1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952
|
// =============================================================== //
// //
// File : adGene.cxx //
// Purpose : Basic gene access functions //
// //
// Coded by Ralf Westram (coder@reallysoft.de) in July 2002 //
// Institute of Microbiology (Technical University Munich) //
// http://www.arb-home.de/ //
// //
// =============================================================== //
#include "gb_local.h"
#include <adGene.h>
#include <arbdbt.h>
#include <arb_strbuf.h>
#include <arb_strarray.h>
bool GEN_is_genome_db(GBDATA *gb_main, int default_value) {
// default_value == 0 -> default to normal database
// == 1 -> default to GENOM database
// == -1 -> assume that type is already defined
GBDATA *gb_genom_db = GB_entry(gb_main, GENOM_DB_TYPE);
if (!gb_genom_db) { // no DB-type entry -> create one with default
GB_ERROR error = NULL;
assert_or_exit(default_value != -1); // first call to GEN_is_genome_db has to provide a 'default_value'
gb_genom_db = GB_create(gb_main, GENOM_DB_TYPE, GB_INT);
if (!gb_genom_db) error = GB_await_error();
else error = GB_write_int(gb_genom_db, default_value);
if (error) GBK_terminatef("Fatal in GEN_is_genome_db: %s", error);
}
return GB_read_int(gb_genom_db) != 0;
}
// --------------
// genes:
GBDATA* GEN_findOrCreate_gene_data(GBDATA *gb_species) {
GBDATA *gb_gene_data = GB_search(gb_species, "gene_data", GB_CREATE_CONTAINER);
gb_assert(gb_gene_data);
return gb_gene_data;
}
GBDATA* GEN_find_gene_data(GBDATA *gb_species) {
return GB_search(gb_species, "gene_data", GB_FIND);
}
GBDATA* GEN_expect_gene_data(GBDATA *gb_species) {
GBDATA *gb_gene_data = GB_search(gb_species, "gene_data", GB_FIND);
gb_assert(gb_gene_data);
return gb_gene_data;
}
GBDATA* GEN_find_gene_rel_gene_data(GBDATA *gb_gene_data, const char *name) {
GBDATA *gb_name = GB_find_string(gb_gene_data, "name", name, GB_IGNORE_CASE, SEARCH_GRANDCHILD);
if (gb_name) return GB_get_father(gb_name); // found existing gene
return 0;
}
GBDATA* GEN_find_gene(GBDATA *gb_species, const char *name) {
// find existing gene. returns 0 if it does not exist.
GBDATA *gb_gene_data = GEN_find_gene_data(gb_species);
return gb_gene_data ? GEN_find_gene_rel_gene_data(gb_gene_data, name) : 0;
}
static GBDATA* GEN_create_nonexisting_gene_rel_gene_data(GBDATA *gb_gene_data, const char *name) {
GB_ERROR error = GB_push_transaction(gb_gene_data);
GBDATA *gb_gene = 0;
gb_assert(!GEN_find_gene_rel_gene_data(gb_gene_data, name)); // don't call this function if you are not sure that the gene does not exists!
