770
1771
1772
1773
1774
1775
1776
1777
1778
1779
1780
1781
1782
1783
1784
1785
1786
1787
1788
1789
1790
1791
1792
1793
1794
1795
1796
1797
1798
1799
1800
1801
1802
1803
1804
1805
1806
1807
1808
1809
1810
1811
1812
1813
1814
1815
1816
1817
1818
1819
1820
1821
1822
1823
1824
1825
1826
1827
1828
1829
1830
1831
1832
1833
1834
1835
1836
1837
1838
1839
1840
1841
1842
1843
1844
1845
1846
1847
1848
1849
1850
1851
1852
1853
1854
1855
1856
1857
1858
1859
1860
1861
1862
1863
1864
1865
1866
1867
1868
1869
1870
1871
1872
1873
1874
1875
1876
1877
1878
1879
1880
1881
1882
1883
1884
1885
1886
1887
1888
1889
1890
1891
1892
1893
1894
1895
1896
1897
1898
1899
1900
1901
1902
1903
1904
1905
1906
1907
1908
1909
1910
1911
1912
1913
1914
1915
1916
1917
1918
1919
1920
1921
1922
1923
1924
1925
1926
1927
1928
1929
1930
1931
1932
1933
1934
1935
1936
1937
1938
1939
1940
1941
1942
1943
1944
1945
1946
1947
1948
1949
1950
1951
1952
1953
1954
1955
1956
1957
1958
1959
1960
1961
1962
1963
1964
1965
1966
1967
1968
1969
1970
1971
1972
1973
1974
1975
1976
1977
1978
1979
1980
1981
1982
1983
1984
1985
1986
1987
1988
1989
1990
1991
1992
1993
1994
1995
1996
1997
1998
1999
2000
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
2014
2015
2016
2017
2018
2019
2020
2021
2022
2023
2024
2025
2026
2027
2028
2029
2030
2031
2032
2033
2034
2035
2036
2037
2038
2039
2040
2041
2042
2043
2044
2045
2046
2047
2048
2049
2050
2051
2052
2053
2054
2055
2056
2057
2058
2059
2060
2061
2062
2063
2064
2065
2066
2067
2068
2069
2070
2071
2072
2073
2074
2075
2076
2077
2078
2079
2080
2081
2082
2083
2084
2085
2086
2087
2088
2089
2090
2091
2092
2093
2094
2095
2096
2097
2098
2099
2100
2101
2102
2103
2104
2105
2106
2107
2108
2109
2110
2111
2112
2113
2114
2115
2116
2117
2118
2119
2120
2121
2122
2123
2124
2125
2126
2127
2128
2129
2130
2131
2132
2133
2134
2135
2136
2137
2138
2139
2140
2141
2142
2143
2144
2145
2146
2147
2148
2149
2150
2151
2152
2153
2154
2155
2156
2157
2158
2159
2160
2161
2162
2163
2164
2165
2166
2167
2168
2169
2170
2171
2172
2173
2174
2175
2176
2177
2178
2179
2180
2181
2182
2183
2184
2185
2186
2187
2188
2189
2190
2191
2192
2193
2194
2195
2196
2197
2198
2199
2200
2201
2202
2203
2204
2205
2206
2207
2208
2209
2210
2211
2212
2213
2214
2215
2216
2217
2218
2219
2220
2221
2222
2223
2224
2225
2226
2227
2228
2229
2230
2231
2232
2233
2234
2235
2236
2237
2238
2239
2240
2241
2242
2243
2244
2245
2246
2247
2248
2249
2250
2251
2252
2253
2254
2255
2256
2257
2258
2259
2260
2261
2262
2263
2264
2265
2266
2267
2268
2269
2270
2271
2272
2273
2274
2275
2276
2277
2278
2279
2280
2281
2282
2283
2284
2285
2286
2287
2288
2289
2290
2291
2292
2293
2294
2295
2296
2297
2298
2299
2300
2301
2302
2303
2304
2305
2306
2307
2308
2309
2310
2311
2312
2313
2314
2315
2316
2317
2318
2319
2320
2321
2322
2323
2324
2325
2326
2327
2328
2329
2330
2331
2332
2333
2334
2335
2336
2337
2338
2339
2340
2341
2342
2343
2344
2345
2346
2347
2348
2349
2350
2351
2352
2353
2354
2355
2356
2357
2358
2359
2360
2361
2362
2363
2364
2365
2366
2367
2368
2369
2370
2371
2372
2373
2374
2375
2376
2377
2378
2379
2380
2381
2382
2383
2384
2385
2386
2387
2388
2389
2390
2391
2392
2393
2394
2395
2396
2397
2398
2399
2400
2401
2402
2403
2404
2405
2406
2407
2408
2409
2410
2411
2412
2413
2414
2415
2416
2417
2418
2419
2420
2421
2422
2423
2424
2425
2426
2427
2428
2429
2430
2431
2432
2433
2434
2435
2436
2437
2438
2439
2440
2441
2442
2443
2444
2445
2446
2447
2448
2449
2450
2451
2452
2453
2454
2455
2456
2457
2458
2459
2460
2461
2462
2463
2464
2465
2466
2467
2468
2469
2470
2471
2472
2473
2474
2475
2476
2477
2478
2479
2480
2481
2482
2483
2484
2485
2486
2487
2488
2489
2490
2491
2492
2493
2494
2495
2496
2497
2498
2499
2500
2501
2502
2503
2504
2505
2506
2507
2508
2509
2510
2511
2512
2513
2514
2515
2516
2517
2518
2519
2520
2521
2522
2523
2524
2525
2526
2527
2528
2529
2530
2531
2532
2533
2534
2535
2536
2537
2538
2539
2540
2541
2542
2543
2544
2545
2546
2547
2548
2549
2550
2551
2552
2553
2554
2555
2556
2557
2558
2559
/* @(#)help.wrm	1.1    1/20/94 */ 

      /***************************************************************/
      /***************************************************************/
      /**  File wspec/help.wrm :                                    **/
      /**  Provides an online help for the ACeDB program.           **/
      /***************************************************************/
      /***************************************************************/
      /*                                                             */
      /*         R.Durbin & J.Thierry-Mieg.                          */
      /*                    last modified  22/9/91  by JTM.          */
      /*                                                             */
      /***************************************************************/


**acedb

    **************************************************************
    ****           acedb: A C. elegans Database               ****
    **** Richard Durbin (MRC, UK) rd@mrc-lmba.cam.ac.uk       ****
    **** Jean Thierry-Mieg (CNRS, France) mieg@kaa.cnrs-mop.fr****
    **************************************************************

This help page provides basic information for the whole program.
For specific help on the Main Window press the "Page Down" button.

Exit:
  To exit the program choose Quit from the menu in the main window.

Help:
  The F1 or F10 or Help key invokes the on line help related to the
  window to which the mouse points.  Some of these keys may not work on
  some machines or under some window managers, but one should!
  There is also a help entry in most menus.

Printing:
  The F2 or F9 key creates a post-script file in the
  subdirectory PS of $ACEDB.  It will then try to print it using 
  "lpr".  If the environment variable ACEDB_LPR is set (e.g. 
  setenv ACEDB_LPR "lpr -Pmyprinter"),  then that print command is
  used instead.  Setting it to an empty string will prevent
  automatic printing.  There is also a print option in most menus.

Color, Gray, Black and White screens:
  In principle, under X11, acedb will autodetect the type of screen
  you are using. In case of problem, you can try to setenv one of
  ACEDB_MONO, ACEDB_GREY, ACEDB_GRAY, ACEDB_COLOR, ACEDB_COLOUR.

Mouse:
  The left button is used to pick windows or objects. Usually, picking
  once changes the color of the box, picking a second time initiates
  and action.
  The mid button is used in some graphic windows to recenter (single
  click) or to zoom and recenter (by dragging in horizontal and
  vertical directions). On the Next, press both buttons to emulate
  the mid button. 
  The right button is used to access menus.

Menu:
  Under X windows (Openwin) you get the menu for any acedb window by
  pressing the right mouse button when the cursor is in the window.
  Under SunView you must press the right mouse button when the
  cursor is in the title bar of the window.

Text entry boxes:
  The yellow and green boxes are micro text editors. Only one of
  them is active (yellow) in a given window. To activate one, pick
  it with the left mouse button, this will position the cursor.
  Recognised commands are: Return key, Insert key (a toggle), Delete
  and BackSpace keys, Home and End key, the left and right arrows,
  a set of usual control keys to move (^f: forward, ^b: backward,
  ^a: to beginning, ^e: to end of line) and delete (^d: a char, ^w:
  a word, ^k: to end of line, ^u: whole line) and Tab which
  autocompletes the names when the class is known. 
 		
General info:
  The release number is available using Status in the main menu.	

  You may redistribute this program and database subject to the
  conditions in the following copyright notice.  Anyone interested in
  maintaining an up to date version should contact one of the authors
  at the above email addresses.

/* Copyright (C) 1991 R Durbin and J Thierry-Mieg. All rights reserved.
 * Written by Jean Thierry Mieg and Richard Durbin, 1990, 1991.
 * Redistribution and use in source and binary forms are freely
 * permitted provided that the above copyright notice and 
 * attribution and date of work and this paragraph are duplicated 
 * in all such forms and that neither this software nor software
 * based in whole or in part on this software is sold for profit.
 * THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
 * IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
 * WARRANTIES OF MERCHANTIBILITY AND FITNESS FOR A PARTICULAR 
 * PURPOSE.
 */

#################################################################

**Main_Window

  For general information about the program, how to get on line
help, how to use the mouse, how to print windows, authorship,
distribution, copyright etc, press the page_up button.

 ** To exit the program choose Quit from the menu in the main window. **

The main window lets you find objects in the database in two
different ways:

(1) You can pick a class by clicking with the left mouse button.
Clicking again will give a list of all objects in that class in the
Selection Window.  You can restrict this list by typing a template
in the Template box.  When you press the Return key you activate the
search.  Name recognition is not case sensitive.  A '*' in the
template will match anything; e.g. "S*" will match all names
beginning with 'S', "*S*" will match all names containing an 'S',
"*a*b" all names containing an 'A' and ending with a 'B'.  To
actually display the object you must pick its names twice in the
Selection Window (see help for Selection Window).

(2) You can type a text string in the Text Search box (first click
on it with the left button to make it yellow).  This will find all
the objects in the database which contain the search text.  More
precisely, we find all objects whose name contains the search
string, all objects they refer to, and all containing Text (or other
X class data) containing the search string.

