1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434
|
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN">
<html><head><title>Training AUGUSTUS</title>
<link rel="stylesheet" type="text/css" href="augustus.css">
<script src="tutorial.js" type="text/javascript"></script>
</head><body>
<font size=-1>
Navigate to <a href="index.html">Lab Session on AUGUSTUS</a>.
<a href="scipio.html">Using Scipio</a>.
<a href="prediction.html">Predicting Genes</a>.
<a href="ppx.html">AUGUSTUS-PPX</a>.
</font>
<div align="right">Show <a href="javascript:allOn()">all</a> / <a href="javascript:allOff()">no</a> details.</div>
<h1>Training AUGUSTUS</h1>
This manual is intended for those who want to retrain on their own ab initio AUGUSTUS for another species.
Please do not rely on this manual and the scripts and programs. Check what they do on your data!
<h2>1. COMPILE A SET OF TRAINING AND TEST GENES</h2>
You will need a set of genomic sequences with bona fide gene structures (sequence coordinates of starts and ends of exons and genes).
In many cases, or as a first step towards modelling complete genes, it is sufficient to have only
the <i>coding parts</i> of the gene structure (CDS).<br><br>
<a href="javascript:onoff('quantandqual')" class="dlink"><span id="quantandqual" title="quantandquald" class="dcross">[+]</span>
<span class="dtitle">Number and quality of gene structures...</span></a> <br>
<div id="quantandquald" class="details" style="display:none;">
As a minimum for good performance you should have 200 gene structures for training. The more genes the
training set comprises the better, however the incremental benefit of additional genes becomes
very small at 1000 genes already. As a rule of thumb, if you have more than 1000 genes
then rather prefer quality (fewer false annotations) over quantity. Make also sure that in
particular the number of multi-exon genes is large.
These are needed to train the introns. The gene structures of these genes should be
as accurate as possible. However, it is not <i>necessary</i> that they
are 100% correct, neither does the annotation have to be necessarily complete.
It is more imporant that the start codon is correctly annotated than that
the stop codon is correctly annotated.
</div><br>
<a href="javascript:onoff('nonred')" class="dlink"><span id="nonred" title="nonredd" class="dcross">[+]</span>
<span class="dtitle">The gene set should be non-redundant...</span></a> <br>
<div id="nonredd" class="details" style="display:none;">
Non-redundancy is important in particular if you plan to use part of it for training and another part
for assessing prediction accuracy. If in two different sequences genes with
an almost identical amino acid sequence is annotated then delete one of them.
My criterion is: No two genes in the set are more than 80% identical on the amino acid level.
The non-redundancy is very important for avoiding overfitting. This is of course also very important
if you want to test the accuracy on a test set.
</div><br>
Each sequence can contain one or more genes, the genes can be on either strand. However, the genes must
not overlap, and only one transcript per gene is allowed. Store the sequences together with their annotation
in a simple <b>genbank format</b>. For the exact format that the training program can read in look
as an example at one of the training genbank files at the augustus web server:
<a href="http://augustus.gobics.de/datasets/">http://augustus.gobics.de/datasets/</a>
<h3 id="trainoptions">1.1 Options for compiling a set of gene structures</h3>
<ol>
<li>pre-existing gene structures (e.g. from <a href="http://www.ncbi.nlm.nih.gov/genbank/">GenBank</a>)
<li>spliced alignments of ESTs against the assembled genomic sequence (e.g. using <a href="http://pasa.sourceforge.net/">PASA</a>)
<li>spliced alignments of de novo assembled transcriptome short reads (RNA-Seq)
<li><a name="scipiooption">spliced</a> alignments of <i>protein</i> sequences of the same or a very closely related species against the
assembled genomic sequence, e.g. using <a href="http://www.webscipio.org/">Scipio</a>.<br>
This approach is described in section <a href="scipio.html">Using Scipio to create a training set</a>.
<li>gene structures from a related species
<li>iteration of training with predicted genes, starting with an existing parameter set
</ol>
<h3 id="split">1.2 Split gene structure set into training and test set</h3>
<p><span class="assignment">Randomly <b>split</b> the set of annotated sequences</span> in a <b>training and a test set</b>.