if (!error) {
gb_gene = GB_create_container(gb_gene_data, "gene");
error = gb_gene ? GBT_write_string(gb_gene, "name", name) : GB_await_error();
}
gb_assert(gb_gene || error);
error = GB_end_transaction(gb_gene_data, error);
if (error) GB_export_error(error);
return gb_gene;
}
GBDATA* GEN_create_nonexisting_gene(GBDATA *gb_species, const char *name) { // needed by ../PERL_SCRIPTS/GENOME/GI.pm@create_nonexisting_gene
return GEN_create_nonexisting_gene_rel_gene_data(GEN_findOrCreate_gene_data(gb_species), name);
}
GBDATA* GEN_find_or_create_gene_rel_gene_data(GBDATA *gb_gene_data, const char *name) {
GBDATA *gb_gene = 0;
// Search for a gene, when gene does not exist create it
if (!name || !name[0]) {
GB_export_error("Missing gene name");
}
else {
GBDATA *gb_name = GB_find_string(gb_gene_data, "name", name, GB_IGNORE_CASE, SEARCH_GRANDCHILD);
if (gb_name) {
gb_gene = GB_get_father(gb_name); // found existing gene
}
else {
GB_ERROR error = GB_push_transaction(gb_gene_data);
if (!error) {
gb_gene = GB_create_container(gb_gene_data, "gene");
error = GBT_write_string(gb_gene, "name", name);
}
error = GB_end_transaction(gb_gene_data, error);
if (error) {
gb_gene = NULL;
GB_export_error(error);
}
}
}
return gb_gene;
}
GBDATA* GEN_first_gene(GBDATA *gb_species) {
return GB_entry(GEN_expect_gene_data(gb_species), "gene");
}
GBDATA* GEN_first_gene_rel_gene_data(GBDATA *gb_gene_data) {
return GB_entry(gb_gene_data, "gene");
}
GBDATA* GEN_next_gene(GBDATA *gb_gene) {
gb_assert(GB_has_key(gb_gene, "gene"));
return GB_nextEntry(gb_gene);
}
GBDATA *GEN_first_marked_gene(GBDATA *gb_species) {
return GB_first_marked(GEN_expect_gene_data(gb_species), "gene");
}
GBDATA *GEN_next_marked_gene(GBDATA *gb_gene) {
return GB_next_marked(gb_gene, "gene");
}
// ----------------------
// gene position
static GEN_position *lastFreedPosition = 0;
GEN_position *GEN_new_position(int parts, bool joinable) {
GEN_position *pos;
size_t pos_size = parts*sizeof(pos->start_pos[0]);
size_t comp_size = parts*sizeof(pos->complement[0]);
size_t data_size = 2*pos_size+3*comp_size;
gb_assert(parts>0);
if (lastFreedPosition && lastFreedPosition->parts == parts) {
pos = lastFreedPosition;
lastFreedPosition = 0;
memset(pos->start_pos, 0, data_size);
}
else {
pos = (GEN_position*)GB_calloc(1, sizeof(*pos));
pos->parts = parts;
pos->start_pos = (size_t*)GB_calloc(1, data_size);
pos->stop_pos = pos->start_pos+parts;
pos->complement = (unsigned char*)(pos->stop_pos+parts);
}
pos->joinable = joinable;
pos->start_uncertain = 0;
pos->stop_uncertain = 0;
return pos;
}
void GEN_use_uncertainties(GEN_position *pos) {
if (pos->start_uncertain == 0) {
// space was already allocated in GEN_new_position
pos->start_uncertain = pos->complement+pos->parts;
pos->stop_uncertain = pos->start_uncertain+pos->parts;
size_t comp_size = pos->parts*sizeof(pos->complement[0]);
memset(pos->start_uncertain, '=', 2*comp_size);
}
}
void GEN_free_position(GEN_position *pos) {
if (pos) {
if (lastFreedPosition) {
free(lastFreedPosition->start_pos); // rest is allocated together with start_pos
free(lastFreedPosition);
}
lastFreedPosition = pos;
}
}
static struct GEN_position_mem_handler {
~GEN_position_mem_handler() { GEN_free_position(NULL); }
} GEN_position_dealloc;
static GB_ERROR parseCSV(GBDATA *gb_gene, const char *field_name, size_t parts_expected, ConstStrArray& parseTable) {
// reads a field and splits the content at ','
// results are stored in parseTable
GB_ERROR error = 0;
GBDATA *gb_field = GB_entry(gb_gene, field_name);
if (!gb_field) error = GBS_global_string("Expected entry '%s' missing", field_name);
else {
char *content = GB_read_string(gb_field);
if (!content) error = GB_await_error();
else {
parseTable.erase();
GBT_splitNdestroy_string(parseTable, content, ',');
if (parseTable.size() != parts_expected) {
error = GBS_global_string("Expected %zu CSV, found %zu", parts_expected, parseTable.size());
}
}
}
return error;
}
static GB_ERROR parsePositions(GBDATA *gb_gene, const char *field_name, int parts_expected, size_t *results, ConstStrArray& parseTable) {
GB_ERROR error = parseCSV(gb_gene, field_name, parts_expected, parseTable);
if (!error) {
int p;
for (p = 0; p<parts_expected && !error; p++) {
char *end;
results[p] = strtol(parseTable[p], &end, 10);
if (end == parseTable[p]) { // error
error = GBS_global_string("can't convert '%s' to number", parseTable[p]);
}
}
}
if (error) {
error = GBS_global_string("While parsing field '%s': %s", field_name, error);
}
return error;
}
GEN_position *GEN_read_position(GBDATA *gb_gene) {
int parts = 1;
bool joinable = false;
GBDATA *gb_pos_joined = GB_entry(gb_gene, "pos_joined");
GEN_position *pos = 0;
GB_ERROR error = 0;
if (gb_pos_joined) {
parts = GB_read_int(gb_pos_joined);
if (parts != 1) { // split
if (parts>1) joinable = true;
else if (parts<-1) parts = -parts; // neg value means "not joinable" (comes from feature location 'order(...)')