In addition the Main Window menu allows access to many other
applications and functions of acedb.

Menu entries:
Quit	              Quits entire program
Help                  Gets the on line Help
Program Status        Info on the database
Clean up              Kills all acedb windows except main
Add update file       To read the official data updates 
Query                 Starts a window which has its own  help.    
Deficiencies          Primitive tool to analyse deficiency data.
Genetics              Run the get buttons to preprocess Mapping data
DNA                   Starts a window which has its own  help.    
Wild Worms            Starts an OPEN-WINDOWS screen saver if available

  Toggle entry (you only see one of these at a time)
Write Access          Select this to get write access to the
                      database. If you are not registered
                      in wspec/passwd, you will not be offered this option.
Save                  Saves all changes permanently and releases write access.
   
  The following entries only exist if you have Super-User access
Add/Alias/Rename      Starts a window which has its own  help.    
Read .ace files       Starts a window which has its own  help.    
Align maps            Starts a window which has its own  help.    
Read Models           Run this after modifying wspec/models.wrm
Dump asn models       Produces an asn definition file.
Dump                  Dumps the whole databse in ace format. Slow.
Debugger              Calls the function "invokeDebugger()", set a
                      break on this function in your favorite debugger.
Test subroutine       Calls acedbtest(), for use to test new code.

#################################################################

**Tacedb

    **************************************************************
    ****           acedb: A C. elegans Database               ****
    **** Richard Durbin (MRC, UK) rd@mrc-lmba.cam.ac.uk       ****
    **** Jean Thierry-Mieg (CNRS, France) mieg@kaa.cnrs-mop.fr****
    **************************************************************

This help page provides basic information for the line oriented
version of the acedb program.

Exit:
  To exit the program type Quit, or simply q 

Help:
  Type ?, or help, or help topic.

  You may redistribute this program and database subject to the
  conditions in the following copyright notice.  Anyone interested in
  maintaining an up to date version should contact one of the authors
  at the above email addresses.

/* Copyright (C) 1991 R Durbin and J Thierry-Mieg. All rights reserved.
 * Written by Jean Thierry Mieg and Richard Durbin, 1990, 1991.
 * Redistribution and use in source and binary forms are freely
 * permitted provided that the above copyright notice and 
 * attribution and date of work and this paragraph are duplicated 
 * in all such forms and that neither this software nor software
 * based in whole or in part on this software is sold for profit.
 * THIS SOFTWARE IS PROVIDED "AS IS" AND WITHOUT ANY EXPRESS OR
 * IMPLIED WARRANTIES, INCLUDING, WITHOUT LIMITATION, THE IMPLIED
 * WARRANTIES OF MERCHANTIBILITY AND FITNESS FOR A PARTICULAR 
 * PURPOSE.
 */

#################################################################

**Help  

  The online help is in the file wspec/help.wrm
  Each sections of the help menu starts by **section_name
  To register a help section with a display, just edit the file
  wspec/displays.wrm, do not recompile.

Menu:
	Gives the table of content.

Page Up : Page Down :
	Let you read the help file in consecutive order.

Push: 
        Enter the section in the help ring.

Pop:
        Circle backwards around the help ring.
	This ring contains the page accessed automatically from
	another window, those picked from the menu and those
	explicitly pushed into the ring. Not those you have
	been browsing through using page up/down.
	The ring is reinitialised if you kill the help window.

#################################################################

**File_Chooser

  Interactive File Chooser

  You can type a directory name in the top box and a file template
  in the second and third box. Or pick them from the current list
  which appears underneath.

#################################################################

**No_help

  For this display, no help was specified in wspec/displays.wrm

#################################################################

**Chronometer

  Integrated profiler.

  This profiler will run only if the code is compiled with the
option -DCHRONO (see in the file wmake/truemake) and will only
profile those functions which include a balanced pair of calls

chronoStart("Function name") ; chronoReturn() ;

To use it open the Chronometer from the main menu,
pick Start from the chrono menu
	do whatever you want, i.e. parse a file,
        may be interspacing your work with commands
	Start and Stop from the chrono menu
	when you are done
pick Show from the chrono menu

Print will copy the content of the chrono window to
	./PS/chronometer#.PS  
or simply
	./chronometer#.PS  
if you do not have a PS subdirectory in your current directory.

This output is in PostScript.

#################################################################

**Status

Displays information about the usage of the memory and the disk.

The first line indicates explicitly the session number,
this number is updated whenever new data are entered and saved,
the login name of the user, and his present write access state.

The line On disk  concerns  the file database/blocks.wrm
It indicates the number of blocks really used
by the database, followed by the number of blocks still available.
You may want to monitor these figures from time to time. The
number of used blocks should grow substantially only when you
parse a lot of new data or when you multiply the number of
different sessions kept available. It should decrease when you
destroy old sessions.
If at some point this file becomes full, the program will ask
permission to extend it as needed. If you refuse, the current
session will be lost and you will simply restart on the statu quo
ante.

The number of lexiques corresponds to the number of different
classes as defined in wspec/classes.wrm. The number of keys
is the number of independent objects known to the database, the
number of char is the cumulated length of their names and of
the entries in class Text.

The number of nodes and arrays gives an indication on the
usage of the memory. They may be useful to debug a new piece of
code and check, for example that all the arrays created for a given
purpose get destroyed when they should.

You should have 
	used objects = locked + known
and locked droping to zero after a clean up

The number of modified objects should drop to 0 after a *Save.

In the local menu you will find
Quit
	Destroys the window.
Help
	Invoke this page of the present file.
Update
	Refreshes the data displayed in the status window
More on lexiques
	shows how many objects there are in each class
BlockShow
	Gives some detail on the content of the first cache
	This info is only useful to debug or optimize
	the kernel of the acedb program.

#################################################################

**Cloning

Hopefully, this will turn into a full fledged tool to recompute
the physical map and assess its reliability. At present, it
does very little.
This option is not linked in release 1.4

Select project:
This  will look for a 
 binary file    $ACEDB_DATA/sulston/whatever_you_enter.bnd
if it does not exist the program will try to create it from the
ascii file    $ACEDB_DATA/sulston/whatever_you_enter.cor
which should contain the rawdata of the physical map, one integer
by line

Histogram:
Plots the histogram of the raw data just read.

Calcul:
Does nothing interesting yet (jan 1991), sorry.

####################################################################

**Linear_correlation

A small utility to compute and plot a linear regression
The prototype is :

typedef struct point {double x, y ;} Point ;
void plotCorrel(char *title, Array a)

Print;
	outputs the window as usual to ./PS/correl#.PS

Statistics:
	Not yet available. Sorry. 
	Should hopefully give likelihoods of the regression.

####################################################################

**Genetics

A tool to compute the genetic map.
Still in embryonic form, sorry.
Not linked in release 1.4

####################################################################

**Add_New_Objects

This window lets you perform various operations on whole objects.
Currently you add new objects, delete entire objects, and rename
objects.  You must have acquired write access for it to work.

First choose the class that you want to add to by picking
on it.  Then type the name of the object in the text entry box, then
select the operation you want to perform from the menu.  If you hit
return and the object already exists it is displayed in tree mode
(useful for confirming before renaming or destroying).

Double clicking on the classes does nothing.  All actions
are initiated from the menu.

Menu items:

Create: creates a new entry and displays and empty tree window for
it so you can get update mode and add data if you want.

Rename/Fuse: prompts for a new name.  Fuse does not work yet.

Delete: deletes object with all its data

####################################################################

**KeySet

Selecting a class in the acedb Main Window pops up a selection list.

It contains a list of keys which can be manipulated in many ways.
You can select any displayed key by  clicking it with the
left mouse button, it then reverts color. If you select it a second
time (double click without time-out), the corresponding object is
popped if it is known in the database. A clone will be displayed
as part of the physical map, a chromosome as a genetic map, most
other objects as text trees. You can overide this display type by
selecting it (one click) and choosing one of the options Tree or Dump
from the local menu.

Quit:
	Destroys the window.
Help:
	Invoke this page of the present file.

Add Key:  lets you add a key to the current list by picking.  You can
 	build up a heterogeneous list of object keys, e.g. for dumping,
	this way.
Copy:
	Copies the selection list to a new window. You should use this
	option to save the result of a previous selection before
	reactivating the Main Window.
Save:
	Saves the selection list as a new permanent object belonging
	to the class KeySet.

AND: OR: XOR:
	You must first pick with the left mouse button the
	background of another keySet window. Then these 3 options
	will perform the logical mix of your window and the other one
	and  present the result in the former.
	AND takes the intersection of the 2 sets,
	OR their union.
	XOR is the exclusive OR.

Ace Dump:
	Dumps all the selected objects into ascii file in the
	.ace format that you or some program (including acedb itself)
	can read.  This file could be transfered over the network 
	and read by the acedb program on another machine.  Also it
	is a convenient way to make a standard file containing the
	information in acedb about a set of objects.
Name Dump:
	Dumps the current list as a KeySet object (ace format).
FastA dump:
	this creates a file of DNA sequence data in the standard
	fastA format containing sequence for all objects in the 
	current list with DNA sequence attached.
  All the Dump options prompt you for a file name in an interactive
  window.

Tree:
	Displays the object as a text Tree if possible, as opposed to
	displaying it in its default display type (possibly graphic).
	This is useful to enter comments or update the objects by
	hand in some other way.
Biblio:
	Pops a window with all the papers related to the selected
	list : the paper themselves which are part of the list,
	those written by the authors of the list, those quoting the
	genes of the list, etc. The Biblio window can then be printed.
Debug:
	Interpreted binary dump of the relevant disk blocks.
	Only useful to debug the kernel if need be.
	No documentation provided, contact the authors and/or study 
        the directories w5 and w6.

###################################################################

**Query

Loads and execute external programs which sift through the data.
The idea is to prepare in a directory $ACEDB/wquery a set of program
files named xxx.qry containing sets of useful commands for selecting 
data.

The syntax of the acedb query language is a little complex but quite
powerful. It is explained in the Query_syntax help section and in
the latex document doc/query_syntax, and allows you to write command
files with parameters. An easier, but less powerful, interface is
provided by the Query_Builder, and Query_by_example which can be
acessed from the main acedb menu. The related Table_Maker allows the
contruction of relational tables.