<pre><div class="code">randomSplit.pl genes.gb 100</div></pre>
This generates a file <span class="result"><tt>genes.gb.test</tt></span> with 100 randomly chosen loci and a disjoint file <span class="result"><tt>genes.gb.train</tt></span> with the rest of the loci from <tt>genes.gb</tt>:
<pre class="code">
grep -c LOCUS genes.gb*
# genes.gb:586
# genes.gb.test:100
# genes.gb.train:486
</pre>
In order for the test accuracy to be statistically meaningful the test set should also be
large enough (100-200 genes). You should split the set of gene structures really randomly!
Do not just take the first and the last part of the file as then the test set is unlikely to
be representative. The script <tt>randomSplit.pl</tt> is in the scripts directory.<br><br>
<a href="javascript:onoff('ss')" class="dlink"><span id="ss" title="ssd" class="dcross">[+]</span>
<span class="dtitle">Additional splice site training set...</span></a> <br>
<div id="ssd" class="details" style="display:none;">
In rare cases it may be useful to specify a set of splice site sequences that should be used for training
in addition to the complete genes. This would apply, e.g. if the number of intron examples in your training set is small but
you have additional intron example, e.g. from spliced alignments of ESTs.
<br>The format is as in the following example.
<pre><div class="code">dss gccgagaactccgctcgttctgtgcgttctcctgtcccaggtagggaagaggggctgccgggcgcgctctgcgccccgtttc
dss cgtgattgtcggggggaaagacatccagggctccttgcaggtaacacatctgtttgagataacttgggttcaaggaggacat
dss agagaatcagagacagcctttcccaagagatgttggcaaggtaagtcagacaaacagcaaatgacaaaaacatgtttttatg
dss cattgtcactgttgtgtcacctgcgctgctggaccgagaggtgagctgaaaagaataccactttctttttcacgagaataga
dss tgacaaaaatgatcactcaccaaaattcaccaagaaagaggtaaacccctgtgccaaacaccaaccaccactgtggtcacag
ass gttagtatgcttctttaattttttttctccctgaaattataggaaccagatgttaaaaaattagaagaccaacttcaaggcg
ass --------------------------ggctttgtctttgcagaatttatagagcggcagcacgcaaagaacaggtattacta
ass gattccttgtgattagcctctcttgctccttttctccaccagcaaagtcgaccaagaaattatcaacattatgcaggatcgg
ass aaccgtagtaaacagcatgaatcgtgttttgtttttgaacagaccactggccttgtgggattggctgtgtgcaatactcctc
</div></pre>
<p>dss: donor (=5') splice site. 40 letters + gt + 40 letters
<br>ass: donor (=3') splice site. 40 letters + ag + 40 letters
<br>use '-' for unknown characters
<br><br>
</div><br>
<h2 id="meta">2. CREATE A META PARAMETERS FILE FOR YOUR SPECIES</h2>
<p> We call parameters like the size of the window of the splice site models and the order of the Markov model <i>meta parameters</i>, in contrast to <i>parameters</i> like the distribution of
splice site patterns, the <i>k</i>-mer probabilities of coding and noncoding regions.
There are a few dozen meta parameters but many thousands of parameters. The meta parameters
determine how the parameters are calculated.<br><br>
<span class="assignment">Create the files for training "<tt>bug</tt>"</span> from a template.
<pre><div class="code">new_species.pl --species=bug</div></pre>
<tt>new_species.pl</tt> uses the environment variable <tt>AUGUSTUS_CONFIG_PATH</tt> to determine the directory in which AUGUSTUS stores the species parameters.
You should see a report like this:
<pre><div class="code">creating directory /home/mario/augustus/trunk/config/species/bug/ ...
creating /home/mario/augustus/trunk/config/species/bug/bug_parameters.cfg ...
creating /home/mario/augustus/trunk/config/species/bug/bug_weightmatrix.txt ...
creating /home/mario/augustus/trunk/config/species/bug/bug_metapars.cfg ...
...
</div></pre>
The file <span class="result"><tt>bug_parameters.cfg</tt></span> contains besides meta-parameters also parameters to
<tt>augustus</tt> and <tt>etraining</tt> like defaults for output format settings.