else error = GBS_global_string("Illegal value %i in 'pos_joined'", parts);
}
}
if (!error) {
pos = GEN_new_position(parts, joinable);
ConstStrArray parseTable;
parseTable.reserve(parts);
error = parsePositions(gb_gene, "pos_start", parts, pos->start_pos, parseTable);
if (!error) error = parsePositions(gb_gene, "pos_stop", parts, pos->stop_pos, parseTable);
int p;
if (!error) {
error = parseCSV(gb_gene, "pos_complement", parts, parseTable);
for (p = 0; p<parts && !error; p++) {
const char *val = parseTable[p];
if ((val[0] != '0' && val[0] != '1') || val[1] != 0) {
error = GBS_global_string("Invalid content '%s' in 'pos_complement' (expected: \"01\")", val);
}
else {
pos->complement[p] = (unsigned char)atoi(val);
}
}
}
if (!error) {
GBDATA *gb_pos_certain = GB_entry(gb_gene, "pos_certain");
if (gb_pos_certain) {
error = parseCSV(gb_gene, "pos_certain", parts, parseTable);
GEN_use_uncertainties(pos);
for (p = 0; p<parts && !error; p++) {
const unsigned char *val = (unsigned char *)(parseTable[p]);
int vp;
for (vp = 0; vp<2; vp++) {
unsigned char c = val[vp];
if (c != '<' && c != '=' && c != '>' && (c != "+-"[vp])) {
error = GBS_global_string("Invalid content '%s' in 'pos_certain' (expected 2 from \"<=>\")", val);
}
}
if (!error) {
pos->start_uncertain[p] = val[0];
pos->stop_uncertain[p] = val[1];
}
}
}
}
}
gb_assert(error || pos);
if (error) {
GB_export_error(error);
if (pos) {
GEN_free_position(pos);
pos = 0;
}
}
return pos;
}
GB_ERROR GEN_write_position(GBDATA *gb_gene, const GEN_position *pos, long seqLength) {
// if 'seqLength' is != 0, it is used to check the correctness of 'pos'
// (otherwise this function reads the genome-sequence to detect its length)
GB_ERROR error = 0;
GBDATA *gb_pos_joined = GB_entry(gb_gene, "pos_joined");
GBDATA *gb_pos_certain = GB_entry(gb_gene, "pos_certain");
GBDATA *gb_pos_start;
GBDATA *gb_pos_stop;
GBDATA *gb_pos_complement;
int p;
gb_assert(pos);
gb_pos_start = GB_search(gb_gene, "pos_start", GB_STRING);
if (!gb_pos_start) error = GB_await_error();
if (!error) {
gb_pos_stop = GB_search(gb_gene, "pos_stop", GB_STRING);
if (!gb_pos_stop) error = GB_await_error();
}
if (!error) {
gb_pos_complement = GB_search(gb_gene, "pos_complement", GB_STRING);
if (!gb_pos_complement) error = GB_await_error();
}
if (!error) {
if (pos->start_uncertain) {
if (!gb_pos_certain) {
gb_pos_certain = GB_search(gb_gene, "pos_certain", GB_STRING);
if (!gb_pos_certain) error = GB_await_error();
}
}
else {
if (gb_pos_certain) {
error = GB_delete(gb_pos_certain);
gb_pos_certain = 0;
}
}
}
// test data
if (!error) {
size_t length;
if (seqLength) {
length = seqLength;
}
else { // unknown -> autodetect
GBDATA *gb_organism = GB_get_grandfather(gb_gene);
GBDATA *gb_genome = GBT_read_sequence(gb_organism, GENOM_ALIGNMENT);
length = GB_read_count(gb_genome);
}
for (p = 0; p<pos->parts && !error; ++p) {
char c;
c = pos->complement[p]; gb_assert(c == 0 || c == 1);
if (c<0 || c>1) {
error = GBS_global_string("Illegal value %i in complement", int(c));
}
else {
if (pos->start_pos[p]>pos->stop_pos[p]) {
error = GBS_global_string("Illegal positions (%zu>%zu)", pos->start_pos[p], pos->stop_pos[p]);
}
else if (pos->start_pos[p] == 0) {
error = GBS_global_string("Illegal start position %zu", pos->start_pos[p]);
}
else if (pos->stop_pos[p] > length) {