########################
The Buttons have the following options :
########################

Quit:
	Quits this window with an option to save
	your current file of commands, provided
	you have given a file name.

Help:
	Invokes this section of the help file.

Print:
	Print this window to a postscript file and send to 
	printer (ACEDB_LPR).

Clear:
	Clears all the user-entry boxes on the window.

New KeySet:
	Calls up a new, blank keyset window titled "Query Answer".

By Example:
	Call up the Query-by-example window.

Builder:
	Call up the Query Builder window.

Load:
	Loads the file Directory/FileName.qry if it
	exists. The ending .qry is added automatically	

Save:
	Saves the present set of commands into
	the file Directory/FileName.qry 
	if you have write access to Directory.
	The ending .qry is added automatically	

Search Locally:
	Execute the current query on the local database and put 
	the found and selected objects in the Keyset (selection list).

Search IGD:
	Execute the current query for IGD and put the found
	and selected objects in the Keyset (selection list).

Search Server:
	Execute the current query on a remote ACEDB server and put
	the found and selected objects in the Keyset (selection list).

Undo:
	Cancels the last command and redisplays
	the previous Keyset (selection list).

########################
In addition to the commands above, the Menu have the following options :
########################

Print Window:
	Same as Print Button:
	Print this window to a postscript file and send to 
	printer (ACEDB_LPR).

Refresh:
	Redraws the window.

Clear Entries:
	Same as Clear Button:
	Clears all the user-entry boxes on the window.

Query By Example:
	Same as the By Example Button.
	Call up the Query-by-example window.

Query Builder:
	Same as the Builder Button.
	Call up the Query Builder window.

Load From File:
	Same as Load Button:
	Loads the file Directory/FileName.qry if it
	exists. The ending .qry is added automatically	

Save To File:	
	Same as Save Button:
	Saves the present set of commands into
	the file Directory/FileName.qry 
	if you have write access to Directory.
	The ending .qry is added automatically	

Send:
	Same as Send Button:
	Not used widely yet. (For Otto Ritter)
	This command sends the query to a remote 
	distributed database.

Enable Autosave:
Disable Autosave:
	When enabled (either by setenv ACEDB_AUTOSAVE or 
	from menu on query window), this function will save 
	the current series of query commands by appending 
	the it to the end of a time-stamp labelled file in 
	wquery/.  These files can be later edited (using a 
	simple text editor) and/or loaded.  The backup save 
	occurs whenever a Find (query search) is executed.

Search Locally:
	Same as Search Locally Button:
	Execute the current query and put the found
	and selected objects in the Keyset (selection list).

Search IGD:
	Same as Search IGD Button:
	Execute the current query for IGD and put the found
	and selected objects in the Keyset (selection list).

Search Server:
	Same as Search Server Button:
	Execute the current query on a remote ACEDB server and put
	the found and selected objects in the Keyset (selection list).

Undo Search:
	Same as Undo Button:
	Cancels the last command and redisplays
	the previous Keyset (selection list).

########################
In addition to the commands above, the Menu have the following options :
########################

Refresh:
	Redraws the window.

Autosave:
	When enabled (either by setenv ACEDB_AUTOSAVE or 
	from menu on query window), this function will save 
	the current series of query commands by appending 
	the it to the end of a time-stamp labelled file in 
	wquery/.  These files can be later edited (using a 
	simple text editor) and/or loaded.  The backup save 
	occurs whenever a Find (query search) is executed.

########################
Other details :
########################

Direct Query Commands (allows the  FULL query syntax)
	   Please select Query_syntax or page down for more details.
        Edit these boxes the same as the User Entry Boxes (pick with
	mouse, use keyboard).  Execute a query command by clicking
	(again) on the left mouse button or hitting the RETURN key. 

	If you edit the last command line a new, blank box is created 
	for the next input query command.
	
Scope:
	If the query starts as: FIND my_class, the whole class
        my_class is searched; otherwise the query commands act on 
        the active Keyset (selection list).
	To select another key set, pick it once.


###################################################################

**Query_syntax of the commands

A detailled description is presented in the manual doc/query_language_guide.tex

There are 3 possibilities
Find  Class  xxxxxx     
	The command xxx is applied to all the keys of the (sub)Class
        Abbreviation: >?Class xxxxxx
Follow Tag   xxxx
	The command xxx is applied to all the keys following
	tag in the objects of the active key set.
        Abbreviation: > Tag xxxxxx
xxxx
	The command xxx is applied directly to the active key set.

A command is a logical expression evaluating to True or False.
	it is applied to a key which is discarded or retained
	in the resulting list.

A composite query can be formed by chaining a series of queries
separated by semicolons, in which case the active keyset obtained so
far is passed into the next query.

Recognised operators are, in order of increasing precedence:
	|    OR
	^    XOR
	&    AND
	!    NOT
        #    Jumps in constructed types.
        <    <=    >    >=  to compare numbers
	=    to compare numbers or match the left hand side to a
	 	template, i.e  a word with wild chars *, ?.
        COUNT  Counts the number or entries to the right of its rhs
        IS  xxx  Checks if the name of the active object matches xxx
        CLASS xxx Checks if the active object belongs to (sub)class xxx

Parentheses of all sorts "([" can be used freely, but must be matched.

Words are matched to a tag or treated just as text.
	They must be put in "double quotes" if they include
	spaces or any operator &, |, ^, <, >, =, (, ), [, ], {, }.
Wild chars can be used in words but then they are not
	at present matched to tags except in a redirection
Numbers are parsed as floats.

Examples (as given in $ACEDB/wquery/examples.qry)

 >?Chrom*               will list all chromosomes 
 >?Author s* | a*       all authors whose name begins with s or a
 >?Au*  s?s* OR b*s*    all authors whose name matches s?s* or b*s*
 >Pap*  Journal = N* OR Year > 1987 
        Checks the previous list : redirect to papers and lists
	all their papers published in N(ature) or after 1987
 Year = 1988            Restricts to the papers of exactly 1987 
 >?Gen* myo* Clone      All the cloned myosin genes
Find Author IS "Sulston JE" ; >Paper ; >Author
			Finds all the coauthors of papers by Sulston.

Subfields
	To find the value of subfields you must first
	locate yourself on the tag then move right from it
	using NEXT (move right) or HERE (move here) for multiple checks.
	For example the genes to the end of
	chromosome X are found with

Find Gene gMap = X AND NEXT > 12 AND HERE < 19 ;
	
	Warning
	This is clearly hard to read, also it will be evaluated
	at execution left to right as it should only if the
	precedence of the operators allows it. Be careful.

Subtypes
       To locate a tag in a subtytpe, you must indicate the path
       using the operator #, example:

 Find Gene Lab AND NEXT#freezer = 4
      To find all the genes in your freezer number 4	

COUNT
     To count entries, example, find prolific authors:
 
 Find Author COUNT Paper > 100


###################################################################

**Query_Builder

The interface in this window is a little complex but it offers
a great processing power.

You can use the menu or act directly in the display, using either
the user-friendly entry boxes (top) or direct query syntax (on 
bottom line(s)).  

If you pick the Black triangles, then you will get a BLOCKING, scrollable
selector to choose from a long list of choices.  Please don't forget to
you must dismiss this window by either Cancel-ling with the button or menu,
or by double-clicking to select a choice.

The First Box on the First Line specifies what class you are seaching WITHIN.

On the Second Line (and successive lines), the First Box is the Attribute
that you are matching to.  The Second Box is the Operator which may differ
depending on the type of query you are performing (less than, equals, text).
The Third Box is the Value you are matching to the Attribute.  The Fourth
(and last) Box is a conjunction to allow for more Conditions (as formed
on the second line) to be specified.

########################
User Entry Box Details
########################

Class-Tag Box:
	(The box with the default "ANY CLASS" in top left.)
	Use this box to select the class you are searching within.
	This entry determines the list of attributes for the Attributes box.

Pre-Class Box:
	(Usually Hidden, ignored, this box will appear in the top right area
	 when the "Show More" option on the menu has been chosen.)
	Use this box for Secondary/indirect queries wherein you wish to
	find refer to this entry first, find a specific class within this
	entry's model, and search for objects within that second, specific
	class (which is specified by the Class-Tag Box).

Attribute Box:
	(First box to the right of the text "where").
	Use this box to list any attributes within a class' model which
	you wish to test for.
	On both the Selector and the Popup menu for the Attribute Box,
	you may see the choice "USE TAG CHOOSER" which will call up 
	a model-display for the current class and you can double-click
	on a tag label to choose a tag within this context.

Condition Box:
	(Second Box on line beginning with "where")
	This box presents a list of operators which will be applied 
	to the attribute.
	>Some operators (exists, does not exist) do not take any arguments.
	In the top set of choices on the pop-up menu, "contains", "begins
	with", and "ends with" merely combine wildcards (such as "?" and
	"*") with the equality operator.
	>Equality and inequality can be tested for using the middle set of
	choices on the pop-up menu.
	>The bottom set of choices allows you to query on the number of
	instances of data (a REPEAT list) associated with the current
	Attribute in the data objects.

Value Box:
	(Third box from right on "where" line.)
	Later, this may supply more hints as metadata becomes available.
	Currently, enter the arguments for the comparisons used in the
	Conditions box here.  "?" (single character) and "*" (0 or more
	characters) are valid wildcards and quoted strings are accepted.

Conjunction Box:
	(Last box, far right, on "where" line.)
	Use this box to form conjunctive query conditions, to use the
	"#" (and-submodel) function, and to demark the end of a query
	with the special word "END".

########################
The Buttons have the following options :
########################

(Most of the button and main menu commands are the same as the 
	Query Commands window.)

Quit:
	Quits this window with an option to save
	your current file of commands, provided
	you have given a file name.

Help:
	Invokes this section of the help file.

Print:
	Print this window to a postscript file and send to 
	printer (ACEDB_LPR).

Clear:
	Clears all the user-entry boxes on the window.

New KeySet:
	Calls up a new, blank keyset window.

By Example:
	Call up the Query-by-example window.

Command Edit:
	Call up the Query Commands window.

Search Locally:
	Execute the current query and put the found
	and selected objects in the Keyset (selection list).

Undo:
	Cancels the last command and redisplays
	the previous Keyset (selection list).

########################
In addition to the commands above, the Menu have the following options :
########################

Print Window:
	Same as Print Button:
	Print this window to a postscript file and send to 
	printer (ACEDB_LPR).

Refresh:
	Redraws the window.