<span class="assignment">Edit <tt>bug_parameters.cfg</tt> and set <tt>stopCodonExcludedFromCDS</tt> to </tt>true</tt>.</span>
<br><br>
<a href="javascript:onoff('par')" class="dlink"><span id="par" title="pard" class="dcross">[+]</span>
<span class="dtitle">The *_parameters.cfg file...</span></a> <br>
<div id="pard" class="details" style="display:none;">
contains output format options like
<p>
<table style="margin-left:20px;">
<tr><td><tt>protein</tt></td><td style="padding-left:30px;">turn on/off the inclusion of predicted peptide sequences in the output</td></tr>
<tr><td><tt>codingseq</tt></td><td style="padding-left:30px;">turn on/off the inclusion of predicted coding sequences in the output</td></tr>
</table>
</p>
and settings like
<p>
<table style="margin-left:20px;">
<tr><td><tt>alternatives-from-evidence</tt></td><td style="padding-left:30px;">turn on/of prediction of alternative transcripts based on hints</td></tr>
<tr><td><tt>UTR</tt></td><td style="padding-left:30px;">turn on/off the prediction of untranslated regions</td></tr>
</table>
</p>
All of the parameters set in this file can equally be given on the command line, e.g.
<pre><div class="code">augustus --species=bug --protein=on input.fa</div></pre>
in which case they override the setting in this file. The parameters at the top of the
file can be edited as desired or required for the species.
<p>The optional file with the filename given by /IntronModel/splicefile
may contain a list of sequence windows of known splice sites as described <a href="#ss">above</a>.<br><br>
For more info have a
look at the comments in the file and at the <tt>README.TXT</tt> that is included with AUGUSTUS.
</div><br>
<a href="javascript:onoff('gc')" class="dlink"><span id="gc" title="gcd" class="dcross">[+]</span>
<span class="dtitle">Distinguishing GC content classes...</span></a> <br>
<div id="gcd" class="details" style="display:none;">
This section describes the meaning of the meta parameter <i>/Constant/decomp_num_steps</i>
and the matrix in the file <tt>bug_weightmatrix.txt</tt> and you can savely skip this
on first training.<br><br>
For some species like humand and honey bee it makes sense to let the model
parameters depend on the average frequencies of the 4 bases in the query sequence.
For example, in human, the GC content stays
consistently above or below average over long sequence stretches (isochores).
AUGUSTUS can locally use different parameters that are adjusted to the base composition
of this piece.
I describe here only the dependency on the GC content.<br>
<tt>/Constant/decomp_num_steps</tt> is the number of different levels of GC
content that is taken into account, i.e. AUGUSTUS uses <tt>/Constant/decomp_num_steps</tt>
different sets of parameters, each for a different GC content.
Values between 1 and 10 are useful. The GC content ranges between
<tt>/Constant/gc_range_min</tt> and <tt>/Constant/gc_range_max</tt>.
These parameters can be set in the meta parameters file. Given a target GC content, each sequence in the training set is weighted depending on how similar its GC content
is to the target GC content. It gets a weight that is the higher, the
closer the GC content of the training sequence is to the target GC content.<br><br>
The two non-zero numbers in the middle of the 4x4 Matrix in bug_weightmatrix.txt
(default: 200) determine the influence of the deviation in GC content.
A high value (like 300) means that mostly training sequences with a very similar GC
content to the target GC content are taken into account.
The advantage is that the training is more specific to the target GC content.
The disadvantage of a high value is that this effectively reduces the size of the training set.
A low value (like 150) means that all training sequences are taken into account, except
that training sequences with a similar GC content are weighed somewhat stronger.
Editing the weightmatrix file is not recommended for normal users.
</div>
<h2 id="etraining">3. MAKE AN INITIAL TRAINING</h2>
This step may be skipped if step 4 below is done. However, in a semi-automatic setting (you type the commands in this document) it is not recommended to skip it.
<span class="assignment">Train augustus for the species <tt>bug</tt></span>
on the training set of gene structures.
<pre><div class="code">etraining --species=bug genes.gb.train</div></pre>
This creates/updates parameter files for exon, intron and intergenic region in the directory
$AUGUSTUS_CONFIG_PATH/species/bug.
<pre><div class="code">ls -ort $AUGUSTUS_CONFIG_PATH/species/bug/</div></pre>
now yields
<pre class="code">
-rw-r--r-- 1 mario 810 2011-01-08 10:50 bug_weightmatrix.txt
-rw-r--r-- 1 mario 810 2011-01-08 10:50 bug_weightmatrix.txt
-rw-r--r-- 1 mario 1355 2011-01-08 10:50 bug_metapars.utr.cfg
-rw-r--r-- 1 mario 2057 2011-01-08 10:50 bug_metapars.cfg
-rw-r--r-- 1 mario 7156 2011-01-08 22:05 bug_parameters.cfg
-rw-r--r-- 1 mario 100100 2011-01-08 22:35 bug_intron_probs.pbl
-rw-r--r-- 1 mario 234355 2011-01-08 22:35 bug_exon_probs.pbl
-rw-r--r-- 1 mario 32588 2011-01-08 22:35 bug_igenic_probs.pbl
</pre>
where <span class="result"><tt>bug_{intron,exon,igenic}.pbl</tt></span> are our newly created parameter files.<br><br>
Now we make a first try and <span class="assignment">predict the genes in <tt>genes.gb.train</tt> <i>ab initio</i></span>.