error = GBS_global_string("Illegal stop position %zu (>length(=%zu))", pos->stop_pos[p], length);
}
else {
if (pos->start_uncertain) {
c = pos->start_uncertain[p];
char c2 = pos->stop_uncertain[p];
if (!c || strchr("<=>+", c) == 0) error = GBS_global_string("Invalid uncertainty '%c'", c);
else if (!c2 || strchr("<=>-", c2) == 0) error = GBS_global_string("Invalid uncertainty '%c'", c2);
else {
if (c == '+' || c2 == '-') {
if (c == '+' && c2 == '-') {
if (pos->start_pos[p] != pos->stop_pos[p]-1) {
error = GBS_global_string("Invalid positions %zu^%zu for uncertainties +-", pos->start_pos[p], pos->stop_pos[p]);
}
}
else {
error = "uncertainties '+' and '-' can only be used together";
}
}
}
}
}
}
}
}
if (!error) {
if (pos->parts == 1) {
if (gb_pos_joined) error = GB_delete(gb_pos_joined);
if (!error) error = GB_write_string(gb_pos_start, GBS_global_string("%zu", pos->start_pos[0]));
if (!error) error = GB_write_string(gb_pos_stop, GBS_global_string("%zu", pos->stop_pos[0]));
if (!error) error = GB_write_string(gb_pos_complement, GBS_global_string("%c", pos->complement[0]+'0'));
if (!error && gb_pos_certain) {
error = GB_write_string(gb_pos_certain, GBS_global_string("%c%c", pos->start_uncertain[0], pos->stop_uncertain[0]));
}
}
else {
if (!gb_pos_joined) {
gb_pos_joined = GB_search(gb_gene, "pos_joined", GB_INT);
if (!gb_pos_joined) error = GB_await_error();
}
if (!error) error = GB_write_int(gb_pos_joined, pos->parts * (pos->joinable ? 1 : -1)); // neg. parts means not joinable
if (!error) {
GBS_strstruct *start = GBS_stropen(12*pos->parts);
GBS_strstruct *stop = GBS_stropen(12*pos->parts);
GBS_strstruct *complement = GBS_stropen(2*pos->parts);
GBS_strstruct *uncertain = GBS_stropen(3*pos->parts);
for (p = 0; p<pos->parts; ++p) {
if (p>0) {
GBS_chrcat(start, ',');
GBS_chrcat(stop, ',');
GBS_chrcat(complement, ',');
GBS_chrcat(uncertain, ',');
}
GBS_strcat(start, GBS_global_string("%zu", pos->start_pos[p]));
GBS_strcat(stop, GBS_global_string("%zu", pos->stop_pos[p]));
GBS_chrcat(complement, pos->complement[p]+'0');
if (gb_pos_certain) {
GBS_chrcat(uncertain, pos->start_uncertain[p]);
GBS_chrcat(uncertain, pos->stop_uncertain[p]);
}
}
char *sstart = GBS_strclose(start);
char *sstop = GBS_strclose(stop);
char *scomplement = GBS_strclose(complement);
char *suncertain = GBS_strclose(uncertain);
error = GB_write_string(gb_pos_start, sstart);
if (!error) error = GB_write_string(gb_pos_stop, sstop);
if (!error) error = GB_write_string(gb_pos_complement, scomplement);
if (!error && gb_pos_certain) error = GB_write_string(gb_pos_certain, suncertain);
free(suncertain);
free(scomplement);
free(sstop);
free(sstart);
}
}
}
return error;
}
static GEN_position *location2sort = 0;
static int cmp_location_parts(const void *v1, const void *v2) {
int i1 = *(int*)v1;
int i2 = *(int*)v2;
int cmp = location2sort->start_pos[i1]-location2sort->start_pos[i2];
if (!cmp) {
cmp = location2sort->stop_pos[i1]-location2sort->stop_pos[i2];
}
return cmp;
}
void GEN_sortAndMergeLocationParts(GEN_position *location) {
// Note: makes location partly invalid (only start_pos + stop_pos are valid afterwards)
int parts = location->parts;
int *idx = (int*)malloc(parts*sizeof(*idx)); // idx[newpos] = oldpos
int i, p;
for (p = 0; p<parts; ++p) idx[p] = p;
location2sort = location;
qsort(idx, parts, sizeof(*idx), cmp_location_parts);
location2sort = 0;
for (p = 0; p<parts; ++p) {