Clear Entries:
	Same as Clear Button:
	Clears all the user-entry boxes on the window.

Show More:
Show Less:
	For more advanced users, this option will display (hide in case
	of Show Less) a box allowing the user to choose where to begin
	a query.  ALL DATA is default.  Otherwise, a query can begin
	from a class and search it's subclasses.  A subclass of a
	class is a particular attribute (tag) within the class model 
	and is named the same as a corresponding, separate class.

Query By Example:
	Same as By Example Button.
	Call up the Query-by-example window.

Query Command Edit:
	Same as Command Edit Button.
	Call up the Query Commands window.

Search Locally:
	Same as Search Locally Button.
	Execute the current query and put the found
	and selected objects in the Keyset (selection list).

Undo Search:
	Same as Undo Button:
	Cancels the last command and redisplays
	the previous Keyset (selection list).

########################
Other details :
########################

Query Builder (User Entry Boxes) :
        You activate an entry box by picking it (click with the left
	mouse button).  It turns yellow (dark grey on monochrome) 
	and all keyboard-input will then enter into that box.

	Use the right mouse button to bring up pop-up menus containing
	appropriate choices for each user-entry box.

	Not all functionality of the query language is implemented in
	the query builder.

	By some of these boxes, there is a triangle that can be clicked
	on with the mouse.  This will activate a selector menu with
	a scroll bar in case the popup menu does not fit on the screen.
	"Cancel" must be pressed (button) or chosen (popup menu on 
	selector window) or a selection must be made (double-click on
	an entry) to dismiss.

Scope:
	The query commands modify the active Keyset (selection list).
	To select another key set, pick it once or use the New KeySet 
	option on the menu.

Query Commands Display:
	If the Query Commands window is open, the syntax formed by the
	Query Builder will be shown on a command edit line there.

   Please select Query_syntax or page down for more details.

###################################################################

**Query_By_Example

Based upon a fill-in-the-blank and toggle-button style of entry, 
this window allows the user to fill in values in a class model-display.

These values are then used in a conjunctive query command
to retrieve data objects from the database.  

This window can be used in conjunction with or independently of the
Query Window. (see Query);

>> -*- IMPORTANT: Note that some attribute-tags are used in a boolean 
>> *+* exists/does_not_exist fashion.  See Boolean Attributes below.
>> -*- Also, to execute a query formed in this window, use the FIND button.

N.B.  If you Read Models and update the models, you may have to restart
the ACEDB program for the correct QBE display to appear.

########################
The Buttons have the following options :
########################

Quit:
	Exits the window.

Help:
	Invokes this section of the help file.

Clear:
	Clears the entry boxes and redraws the window from scratch.

New KeySet:
	Calls up a new, blank keyset window.

Command Edit: 
	Call up the Query Commands window.

Search Locally:
	Execute the current query and put the found
	and selected objects in the Key Set.

Undo:
	Cancels the last command and redisplays
	the previous Keyset (selection list).

>From Selector/ Change Query Search Box:
	Actually a menu (activate by right mouse button), this 
	allows the user to use the current keyset as the base for
	a query or to use the current class shown.
	Simple clicking of the left mouse button will "step" 
	through the menu selections.

Class Selector/ Change Class Status Box:
	Actually a menu (activate by right mouse button), this 
	allows the model being currently shown to be changed to any
	class in the database.  Simple clicking of the left mouse
	button will "step" through the menu selections.

########################
In addition the the above functions, the Menu has the following options:
########################

Print:
	Print this window to a postscript file and send to 
	printer (ACEDB_LPR).

Refresh:
	Redraws the window.

Query Builder:
	Same as the Builder Button.
	Call up the Query Builder window.

Query Command Edit:
	Same as Command Edit Button.
	Call up the Query Commands window.

AND, OR :
	The various tags and fields are connected via the conjunctions
	AND (&) and OR (|) as selected on the menu.  Use the Query Builder
	window to view the composed query command.

Show Full Description:
	Calls up the metadata associated with the last picked (left 
	mouse button) label or entry-box on the display.

Show Long Description:
	Calls up the ?LongText metadata associated with the last picked 
	(left mouse button) label or entry-box on the display.

Search Locally:
	Same as Search Locally Button.
	Execute the current query and put the found
	and selected objects in the Keyset (selection list).

Undo Search:
	Same as Undo Button:
	Cancels the last command and redisplays
	the previous Keyset (selection list).

########################
Other details :
########################

User Entry Boxes:
        You activate an entry box by picking it (click with the left
	mouse button).  It turns yellow (dark grey on monochrome) 
	and all keyboard-input will then enter into that box.

	On a carriage-return (CR), the entry is processed for 
	correctness and, if the Query window is up, will output
	a formed query to the current query command line. 
	Any subsequent call to the Find button will re-process
	the every entry's current contents, form the query on the
	Query window (if appropriate), and execute the query.
	
ITEM NAME:
	This is a special box at the top which can be activated to
	query using the names of items within the current class.

Valued Attributes:
	(also called attribute, field, tag, subclass)
	All valid attributes will have an Entry Box to the right of it's
	name.  Simply pick and edit a box for it to be folded into the
	current query command.  
	Sub-conditions, such as "< 100.1", "> fred", and "!= gene21"
	are allowed in these lines.  For the numeric entries, the user
	will receive a warning that the syntax is not numeric, which
	can be ignored at the user's choice.
	
All Attributes:
	If you wish to deactivate or activate only the tag, the 
	attribute labels can be toggled on or off regardless of
	whether or not a corresponding attribute field is empty 
	or filled.

Scope:
	The query commands will modify the active Keyset (selection list).
	To select another key set, pick it once or use the New KeySet
	command.

Query Commands Display:
	If the Query Commands window is open, the syntax formed by the
	Query-By-Example window will be shown on a command edit line there.

   Please select Query or page up for more details.

###################################################################

**Table_Maker

This facility is related to the Query system discribed above.
It allows the construction of tables, or tuples, of object names
and field values and the construction of multiple-maps (see below).

This system uses 3 windows, the definition window explained here,
which allows you to define your table, the data window which reuses
the same space and is explained in the next section, and the
multimap window which is created by pressing the map button in the
data window.

The interface in the definition window tries to be more user
friendly than the interface in Query. Once constructed, the
definition of a table is stored in the directory ./wquery as **.def.
It is however unwise to edit the def file by hand and we recommand
that you edit it via the interface.


MAJOR BUG: As of 1-9, you can only access the first line and first
column to the right of a tag. For example, if you try to list all
exons in a sequence, you correctly obtain the start of each exons,
but it is then wrongly followed each time by the end of the Fisrt
exon.

########################
The menu has the following options :
########################
Quit:
	Quits this window with an option to save
	your current file of commands, provided
	you have given a file name.

Help:
	Invokes this section of the help file.

Print:
        Prints out this window as is.

Save:
	Saves the present set of definitions into
	the file Directory/FileName.qry 
	if you have write access to Directory.
	The ending .def is added automatically	

Load:
	Loads the file Directory/FileName.def if it
	exists. The ending .def is added automatically	

Create definition:
        Creates space for a new definition. See below.

Suppress definition:
	Suppresses the active definition. You activate a definition
        by picking one of its boxes, for example the hidden/visible
        buttton.
 
Show All Data:
        If you have just changed the definitions, initiates a search
	of the whole database according to your definitions  and
	display the results.
	Else re displays the same data, even if they were contructed
	from the active KeySet. 
	In particular, modifying the width of a column or its
	visible/hidden status does not initiate a new search.

Show Active KeySet:
        Initiates a search of the objects enumerated in the
	Active-KeySet according to your definitions  and
	displays the results. 


##################################
A Definition consists of:

Its number, which is used in the "Constructed from" field of the
other definitions.

A widht box, which you can edit after picking it with the left mouse
button. It indicates the widht of the column of data when displayed.
Press return to fix, the value. 

A visible/hidden button. You can rotate it with the left mouse
button by picking or directly with the rigth mouse button and a
pull-down menu. If a definition is hidden, the corresponding data
will not show in the data-display. This will reduce the number of
columns of the data display, but most probably, also the number of
lines. For example, if you show a paper in column 1, and its authors
in collone 2, you will get as many lines as authors, by hiding
author, you keep only one line. 

An optional/mandatory button. You can rotate it with the left mouse
button by picking or directly with the rigth mouse button and a
pull-down menu. If a definition is mandatory, only the lines
satisfying it will be kept. This restriction applies even if the
corresponding definition is hidden.

The Class field. In column 1, Class is a pull-down menu which can be
activated with the right mouse button. It lists all the visible
classes, but you should only select a B-class. When you then press
the show all data button, only the corresponding class wil be
explored.

The Constructed from field. Tells the system where-from it should
recover its data.

The Tag button. By pressing the tag button, the model of the class of
the definition you are "constructing from" is displayed. Double pick
an entry there. You active definiton will be updated accordindly.
There are 3 possibilities: Tag, Object,Value.
For example, the Gene Class model has a line:
   gMap ?Chromosome Float Float
Picking gMap, the column will be Boolean, with entry TRUE or FALSE,
depending if gMap is present or not in the corresponding gene.
Picking ?Chromosome, the column will be Class Chromosome, and you
will be able to use it as a from from a follow up definition.
Picking the first or second Float, the column will display the
corresponding number, in this case a position on the genetic map and
may use this column of number to draw a multiple map.

You may also edit the tag field manually, following the Query-syntax
explained in the preceding page, but this will not edit the Class
field of the definition which must be set either by editing the .def
file manually or by using first the tag button and choosing the same
sort of field.

The condition field is applied at last to the selected object.

In fact the query system is applied twice in every definition, once
using the tag field, to select the piece of data you want, a second
time, using the condition field, applied to the picked object. The
best is to srudy and edit the exampleds provided and/or complain to
the authors.

BUG: At present, you cannot restrict a number to a given range using
the condition field, sorry, this should be fixed later.

###################################################################

**Table_Maker_Data



Quit:
	Quits this window with an option to save
	your current file of commands, provided
	you have given a file name.

Help:
	Invokes this section of the help file.

Print:
        Prints out this window as is.

Switch:
	First touch an element in some column, then press Switch,
this will exchange the active column with the one immediatly to its
right. At the same time, the line are reordered so that they always
reamin in alphanumerical order left to right. By Putting the genes
left of their position, you get them in alphbetic order, by putting
first the chromosome, then the position, then the gene, you get them
in genetic map order.

Export KeySet:
	Exports the active column, if it contains keys.

Define Table:
	Returns to the Table_Maker definition window.

Map:
	Construct a multiple map based on the visible numerical
columns. See next help-page.

Ascii Dump:
        Dump the table in Ascii format.

###################################################################

**Multi_Map

This facility is invoked by the Map button of the table_Maker.

Then interface is modelled on the genetic map display.
Each numerical column of the table corresponds to a map. Each entry
is shown as a yellow square which you may pick. Squares
corresponding to a single line of the table are linked together,
ending on the name of the object in column 1 of the definition of
the table. Note that by switching the columns in the table, yous
witch the maps but you cannot change the name shown. This is because
only the name in column 1 is garanteed to be unique. 

When you pick a name or a square, the corresponding line in the
Table is lighted. 

Quit-Help-Print: as usual.

Zoom all/Zoom active: 
Using the wwhole and zoom in/out buttons you
zoom either the active map or all of them at the same time.

Recenter:
You can recenter the active map with the mid mouse button.

Zoom and recenter:
With the mid mouse button in the left part of the graph, you can
zoom and recenter at the same time by dragging in x-y. This action
applies to the active map only.

With these functionality it is easy to realign a given region of the
mutimap. A good exaple is given in g2pmap which you can load from
the table maker definition window.



###################################################################

**Histogram

An embryonic graphical tool.

Prototype: void plotHisto(char *title, Array a)  ;

Plots the histogram of the array of integers a.

Print:
	Outputs the result to the Post Script file ./PS/histo#.PS

The histogram itself is plotted in blue. 

In the top right corner:
	total indicates the cumulated sum, i.e. the integral of y(x),
	max y(xm) = ymax indicates the coordinates (xm,ymax) of the maximum.
	max x is the maximal x value.

In the top left corner, the pair of number indicates the coordinates
of the center of the black reticule. Picking anywhere with the left
mouse button, you can move the reticule and get its new coordinates.

Statistics:
  Primitive: just gives the average and  the variance of the plot.


###################################################################

**Plot_Curve

Another  embryonic graphical tool.

Prototype: void plotCurve(char *title, Array a)  ;

Plots the curve described in A as an Array of pairs of float:
	x1, y1, x2, y2 ....

Print:
	Outputs the result to the Post Script file ./PS/histo#.PS

The histogram itself is plotted in blue. 

###################################################################

**Bibliography

Displays the bibliography related to a KeySet. This tool
is called from another display window by invoking there
the menu entry Biblio.

Print:
	Outputs the result to the Post Script file ./PS/biblio#.PS


###################################################################

**Tree

This represent a typical Text object (class B)

Buttons
*******

Quit, destroys this window.

Tables... : this button is only present if a table_maker command file
has been registered with the class of the urrent object in the file
wspec/table.menu.wrm. If present, the button contains a submenu with the
list of these tables which are selected with the right mouse button.

The main menu has the following entries:

Help, displays this help page.

Print, prepares a Post Script file pmapxxx.PS in ./PS
	You can then print it on your local laser printer.

Update:
	Lets you edit the object, only if you have write access.
	Please select Update or page down for more details.	

Biblio:
	Pops a window with all the papers related to the object
	The paper themselves which are part of the list,
	those written by the authors of the list, those quoting the
	genes of the list, etc. The Biblio window can then be printed.
Tree:
	Displays the active box a s tree if possible, rather than
	graphically as may happen when you double click a box.

Image display and other system calls:
	There is a special Tag: Pick_me_to_call
	present in particular in class Image. Picking twice this tag
	will call an external program defined just after the
	File tag, the second parameter beeing a file name suppose
	to exist in the subdirectory externalFiles.
	For example, we could have
	 Pick_me_to_call iconedit myIcon
	Resulting in the call
	   system(cd externalFiles ; iconedit myIcon) ;
	
###################################################################

**Update

Lets you alter and modify any text object.  Double click on anything
to add/change.  Objects in blue are part of the model, i.e. new
things that you could add.  If you double click on part of the
exisiting object you will be able to edit it, if on the model you
will be asked to add a new entry.  

If the entry is for an object name then you have a number of
options.  You can double click on the object name in another window
if you have it displayed.  Alternatively you can type in the name of
the object.  If you type in a partial name and hit the TAB key then
a list of possible completions will be given in the Main Selection
Window, and your entry in the update window will be automatically
completed up to the first ambiguous letter.  In particular if there
is a unique existing completion then it will be expanded in full.

Quit, destroys this window.

Help, displays this help page.

Save, saves the updated object to the database. 
	From then on, the new values will be used in the
	current session. The changes will become permanent only
	if you also Save the session from the main ACEDB menu.

Add comment,  let you add a comment anywhere in a an object, 
	irrespectively of the model. You can even attach your
	comment to the third number of a list of five. The comment
	will be lost if the entry it is attached to is deleted.
	
Delete: Deletes the selected entry (tag, data or object - pick it
	first) and anything to the right of it.  You can delete
	whole subtrees.

Cancel:	Cancel the current command (Add, Edit, or Add Comment).

Edit:	lets you edit an exisiting entry (equivalent to just double
	clicking on it).

###################################################################

**Dump

Dumps the whole data base into an ace file.

The dump file  can be edited by hand, parsed back in an empty system
(provided you split out the copy of the tags and classes files)
or use with diff to compare 2 sessions.

At the same time, Dump checks the integrity of the whole
database, verifies the existence of all the XREF's.

Dump dumps all the Visible A and B(not X) classes  
this information is sufficient for a complete reconstruction.

###################################################################

**Physical-map

This display represent the alignement of clones into contigs
Next help page explains the clone types

Picking in the Yellow bar (when present) moves you to the sequence.

Picking in the lower Green  bar moves you to the genetic map by local
linear interpolation btween the nearest localised clones.

Quit, destroys this window.

Help, displays this help page.

Print, prepares a Post Script file pmapxxx.PS in ./PS
	You can then print it on your local laser printer.

Preserve, insure that the next pmap will be displayed
	in a different window, otherwise the present one 
	will be reused.

Redraw, useful from time to time if the window gets
	clogged accidentally after moving the window 
	or following arrows.

Recalculate, recomputes the display from the map data.
	Otherwise, the same display is shown again 
	and again. We could make the recalculation automatic
	after any update of the clone tress
	but it would slow the program if you alter
	some data which do not actually influence the drawing.

Show All Remarks, there are three categories of comments: General_,
	PCR_ and Y_.  Typically, PCR_ and Y_ comments were used by 
	John and Alan to help build the map (as are many General_
	ones) and are not very useful to the rest of us.  This 
	switch is a toggle - turning on and off showing the extra 
	comments.

To Genetic Map: Moved to the real or estimated genetic position
	of the selected item.

Apart from the menu options, you can pick any clone and
	obtain it in text form, or pick the comments and
	the genes that may appear under the map.
	Using the arrow keys, you will move from 
	one clone, comment or gene to the next.

The mid button recenter the display, slowly in the upper part of the
window, faster in the lower part where a back bone of the physical
map is shown.
	
NB Page down to get a list of clone types

###################################################################

**Clone-types

Clone types in the physical map of Caenorhabditis elegans.

   Most clones are defined by their initial letter(s), according to
the table below.
   The principal exceptions are:-
(1) Clones given laboratory designations (2 letters followed by #)
(2) MIT clones, which have 1, 2 or 3 identical letters, followed by 
       any letter from A to H, followed by a number from 1 to 12.  Vector 
       is pHC79.


  Clone		Vector:
    name:

  A		Lambda 2001  Sau3AI partial
 ZL		Lambda 2001  Sau3AI partial   probed
YSL		Lambda 2001  YAC subclones, Sau3AI partial


  B		pJB8	serial  Sau3AI partial
  C		pJB8	gridded in microtitre plates  Sau3AI partial
  D		pJB8	gridded on filters  Sau3AI partial
  E		pJB8	EcoK minus  Sau3AI partial
  R		pJB8	RI partial
  M		pJB8	MboI partial
 ZC		pJB8	probed


  K		LoristB	    Sau3AI partial
  T		Lorist2     Sau3AI partial
  W		Lorist4     NotI plus Sau3AI partial
  F		Lorist6     Sau3AI partial
 ZK 15- 56	Lorist6     Sau3AI partial   probed
    57-130	Lorist2       "	      " 	"
   131-164	Lorist6       "	      " 	"
   165-177	Lorist2       "	      " 	"
   178-192	Lorist6       "	      " 	"
   193-344	Lorist2       "	      " 	"
   345-354	Lorist6       "	      " 	"
   355-514	Lorist2       "	      " 	"
   515-552	Lorist6       "	      " 	"
   553-596	Lorist2       "	      " 	"
   597-616	Lorist?       "	      " 	"
   617-626	Lorist2       "	      " 	"
   627-692	Lorist6       "	      " 	"
   693-756	Lorist2       "	      " 	"
   757 onwards	Lorist6       "	      " 	"


  Y		pYAC4   RI partial


###################################################################

**Contig-editor

Picking on displayed entities follows the paradigms of the physical map.

In addition there is a control bar at the top of the graph, containing menu-
buttons, and a cue.  The editor has four menus, which can be selected by picking 
on the menu buttons.

The control bar has a yellow window displaying the latest-visited
position of the scrolling cursor (middle mouse button) in 
band coordinates.

Cues and information messages are displayed on the right of the control bar.

The map has a scale calibrated in band units.

SETTING AND USING MARKS

A mark is a labelled position on the contig. It is represented by a vertical
line through the map, labelled with a band position.  The current mark is
highlit (yellow).
Most editing operations are carried out relative to a mark.  Marks
can be set anywhere in the contig, and used to snap to a given part of
the contig, which may be off-screen.  The simplest way of setting a mark
is to line up the scrolling cursor with a feature on the map, and select 
"Set Mark At Cursor Position".