i = idx[p];
#define swap(a, b, type) do { type tmp = (a); (a) = (b); (b) = (tmp); } while (0)
if (i != p) {
swap(location->start_pos[i], location->start_pos[p], size_t);
swap(location->stop_pos[i], location->stop_pos[p], size_t);
swap(idx[i], idx[p], int);
}
}
#if defined(DEBUG) && 0
printf("Locations sorted:\n");
for (p = 0; p<parts; ++p) {
printf(" [%i] %i - %i %i\n", p, location->start_pos[p], location->stop_pos[p], (int)(location->complement[p]));
}
#endif // DEBUG
i = 0;
for (p = 1; p<parts; p++) {
if ((location->stop_pos[i]+1) >= location->start_pos[p]) {
// parts overlap or are directly consecutive
location->stop_pos[i] = location->stop_pos[p];
}
else {
i++;
location->start_pos[i] = location->start_pos[p];
location->stop_pos[i] = location->stop_pos[p];
}
}
location->parts = i+1;
#if defined(DEBUG) && 0
parts = location->parts;
printf("Locations merged:\n");
for (p = 0; p<parts; ++p) {
printf(" [%i] %i - %i %i\n", p, location->start_pos[p], location->stop_pos[p], (int)(location->complement[p]));
}
#endif // DEBUG
free(idx);
}
// -----------------------------------------
// test if species is pseudo-species
const char *GEN_origin_organism(GBDATA *gb_pseudo) {
GBDATA *gb_origin = GB_entry(gb_pseudo, "ARB_origin_species");
return gb_origin ? GB_read_char_pntr(gb_origin) : 0;
}
const char *GEN_origin_gene(GBDATA *gb_pseudo) {
GBDATA *gb_origin = GB_entry(gb_pseudo, "ARB_origin_gene");
return gb_origin ? GB_read_char_pntr(gb_origin) : 0;
}
bool GEN_is_pseudo_gene_species(GBDATA *gb_species) {
return GEN_origin_organism(gb_species) != 0;
}
// ------------------------------------------------
// find organism or gene for pseudo-species
GB_ERROR GEN_organism_not_found(GBDATA *gb_pseudo) {
gb_assert(GEN_is_pseudo_gene_species(gb_pseudo));
gb_assert(GEN_find_origin_organism(gb_pseudo, 0) == 0);
return GB_export_errorf("The gene-species '%s' refers to an unknown organism (%s)\n"
"This occurs if you rename or delete the organism or change the entry\n"
"'ARB_origin_species' and will most likely cause serious problems.",
GBT_read_name(gb_pseudo),
GEN_origin_organism(gb_pseudo));
}
// @@@ FIXME: missing: GEN_gene_not_found (like GEN_organism_not_found)
// ------------------------------
// search pseudo species
static const char *pseudo_species_hash_key(const char *organism_name, const char *gene_name) {
return GBS_global_string("%s*%s", organism_name, gene_name);
}
static GBDATA *GEN_read_pseudo_species_from_hash(const GB_HASH *pseudo_hash, const char *organism_name, const char *gene_name) {
return (GBDATA*)GBS_read_hash(pseudo_hash, pseudo_species_hash_key(organism_name, gene_name));
}
void GEN_add_pseudo_species_to_hash(GBDATA *gb_pseudo, GB_HASH *pseudo_hash) {
const char *organism_name = GEN_origin_organism(gb_pseudo);
const char *gene_name = GEN_origin_gene(gb_pseudo);
gb_assert(organism_name);
gb_assert(gene_name);
GBS_write_hash(pseudo_hash, pseudo_species_hash_key(organism_name, gene_name), (long)gb_pseudo);
}
GB_HASH *GEN_create_pseudo_species_hash(GBDATA *gb_main, int additionalSize) {
GB_HASH *pseudo_hash = GBS_create_hash(GBT_get_species_count(gb_main)+additionalSize, GB_IGNORE_CASE);
GBDATA *gb_pseudo;
for (gb_pseudo = GEN_first_pseudo_species(gb_main);
gb_pseudo;
gb_pseudo = GEN_next_pseudo_species(gb_pseudo))
{
GEN_add_pseudo_species_to_hash(gb_pseudo, pseudo_hash);
}
return pseudo_hash;