MARKS MENU

- Set Mark At Cursor Position: set a mark at the current cursor position
- Mark Centre: set a mark at the current centre of graph
- Mark Centre Of Cosmid: set a mark at the centre of the current cosmid
- Set Mark: set a mark at a specified band coordinate

- Zero Scale To Mark: recalibrate the scale with current mark=0 - this 
    does not change the model
- Set Scale At Mark: recalibrate the scale with current mark= specified band
    coordinate - this does not change the model
- Reset Scale: restore original calibration of the scale

- Snap To Mark: display graph centred on current mark
- Snap To Previous Mark: display graph centred on previous mark: this allows
    toggling repeatedly between the latest two marks set
- Visit Mark: display graph centred on each mark set, in turn, in reverse order
- Delete Mark: delete current mark (this will occur even if it is off-screen)
- Delete All Marks: you guessed it

UTILITIES

- Overview Physical Map: peek at the default physical map display, preserving the
    state of the editor - useful for fast scrolling using the physical map's 
    mini-contig
- Finished Edit: finish editing session, and revert to the default physical map
- Quit: quit this physical map - like Quit on the default map
- Help: what you are reading
- Print: PostScript dump of the edit panel
- Preserve: as elsewhere
- Redraw: as elsewhere
- Remarks: vary the density of remarks displayed in the edit panel: this is a 
    switch with three states
- Recalculate: as elsewhere
- Unhighlight, Revert: clean the edit panel - remove all highlighting, editing
    marks, etc and restore the default level of remarks

EDITING CLONES

- Left End Of Clone To Mark: move the currently-selected clone so that its left
    end abuts the current mark
- Right End Of Clone To Mark: move the currently-selected clone so that its right
    end abuts the current mark
- Extend Left End Of Clone To Mark: extend the currently-selected clone so that its 
    left end abuts the current mark
- Extend Right End Of Clone To Mark: extend the currently-selected clone so that its
    right end abuts the current mark
- Show Buried Clones Of Clone: show buried clones of currently-selected clone - 
    they are not automatically positioned at present
- Show All Buried Clones: show all buried clones of the contig - 
    they are not automatically positioned at present
- Attach Clone: introduce a YAC or cosmid into the contig
- Detach Clone: detach the currently-selected YAC or cosmid from the contig

CONTIG-WIDE OPERATIONS

- Open Contig: The contig is cut at the current mark, and one side
    positioned relative to the other by dragging it left or right with 
    the left mouse button down, to compress or extend the contig at the
    mark.  A crosshair marks the current cursor position. The current position 
    of the moving side of the cut is displayed in the cue, and the current
    position of the cross-hair cursor is displayed in the 
    yellow position box in the control bar. When the contig
    is recalculated, a new mark is placed automatically at the final position
    of the moving side of the cut, and the position of all affected marks
    is updated.
    F4 has the function of an UNDO key for this operation: you can interrupt
    and back off this operation.


AUTOPOSITIONING

Operates on two keysets: one specifying the domain of interest for matching, 
the other the new clones. Generates a report of results which has operations
defined on it for surveying and editing positioned clones. After running the 
autoposition function, the internal cache representing the domain set, and the
data of the results of the autoposition function can be saved in separate
files for future use. The default domain is the entire database of clones -
this does not have to be specified explicitly; and its internal representation
can be saved for future use.  Generating the internal representation of the
domain is a slow operation for large keysets.

The results are displayed on a pad with sensitive areas. This allows picking
clones of interest. A pick on a matched clone in the context of the pad
causes the clone of interest (the "subject") to be positioned against the
match on its contig.  The result of this operation can be Edited, Accepted,
Rejected, or Bury-ed beneath its match.

Use of accelerators: the following have been defined on the pad, and on the
edit panel when autopositioning is in progress.

UP, DOWN arrow keys - previous, next match for the current subject
LEFT, RIGHT arrow keys - skip to results for previous, next subject 
'a' - accept this match (adds subject to the contig)
'r' - reject this match
'e' - add the subject to the contig as displayed, for manual edit
'b' - bury the clone under its match

Fingerprints can be displayed on a separate window, which acts as a scrollable
log file.

AUTOPOSITIONING - AUTO MENU ON EDIT PANEL

- Autoposition Clones from Keyset: use current keyset 
- Set Autoposition Domain: use current keyset to define domain of Autoposition 
  operation 
- Load Domain: load internal representation of domain from named file 
- Use Whole Database: implicit argument 
- Save Domain: in a named file 
- Load Results: load data of previous Autoposition from named file
  A results file cannot be loaded without loading an appropriate domain file.
- Save Results: in a named file 
- Fingerprint: show fingerprint of the currently-selected clone

AUTOPOSITIONING - REPORT PAD MENU

- Quit
- Help
- Print
- Preserve
- Save Results
- Save Domain
- Tree

Switches -
- Set to Edit: the default behaviour of the accelerator keys is to advance to
  the next match (or next subject's first match) and position against that: when
  this switch is set, the latest match is displayed on the edit panel after
  using the accelerators, instead
- Show Fingerprints: when this switch is set, clone fingerprints are displayed
  automatically in the Fingerprint window whenever a clone on the report is 
  selected, or the accelerators are used

Edit operations -
- Accept
- Reject
- Edit
- Bury Clone

- Fingerprint: show fingerprint of the currently-selected clone

FINGERPRINT WINDOW MENU

- Quit
- Help
- Print
as default.

###################################################################

**Genetic-map

This display represent the genetic map.  You can pick most things.

The contigs are displayed past their last gene -- in many
cases they extend much further, but we don't really know how far in
genetic units so take our estimate estimate with caution.
	  If you double click on the contig it interpolates
to the physical map using the nearest two genes for which there is
genetic map data.  Sometimes if the relative order is wrong this
can be confusing.  All this will improve in the future.

MENU:
Quit, destroys this window.

Help, displays this help page.

Print, prepares a Post Script file pmapxxx.PS in ./PS
	You can then print it on your local laser printer.

Preserve, ensure that the next gmap will be displayed
	in a different window, otherwise the present one 
	will be reused.

Recalculate, recomputes the display from the map data.
	Otherwise, the same display is shown again 
	and again. We could make the recalculation automatic
	after any update of the clone tress
	but it would slow the program if you alter
	some data which do not actually influence the drawing.

Highlight Selected Objects/Show Selected Objects/Show All Objects
	Highlight or restrict to only those objects belonging to the
	map and the selected keyset (normally the list in the Main
	Selection Window, or one made by the Query facility).  All
	reverts to the complete unhighlighted map, and removes any
	highlighting from the GMap Data button option.

Load/Save Private Map
	After editing a map you can save and retrieve it later.  The
	saved map does not appear in the standard chromosome list.

BUTTONS: 
Whole Chromosome, Zoom In/Out affect the amount of the map being
displayed. They are equivalent to the continuous centering and
zooming that you get by picking with the middle button in the left
column of the map and dragging up-down to recenter, left-right to
zoom.

GMap Data: Shows CGC map data in graphical form.  You can click on
the 2point and 3point data entries to see the actual data.

Highlight/Some/All: Equivalent of the menu entries to highlight or
show selected or all objects.

Drag Gene: Pick a gene or a def-dup, press this button, then drag
the gene with the mid mouse button. Useful to edit the map. You can
then save your private version.

COLOR CODE when using the "GMap Data" button.

Red   : The active object.
Yellow: Contact to the physical map.
        Yellow genes are cloned.
	The little yellow boxes are direct hooks to these clones.
	The long yellow bar is the contig. Picking it moves
	you to the corresponding place in the contig.
Grey  : Background to the name of the colored rearrangement.
Green : Those genes covered by the red rearrangement.
	Those rearrangements covering a red gene.
	The gene mapped 2_points relative to the red gene.
Blue  : Those genes not covered by the red rearrangement.
	Those rearrangements not covering a red gene.
	The gene mapped 3_points relative to the red gene.
Magenta : Objects explicitly highlighted with the Highlight option.

The All button removes green, blue and magenta colours.

The ZOOM buttons act on the whole map around the
center represented by the little green box.

DRAGGING.
You can recenter the display by pressing with the centre mouse
button and dragging, or by picking with the left mouse button and
dragging either
  - the small  black box sitting on the scale.
  - or the long green box at the left of the picture.

###################################################################

**Chromosome-map
		
This display represent the the Chromosome in physical units.

The little squares are clones. You must import them from a keyset
using the menu. You can import anything whose position is known in
physical units such as clones, cDna, clone genes etc.
 
MENU:
Quit, destroys this window.

Help, displays this help page.

Print, prepares a Post Script file pmapxxx.PS in ./PS
	You can then print it on your local laser printer.

Preserve, insure that the next gmap will be displayed
	in a different window, otherwise the present one 
	will be reused.

###################################################################

**Feature-map     
		Click page-down for more information.
This display represents the the sequence.  You can pick most things.

GENEFINDER
  Much of the functionality of Phil Green's genefinder package is
built into ACEDB.  A reference is given when you first use the
package.  To access genefinder functions, use the right mouse button
on the indicated box to get at the submenu.  You must get "Genefinder
features" first.  Then "Autofind Gene" will act in the current active
zone.  It will attempt to find the best predicted gene including all
features currently selected (indicated in LIGHTGREEN).  If you have
write access it will create a working gene model, called "Temp_gene".
Selected features can be hand-edited by using the submenu attached to
each feature.  "Fix temp_gene" allows you to make temp_gene into a
permanently stored gene prediction.  "Gene->selected" allows you to
set the selected features from a previously determined gene.
"Selected->temp_gene" lets you convert the currently selected features
into a gene structure.  One common cause of problems is that some
features are selected somewhere else in the sequence (perhaps the
other strand!) -- use the "Clear" button to reset everything.

Genefinder uses tables of codons frequencies etc which are part
of the acedb distribution in the wgf subdirectory. The environment
variable GF_TABLES will overide the $ACEDB/wgf default and let you
use your own tables.

DISPLAY CONTROL BUTTON
  This gives access to a menu of display options.  All the options can
be toggled by picking on them.  e.g. select "DNA Sequence" to see the
DNA. Note that, to see the DNA, you should zoom in quite a lot. 
Otherwise the bits of sequence ends with ... on each line. 

MENU:
Quit, destroys this window.

Help, displays this help page.

Print Screen / Print whole Map
	Prepares a Post Script file pmapxxx.PS in ./PS
	You can then print it on your local laser printer.

Preserve, insure that the next gmap will be displayed
	in a different window, otherwise the present one 
	will be reused.

Clear DNA,
	Uncolors the DNA 

Hide Header
        Hides the buttons etc, useful before printing. The poo up
        menu remains available to toggle back.

Color exons
        Shows the exons on the DNA sequence if present.

Export translation
       Export the translation of the active gene as an Ascii file
       in Fasta format

Export translations
       Export the translation of all teh genes of the active map
       in a singel file in Fasta format

Export Sequence
       Export the active DNA zone in fasta format.