}
GBDATA *GEN_find_pseudo_species(GBDATA *gb_main, const char *organism_name, const char *gene_name, const GB_HASH *pseudo_hash) {
// parameter pseudo_hash :
// 0 -> use slow direct search [if you only search one]
// otherwise it shall be a hash generated by GEN_create_pseudo_species_hash() [if you search several times]
// Note : use GEN_add_pseudo_species_to_hash to keep hash up-to-date
GBDATA *gb_pseudo;
if (pseudo_hash) {
gb_pseudo = GEN_read_pseudo_species_from_hash(pseudo_hash, organism_name, gene_name);
}
else {
for (gb_pseudo = GEN_first_pseudo_species(gb_main);
gb_pseudo;
gb_pseudo = GEN_next_pseudo_species(gb_pseudo))
{
const char *origin_gene_name = GEN_origin_gene(gb_pseudo);
if (strcmp(gene_name, origin_gene_name) == 0) {
const char *origin_species_name = GEN_origin_organism(gb_pseudo);
if (strcmp(organism_name, origin_species_name) == 0) {
break; // found pseudo species
}
}
}
}
return gb_pseudo;
}
// -----------------------
// search origins
GBDATA *GEN_find_origin_organism(GBDATA *gb_pseudo, const GB_HASH *organism_hash) {
// parameter organism_hash:
// 0 -> use slow direct search [if you only search one or two]
// otherwise it shall be a hash generated by GBT_create_organism_hash() [if you search several times]
// Note : use GBT_add_item_to_hash() to keep hash up-to-date
const char *origin_species_name;
GBDATA *gb_organism = 0;
gb_assert(GEN_is_pseudo_gene_species(gb_pseudo));
origin_species_name = GEN_origin_organism(gb_pseudo);
if (origin_species_name) {
if (organism_hash) {
gb_organism = (GBDATA*)GBS_read_hash(organism_hash, origin_species_name);
}
else {
gb_organism = GBT_find_species_rel_species_data(GB_get_father(gb_pseudo), origin_species_name);
}
}
return gb_organism;
}
GBDATA *GEN_find_origin_gene(GBDATA *gb_pseudo, const GB_HASH *organism_hash) {
const char *origin_gene_name;
gb_assert(GEN_is_pseudo_gene_species(gb_pseudo));
origin_gene_name = GEN_origin_gene(gb_pseudo);
if (origin_gene_name) {
GBDATA *gb_organism = GEN_find_origin_organism(gb_pseudo, organism_hash);
gb_assert(gb_organism);
return GEN_find_gene(gb_organism, origin_gene_name);
}
return 0;
}
// --------------------------------
// find pseudo-species
GBDATA* GEN_first_pseudo_species(GBDATA *gb_main) {
GBDATA *gb_species = GBT_first_species(gb_main);
if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) return gb_species;
return GEN_next_pseudo_species(gb_species);
}
GBDATA* GEN_next_pseudo_species(GBDATA *gb_species) {
if (gb_species) {
while (1) {
gb_species = GBT_next_species(gb_species);
if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) break;
}
}
return gb_species;
}
static GBDATA* GEN_next_marked_pseudo_species(GBDATA *gb_species) {
if (gb_species) {
while (1) {
gb_species = GBT_next_marked_species(gb_species);
if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) break;
}
}
return gb_species;
}
GBDATA *GEN_first_marked_pseudo_species(GBDATA *gb_main) {
GBDATA *gb_species = GBT_first_marked_species(gb_main);
if (!gb_species || GEN_is_pseudo_gene_species(gb_species)) return gb_species;
return GEN_next_marked_pseudo_species(gb_species);
}
// ------------------
// organisms
bool GEN_is_organism(GBDATA *gb_species) {
gb_assert(GEN_is_genome_db(GB_get_root(gb_species), -1)); // assert this is a genome db
// otherwise it is an error to use GEN_is_organism (or its callers)!!!!
return GB_entry(gb_species, GENOM_ALIGNMENT) != 0;
}
GBDATA *GEN_find_organism(GBDATA *gb_main, const char *name) {
GBDATA *gb_orga = GBT_find_species(gb_main, name);
if (gb_orga) {
if (!GEN_is_organism(gb_orga)) {
fprintf(stderr, "ARBDB-warning: found unspecific species named '%s', but expected an 'organism' with that name\n", name);
gb_orga = 0;
}
}
return gb_orga;
}
GBDATA *GEN_first_organism(GBDATA *gb_main) {
GBDATA *gb_organism = GBT_first_species(gb_main);
if (!gb_organism || GEN_is_organism(gb_organism)) return gb_organism;
return GEN_next_organism(gb_organism);
}
GBDATA *GEN_next_organism(GBDATA *gb_organism) {
if (gb_organism) {
while (1) {
gb_organism = GBT_next_species(gb_organism);
if (!gb_organism || GEN_is_organism(gb_organism)) break;
}
}
return gb_organism;
}
long GEN_get_organism_count(GBDATA *gb_main) {
long count = 0;
GBDATA *gb_organism = GEN_first_organism(gb_main);
while (gb_organism) {
count++;
gb_organism = GEN_next_organism(gb_organism);
}
return count;
}
GBDATA *GEN_first_marked_organism(GBDATA *gb_main) {
GBDATA *gb_organism = GBT_first_marked_species(gb_main);
if (!gb_organism || GEN_is_organism(gb_organism)) return gb_organism;
return GEN_next_marked_organism(gb_organism);
}
GBDATA *GEN_next_marked_organism(GBDATA *gb_organism) {
if (gb_organism) {
while (1) {
gb_organism = GBT_next_marked_species(gb_organism);
if (!gb_organism || GEN_is_organism(gb_organism)) break;
}
}
return gb_organism;
}
char *GEN_global_gene_identifier(GBDATA *gb_gene, GBDATA *gb_organism) {
if (!gb_organism) {
gb_organism = GB_get_grandfather(gb_gene);
gb_assert(gb_organism);
}
return GBS_global_string_copy("%s/%s", GBT_read_name(gb_organism), GBT_read_name(gb_gene));
}
// --------------------------------------------------------------------------------
#ifdef UNIT_TESTS
#include <test_unit.h>
#include <arb_unit_test.h>
#include <arb_defs.h>
static struct arb_unit_test::test_alignment_data TestAlignmentData_Genome[] = {
{ 0, "spec", "AUCUCCUAAACCCAACCGUAGUUCGAAUUGAG" },
};
#define TEST_EXPECT_MEMBER_EQUAL(s1,s2,member) TEST_EXPECT_EQUAL((s1)->member, (s2)->member)
#define TEST_EXPECT_GENPOS_EQUAL(p1,p2) do { \
TEST_EXPECT_MEMBER_EQUAL(p1, p2, parts); \
TEST_EXPECT_MEMBER_EQUAL(p1, p2, joinable); \
for (int p = 0; p<(p1)->parts; ++p) { \
TEST_EXPECT_MEMBER_EQUAL(p1, p2, start_pos[p]); \
TEST_EXPECT_MEMBER_EQUAL(p1, p2, stop_pos[p]); \
TEST_EXPECT_MEMBER_EQUAL(p1, p2, complement[p]); \
if ((p1)->start_uncertain) { \
TEST_EXPECT_MEMBER_EQUAL(p1, p2, start_uncertain[p]); \
TEST_EXPECT_MEMBER_EQUAL(p1, p2, stop_uncertain[p]); \
} \
} \
} while(0)
#define TEST_WRITE_READ_GEN_POSITION(pos) \
do { \
error = GEN_write_position(gb_gene, (pos), 0); \
if (!error) { \
GEN_position *rpos = GEN_read_position(gb_gene); \
if (!rpos) { \
error = GB_await_error(); \
} \
else { \
TEST_EXPECT_GENPOS_EQUAL((pos), rpos); \
GEN_free_position(rpos); \
} \
} \
TEST_EXPECT_NULL(error.deliver()); \
} while(0)
#define TEST_WRITE_GEN_POSITION_ERROR(pos,exp_error) do { \
error = GEN_write_position(gb_gene, &*(pos), 0); \