Statistics
       Prints on the console some statistics on genes, exons etc.

Analysis window, opens a new window called dna-analysis
	with its own help entry (the next page).


TOP LINE The last sequence you touched is the Selected fMap, this
shows in red in the top left corner. This is the sequence used by dna
analysis and gels. You can have several sequence on the screen if you
use the Preserve option in the menu.

ZOOMING
The Zooming works as in the genetic map. It is controlled by
the 3 buttons, whole(when you are lost!), zoom in, zoom out, and
the mid mouse button: to recentre slowly if the mouse is rigth of
the scale bar, or recenter fast and zoom continuously by dragging the
mid button starting left of the scale bar.


ACTIVE-ZONE and ORIGIN
You can reset the origin by picking the origin value box, typing a
number and RETURN. Alternatively, pick the Origin button then a
gene.
The active zone, indicated in the same coordinate system limits
the scope of the Anaylsis window, Genefinder, Fasta Dumps etc. 
It then shows as blue Shutter lon the left side of the yellow bar.

CLEAR
Clears the colourings, genefinder selections etc.

REVERSE-COMPLEMENT
Pick it with the left button to reverse complement the sequence.
But if you press the right mouse button, you get a sub-menu that
lets you independently complement or reverse the sequence. This may
be useful to compare the features of both strands. On the top right
corner of the window, the staus REVERSED or COMPLEMENT is recalled.


Introns-exons are shown as rectangular boxes (the exons) connected
by springs, the introns. The one on the right go downwards, the one
on the left of the scale go upwards, i.e. they belong to the other
strand. They correspond to the negative reading frames of the
analysis menu.
Picking the subsequences move you to their text value.
Picking the clone box which may occur at the top will move you to
the physical map.
In the case of cDna you will get a text hybridize to Yacs...,
picking one of these yacs will put you on the physical map.

###################################################################

**DNA_analysis
       Click page down for the genetic code.

This window is a command tool. It acts:
  either on the active sequence window 
  or, if you press the "Search active Keyset" button, on all the
sequences listed in the currently active keyset. That button is a
toggle and turns RED when activated.

Searches on the dna result in coloration of the sequence, which shows
on the bases and amino acids, if shown, and on the yellow strip.

Quit, destroys this window.

Help, displays this help page.

Print, prepares a Post Script file xxx.PS in ./PS
	You can then print it on your local laser printer.

Finger print:
	 Restricts with the enzymes used for the C.e. physical map
         hindIII and  sau3aI. You get prompted for the name of a
         file where the result of the search may be exported.
         The sites are shown in 2 colors in the feature window.

Restriction Key_Set
         Will import a list of restriction enzymes that can then be
         searched for in the active sequence or KeySet of sequences.

Restrict Site Text-editor: 
	Searches for AA motifs or Bases restriction sites.
	You can give the sequence you search for or
	the name of a set of known restriction enzymes,
	(list the class Restrict to see them).
	The sites are shown in the sequnce window, and recorded
	at the end of the Dnacpt window. 
	The use of ambiguous letters such as R is allowed
	To activate the search type return..
               Try also the Show Gel Button.

Dump Sequence:
       If UseKeySet is set, dumps in fasta format all sequences of
       the active keyset (or selection list).
       Else, dumps in fasta format the active region of the active
       sequence window, e.g. you can fasta dumps bases 3800 to 7000 of a 
       given sequence.
	
poly R/ poly Y:
	 looks for 12 or more contiguous AG or TC segments, and prints
	out the result of the search. This is equivalent
	to search for a restriction of 12 R or 12 Y (r is a-g, y: t-c), but
	the print out is more precise.  

Splice Concensus:
	Gives the 5' and 3' splice concensus sequences around the
	introns exons  boundaries in the sequences of the active
        keyset. The result is shown in the Dnacpt window itself.
        Resize the window to see it.

Codon Usage:
	Gives the codon usage in the sequences of the active
        keyset. The result is shown in a new window. Note that the 
        genetic code is recalled in the next page of this help.

Lengths:
	Gives the histogram of the lengths of the individual
	sequences in the active KeySet.

Show Gel:
	Pops a Gel Tool with its own help page.
	
Clear:
	Clears the Dnacpt window, useful before using Splice
        concensus or restrict buttons.
   
###################################################################

**DNA_and_amino_acids_nomenclature

          		             DNA
G	Guanine
A	Adenine 
T	Thymine
C	Cytosine
R	Purine                  A,G
Y	Pyramidine              T,C
M	Amino                   A,C
K	Ketone                  G,T
S	Strong interaction      C,G
W	Weak interaction        A,T
H	not-G                   A,C,T
B	not-A                   G,C,T
V	not-T                   A,C,G
D	not-C                   A,G,T
N	any                     G,A,T,C



                                    AMINO ACIDS

          Here is a list of the standard one-letter amino acid codes and their
     three-letter  equivalents.   The synonymous codons and their depiction in
     the IUB codes are shown.  You should recognize that the codons  following
     semicolons  (;)  are  not  sufficiently specific to define a single amino
     acid even though they represent the best possible back  translation  into
     the IUB codes!  All of the relationships in this list can be redefined by
     the user in a local data file described below.

         Symbol 3-letter  Meaning      Codons                Depiction

           A    Ala       Alanine      GCT,GCC,GCA,GCG         !GCN
           B    Asp,Asn   Aspartic,
                          Asparagine   GAT,GAC,AAT,AAC         !RAY
           C    Cys       Cysteine     TGT,TGC                 !TGY
           D    Asp       Aspartic     GAT,GAC                 !GAY
           E    Glu       Glutamic     GAA,GAG                 !GAR
           F    Phe     Phenylalanine  TTT,TTC                 !TTY
           G    Gly       Glycine      GGT,GGC,GGA,GGG         !GGN
           H    His       Histidine    CAT,CAC                 !CAY
           I    Ile       Isoleucine   ATT,ATC,ATA             !ATH
           K    Lys       Lysine       AAA,AAG                 !AAR
           L    Leu       Leucine      TTG,TTA,CTT,CTC,CTA,CTG !TTR,CTN,YTR;YTN
           M    Met       Methionine   ATG                     !ATG
           N    Asn       Asparagine   AAT,AAC                 !AAY
           P    Pro       Proline      CCT,CCC,CCA,CCG         !CCX
           Q    Gln       Glutamine    CAA,CAG                 !CAR
	   R    Arg       Arginine     CGT,CGC,CGA,CGG,AGA,AGG !CGX,AGR,MGR;MGN
           S    Ser       Serine       TCT,TCC,TCA,TCG,AGT,AGC !TCX,AGY;WSN
           T    Thr       Threonine    ACT,ACC,ACA,ACG         !ACN
           V    Val       Valine       GTT,GTC,GTA,GTG         !GTN
           W    Trp       Tryptophan   TGG                     !TGG
           X    Xxx       Unknown                              !NNN
           Y    Tyr       Tyrosine     TAT, TAC                !TAY
           Z    Glu,Gln   Glutamic,
                          Glutamine    GAA,GAG,CAA,CAG         !SAR
           *    End       Terminator   TAA, TAG, TGA           !TAR,TRA;TRR


###################################################################

**Useful_sequences

Trans splices leaders:
	 SL1 = "ggtttaattacccaagtttgag" ;
         SL2 = "ggttttaacccagttactcaag" ;


###################################################################

**Codon_usage

This windows gives the codon usage for the sequences of the active KeySet


###################################################################

**Agarose-Gels

This display is intended to help you interpret a restriction gel 
that you could run on a mutant by showing the expected wild type
gel. You can type in the entry boxes the name of one or several
restriction enzymes separated the semi columns, or little sequences.
Ambiguous bases like n, w, s etc are reconised (see help on
DNA_nomenclature). The lane will correspond to the active DNA
window. If you click a band, you light the corresponding part of the
sequence and the overlapping bands in the other lanes of the same
gel.
 The distance is a log funtion of the lenght of the dna-segment
as given in:
		figure 6.1 page 6.5 ; Molecular cloning, a laboratory manual
		second ed. Sambrook, Fritsch, Maniatis
		ColdSping Harbor lab. press, 1989

      distance  = 3.5 * ( 4 - log10(length) ) ; 

The MENU has the 3 standard entries:
Quit, destroys this window.

Help, displays this help page.

Print, prepares a Post Script file xxx.PS in ./PS
	You can then print it on your local laser printer.

ZOOMING
The Zooming works as in the genetic map. It is controlled by
the 3 buttons, whole(when you are lost!), zoom in, zoom out, and
the mid mouse button: to recentre slowly if the mouse is rigth of
the scale bar, or recenter fast and zoom continuously by dragging the
mid button starting left of the scale bar.

OTHER BUTTONS
The coordinate button is a toggle that prints its length directly
above each band, in base pairs.

We hope to introduce soon other commands to add or remove a site
at a given place

PICKING A BAND
If you click once on a band, its exact length is shown in the left
top yellow 'Position' box.

If you click again, you will color the corresponding band on the
sequence display. If the sequence is no longer the one used to
produce the gel band, the program is suppose to realise it, but
we have not tested all possible cases.
At the same time, you will color the matching bands in the other
lanes. To restore the normal colors, select the same digestion box
and type Enter.

MORE ON DIGESTIONS
To perform a digestion, select a sequence window, select the origin
and length of the bit of sequence you wish to digest. Then pick
one of the text boxes top right in the Gel display. It turns yellow.
Type in your restriction enzymes separated by semi columns (names or
little sequences). Then type return. A typo will display the help
page on the genetic code.

As many lanes as you wish can be displayed. The window resizes
properly. Different lanes may correspond to different sequences, but
then we are not to sure that the recoloring trick is bug free. So
you may have to clear the display from time to time.

###################################################################

**Clone-Grid

This display is designed to display hybridisation data from the YAC
polytene filters (and other gridded filters), and provide a tool for
people to go between such data and the map, even when they don't
have write access to the database.

You see a set of squares layed out in the same pattern as the clones
on the filter.  To help orient you, the rectangle at left containing
"LABEL" corresponds to where the numerical label is written on the
filter.

The current active box (after you have clicked once in a box) has a
cross in it and is outlined in red.  The name of the corresponding
YAC is shown in the "Gridded Clone" text entry box at the top.  If
you click on this to make it yellow, and type in the name of a YAC
on the grid, that will be indicated with a cross/outlined in red.
You can also click on the "Gridded Clone" button, in which case you
can pick on YAC's elsewhere, such as in a physical map window.  This
is useful for finding where neighbouring YAC's on the map are on the
grid.