TEST_EXPECT_EQUAL(error.deliver(), exp_error); \
} while(0)
#define TEST_GENPOS_FIELD(field,value) do { \
GBDATA *gb_field = GB_entry(gb_gene, (field)); \
if ((value)) { \
TEST_REJECT_NULL(gb_field); \
TEST_EXPECT_EQUAL(GB_read_char_pntr(gb_field), (value)); \
} \
else { \
TEST_EXPECT_NULL(gb_field); \
} \
} while(0)
#define TEST_GENPOS_FIELDS(start,stop,complement,certain) do { \
TEST_GENPOS_FIELD("pos_start", start); \
TEST_GENPOS_FIELD("pos_stop", stop); \
TEST_GENPOS_FIELD("pos_complement", complement); \
TEST_GENPOS_FIELD("pos_certain", certain); \
} while(0)
#define TEST_GENE_SEQ_AND_LENGTH(werr,wseq,wlen) do { \
size_t len; \
char *seq = GBT_read_gene_sequence_and_length(gb_gene, true, '-', &len); \
TEST_EXPECT_EQUAL(GB_have_error(), werr); \
if (seq) { \
TEST_EXPECT_EQUAL(len, (size_t)(wlen)); \
TEST_EXPECT_EQUAL(seq, (wseq)); \
free(seq); \
} \
else { \
GB_clear_error(); \
} \
} while(0)
void TEST_GEN_position() {
// see also ../GENOM_IMPORT/Location.cxx@TEST_gene_location
GB_shell shell;
ARB_ERROR error;
GBDATA *gb_main = TEST_CREATE_DB(error, "ali_genom", TestAlignmentData_Genome, false);
TEST_EXPECT_NULL(error.deliver());
{
GB_transaction ta(gb_main);
GBDATA *gb_organism = GBT_find_species(gb_main, "spec"); TEST_REJECT_NULL(gb_organism);
GBDATA *gb_gene_data = GEN_findOrCreate_gene_data(gb_organism); TEST_REJECT_NULL(gb_gene_data);
GBDATA *gb_gene = GEN_create_nonexisting_gene_rel_gene_data(gb_gene_data, "gene"); TEST_REJECT_NULL(gb_gene);
typedef SmartCustomPtr(GEN_position, GEN_free_position) GEN_position_Ptr;
GEN_position_Ptr pos;
pos = GEN_new_position(1, false);
TEST_WRITE_GEN_POSITION_ERROR(pos, "Illegal start position 0");
pos->start_pos[0] = 5;
pos->stop_pos[0] = 10;
pos->complement[0] = 1;
GEN_use_uncertainties(&*pos);
TEST_WRITE_READ_GEN_POSITION(&*pos);
TEST_GENPOS_FIELDS("5", "10", "1", "==");
TEST_GENE_SEQ_AND_LENGTH(false, "TTTAGG", 6);
// ----------
pos = GEN_new_position(3, false);
TEST_WRITE_GEN_POSITION_ERROR(pos, "Illegal start position 0");
GEN_use_uncertainties(&*pos);
pos->start_pos[0] = 5; pos->start_pos[1] = 10; pos->start_pos[2] = 25;
pos->stop_pos[0] = 15; pos->stop_pos[1] = 20; pos->stop_pos[2] = 25;
pos->complement[0] = 0; pos->complement[1] = 1; pos->complement[2] = 0;
pos->start_uncertain[0] = '<';
pos->stop_uncertain[2] = '>';
TEST_WRITE_READ_GEN_POSITION(&*pos);
TEST_GENPOS_FIELDS("5,10,25", "15,20,25", "0,1,0", "<=,==,=>");
TEST_GENE_SEQ_AND_LENGTH(false, "CCUAAACCCAA-TACGGTTGGGT-G", 25);
pos->stop_uncertain[2] = 'x';
TEST_WRITE_GEN_POSITION_ERROR(pos, "Invalid uncertainty 'x'");
pos->stop_uncertain[2] = '+';
TEST_WRITE_GEN_POSITION_ERROR(pos, "Invalid uncertainty '+'"); // invalid for stop
pos->start_uncertain[2] = '+';
pos->stop_uncertain[2] = '-';
TEST_WRITE_GEN_POSITION_ERROR(pos, "Invalid positions 25^25 for uncertainties +-");
pos->stop_pos[2] = 26;
TEST_WRITE_GEN_POSITION_ERROR(pos, (void*)NULL);
pos->stop_pos[0] = 100;
TEST_WRITE_GEN_POSITION_ERROR(pos, "Illegal stop position 100 (>length(=32))");
}
GB_close(gb_main);
}
#endif // UNIT_TESTS
|