There are two modes: Edit Mode and Map Mode.  The mode with the
coloured box is current.  You can switch by picking the other box.

Map Mode: when you click twice on a box you go to the physical map.
If it is an empty box, then you will go to the corresponding YAC.  If
it is filled then it, and all the other filled boxes representing
YACs that overlap, are highlighted in red, and you go to the average
position on the map that they define.  i.e. if a number of boxes are
filled (positive) then map mode splits them into groups, each of
which corresponds to one potential map locus.

The grouping is done by taking all YAC's within some range into a
cluster.  This range is 20 by default.  It can be changed with the
menu entry "Set Cluster Range".

Edit mode: this lets you define a pattern.  Click with the left
mouse.  One click in a box gives a dark blue fill, a second makes it
pale blue (signifying a weak signal), and a third will clear it.

Probes: we now recognize two sorts of probes: simple clones, and
pools.  Pools can contain collections of clone probes and subpools.
The hybridisation pattern for a pool is the union of the patterns
for all its clones and subpools, together with any data attached
specifically to itself.  You can type the name of a probe into the
text entry box (after activating it to yellow by clicking on it), or
you can press the Probe button and pick your probe from another
window (e.g. a phytsical map window).

The Clear button clears any current pattern, deletes a clone name if
ones is present, puts you in edit mode, and prepares the "Pattern for
clone" entry box for you to type in a clone name.  This does not
affect any pattern stored as a "surround" for comparison (see below).

The arrow keys also work to let you move the active box (outlined in
red) around the grid.  Hitting the return key corresponds to clicking
on the current active box.

Menu items are:

Quit, Help, Print: as normal.

Preserve: as in the phsyical map display.  If you select POLY1 again
after choosing this option then you get a new window, rather than
reusing this one.

Center<->Surround: this places the current pattern in a surround to
each highlighted box.  You can then load a new pattern and compare
it to the one stored in the surround.  The clear function only
affects the central pattern, not the surround, so to clear the
surround select Center<->Surround then Clear.

Names: shows YAC names at all locations, rather than square boxes.
To see the ones at the right you will have to stretch the box very
wide (sorry no scrolling yet).  If you print when stretched out you
get an index sheet for the filter like the one sent out with it.

Display probe as tree: shows the current probe in a separate window
in tree (plain text) form.

Save data with probe: only valid if you have write access and are
entering hybridisation data for probes.  This lets you save the
current pattern with the probe whose name is in the Probe text entry
box.  Data that is set as weak (light blue) will be saved with
"Weak" following the YAC name.  When reading in data, if any text is
found following the clone name the box will be displayed in light
blue, so you could edit this text in a tree update window to be more
informative if you wanted.

Set cluster range: This value is used to cluster individual
hybridizing YAC's into groups that are supposed to correspond to
individual loci.  The current algorithm essentially tries to find
loci such that the centres of all the positive YAC's are within the
defined range.  This is not strictly correct.  The units are
physical map bands.  Larger values allow more spread out clusters.

Stats on KeySet: Applies to current keyset, which should contain
probes with hybridisation data.  It returns stats on how many
clusters of various sorts there are, as a line on the terminal.

Change Gridded Clone: doesn't do anything yet.

###################################################################

**Read_files

Quit, destroys this window.

Open File : allows you to choose any file with ending .ace

Read until CTRL/C in home window:
	Reads the whole file or until you type ^C in the window
	from where you started ACEDB. Under Sunview, ^C does not
	always work. Why ?

Read one item:
	READS the next object, i.e. until the next empty line.

Read one line:
	Reads just a single line, usually the value of a tag

Skip to next item: skips.


Double click a file to parse it or use the keyboard
      to edit the name of the directory.
      You get those files of the directory ending with .ace
      or the content of acemenu.wrm if such a file exists
      in that directory (useful for automatic redirection
      to subdirectories).

###################################################################

**Make_maps

The idea is to establish a correspondance between the
       genetic map and the physical map. This is used later
       to jump between maps by continuous interpolation
       between the cloned genes. This function should
       be run whenever the genetic map, the clone map
       or the amount of known sequences have changed
       appreciably.

Quit, destroys this window.

Help, displays this help page.

Print, prepares a Post Script file pmapxxx.PS in ./PS
       You can then print it on your local laser printer.

Make pMaps recalculates the display of all the contigs
	for future fast access. 

Make gMaps recalculates the display of all the chromosomes
	for future fast access. 

Align contigs : tries to align the contigs on the
	chromosomes and report inconsistencies.

Bump contigs : bumps them for a nicer, not necessarilly more
	accurate, display.

####################################################################

**Physical_map_calculation

This program tries to analyse the clone map, also called physical map
It is quite primitive and not linked in distribution 1.4

Quit:	Destroys this window.

Help:	Displays this help page.

Print:	Prepares a Post Script file defdata.PS in ./PS
        You can then print it on your local laser printer.

Make pMaps should be used to recalculate the contigs after
        updating the clones

Align maps is itself a subprogram

The other buttons as a whole make a program and should be used
       in sequence.

##################################################################

**Deficiency_map

This program tries to compute a genetic map using deficiency data.

Quit: 
	Destroys this window.

Help:
	Displays this help page.

Print:
	Prepares a Post Script file defdata.PS in ./PS
	You can then print it on your local laser printer.

Parse database:
	Must be run once, when you have changed the 2_point_data
        It looks for deficiency data and reorgaizes them internally
	for later use by this package. In particular, genes and
	def are sorted into contigs defined as a set of genes and
	deficiencies tested against each other.

Read file:
	This allows you to run the same analysis on some data
	that you do not want to parse into your database.
	The data file should consist of ND+1 lines of NM symbols 1 or 0
	where NM is the number of markers and ND the number of 
	deficiencies. A 1 indicates that the deficiency uncovers
	the gene.
	The first line indicates which genes to take into account.
	It should have NM 1 to use everything, any 0 will discard the
	corresponding column. i.e. gene from the analysis.
	One can also impose the order of subgroups and block some
	genes together. An example input file is given in the next
	help page.

Get contig:
	Ask for a contig number. If you give a bad answer, it does not
	matter. The number of contigs is specified when you Parse
	the database. 

Cost:
	Gives the cost of the running order of the marker,
	The cost function is n for a deficiency splitted in
	n+1 discontinuous pieces
        There is also a way to impose the order of some of the
	markers, but I this is
	not yet done in a smooth way.

Shuffle:
	Reshuffles the markers before a new try.

Monte Carlo;
	Inserts the markers one by one in an expanding list. It tries
	to keep the cost to a minimum and remembers n previous configurations,
	n is a parameter asked from the user. We had fast and good results with
	NM = ND = about 20 and   n = 5
	This is a monte carlo, so you must repeat the search several times.
	Once a good solution is found, it will no longer print the bad ones.
        With NM = ND around 100, n = 8, it was very slow but the
	results were rather good.
	
Intrinsic tree:
	This is an independant fast and innacurate algorithm to
	reorder the genes. It should be completed by the next
	button:

Refine tree:
	This should better the results of the preceding button but
	is not yet available.

Map:
	Creates a new window with a useful graphic presentation of the
	data. It is interesting even on the standard data, before 
	selecting the order option. The Map graph has its own menu
	with the usual options Quit-Help-Print. The Help is the same
	one. Quit quits the application. Print prepares defmapxxx.PS.
	With NM = ND = 100, the resulting graph will not be printed on
	my laser, probably it is a font problem, sorry.

Histo:
	Plots the marginal ditributions :
	Histogram of the number of deficiencies carrying a given
	number of markers and vice versa

####################################################################

**Example_of_a_def_dup_data_file

 Charles Theillet,
 le 18 septembre 1991,
	donnees de genetique humaine analysables par acedb
	
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 
0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 0 0 0 0 
0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 1 1 1 1 0 1 1 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 0 1 0 0 
0 0 0 0 1 0 0 0 1 1 0 0 1 1 1 1 1 1 1 1 1 1 0 0 
0 0 0 0 0 0 1 1 0 0 1 1 1 1 1 1 1 0 0 1 0 0 1 0 
0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 
0 0 0 0 0 0 0 1 0 0 1 1 1 1 1 1 1 0 0 1 1 1 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 
0 0 0 0 0 1 0 0 1 1 1 0 1 1 1 1 1 1 1 1 1 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 
0 0 0 0 0 1 1 0 0 0 1 1 1 1 1 1 1 1 1 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 
0 0 0 0 0 0 0 0 1 1 0 0 1 1 1 1 1 1 1 0 1 0 0 0 
0 0 0 0 1 0 1 0 1 0 0 1 1 1 1 1 1 1 1 1 1 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 
0 0 0 1 0 0 0 1 1 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 
0 0 0 0 0 1 0 1 1 1 0 1 1 1 1 1 1 1 1 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 0 0 0 0 0 
0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 0 0 0 1 0 

BLOCKS       these blocks are ordered left to right in the present code
 0,2  12,18

ORDER
 0,2,3,11  3,11,12,18  12,18,19,23 


####################################################################

**WCS

    WCS is the Worm Community System of Schatz et al. (Arizona)
	Mail schatz@cs.arizona.edu to get further info on WCS.
	To access WCS from ACEDB, you must run under X-windows,
	and start both ACEDB and WCS.
	Whenever the 2 programs run on the same X server (i.e. your 
	terminal), even if from different clients (for example acedb
	running in Cambridge and WCS in Arizona, your terminal 
	being in New York) the main ACEDB menu changes and you get
	3 more entries as follows.
	

WCS Annotate : Sends an annotation to WCS.
WCS Show     : Asks WCS for an eventual annotation.
WCS Search   : Use an object name as a search string in WCS

####################################################################

**Official_Update

The one functional button is "Next Update", which adds the next
official update if it is in $ACEDB_DATA, or if that is not defined,
in $ACEDB/rawdata.

A record of what is going on will appear in the window.  If the
system runs out of space in its disk file it will ask you for more.
You can add several updates in a row if you have them.  If there are
any problems then you will be thrown out of the whole program, with
an error message.

You must have write access, i.e. your login name must be listed in
the file $ACEDB/wspec/passwd.wrm to run this function.

####################################################################

**Long-Text

A simple tool to store and display texts longer than a few lines

###################################################################

**Session_control

Not yet publicly released.

####################################################################
###################################################################