<pre><div class="code">augustus --species=bug genes.gb.test | tee firsttest.out # takes ~1m</div></pre>
This predicts the genes in all 100 sequences and will at the end print a report about
the prediction accuracy, comparing the strucures in the input file <tt>genes.gb.test</tt> with
the ones predicted. Of course, for the predictions only the sequences are used, not the
input gene structures.<br><br>
<span class="assignment">Look at the accuracy report</span> at the end of <tt>firsttest.out</tt>:
<pre><div class="code">grep -A 22 Evaluation firsttest.out</div></pre>
<pre class="code" style="font-size:x-small;">
******* Evaluation of gene prediction *******
---------------------------------------------\
| sensitivity | specificity |
---------------------------------------------|
nucleotide level | 0.975 | 0.89 |
---------------------------------------------/
----------------------------------------------------------------------------------------------------------\
| #pred | #anno | | FP = false pos. | FN = false neg. | | |
| total/ | total/ | TP |--------------------|--------------------| sensitivity | specificity |
| unique | unique | | part | ovlp | wrng | part | ovlp | wrng | | |
----------------------------------------------------------------------------------------------------------|
| | | | 115 | 76 | | |
exon level | 511 | 472 | 396 | ------------------ | ------------------ | 0.839 | 0.775 |
| 511 | 472 | | 40 | 5 | 70 | 43 | 3 | 30 | | |
----------------------------------------------------------------------------------------------------------/
----------------------------------------------------------------------------\
transcript | #pred | #anno | TP | FP | FN | sensitivity | specificity |
----------------------------------------------------------------------------|
gene level | 118 | 100 | 53 | 65 | 47 | 0.53 | 0.449 |
----------------------------------------------------------------------------/
</pre>
These numbers mean, for example, that
<p class="result" style="margin-left:20px;">
of the 100 genes 53 were predicted exactly<br>
83.9% of the exons were predicted exactly<br>
77.5% of the predicted exons were exactly as in the test set.
</p>
<a href="javascript:onoff('flycomp')" class="dlink"><span id="flycomp" title="flycompd" class="dcross">[+]</span>
<span class="dtitle">Compare with the shipped fly parameters...</span></a> <br>
<div id="flycompd" class="details" style="display:none;">
The <tt>fly</tt> parameters that come with augustus yield a somewhat better accuracy:
<pre><div class="code">augustus --species=fly --stopCodonExcludedFromCDS=true genes.gb.test --UTR=off \
| grep -A 22 Evaluation # takes ~1m</div></pre>
gives the following accuracy report:
<pre class="code" style="font-size:x-small;">
******* Evaluation of gene prediction *******
---------------------------------------------\
| sensitivity | specificity |
---------------------------------------------|
nucleotide level | 0.987 | 0.896 |
---------------------------------------------/
----------------------------------------------------------------------------------------------------------\
| #pred | #anno | | FP = false pos. | FN = false neg. | | |
| total/ | total/ | TP |--------------------|--------------------| sensitivity | specificity |
| unique | unique | | part | ovlp | wrng | part | ovlp | wrng | | |
----------------------------------------------------------------------------------------------------------|
| | | | 85 | 45 | | |
exon level | 512 | 472 | 427 | ------------------ | ------------------ | 0.905 | 0.834 |
| 512 | 472 | | 29 | 2 | 54 | 30 | 1 | 14 | | |
----------------------------------------------------------------------------------------------------------/
----------------------------------------------------------------------------\
transcript | #pred | #anno | TP | FP | FN | sensitivity | specificity |
----------------------------------------------------------------------------|
gene level | 105 | 100 | 67 | 38 | 33 | 0.67 | 0.638 |
----------------------------------------------------------------------------/
</pre>
</div>
<h2 id="optimize">4. RUN THE SCRIPT <tt>optimize_augustus.pl</tt></h2>
<p>This script optimizes the prediction accuracy by adjusting the meta parameters in
the <tt>*_parameters.cfg</tt> file. The script alternatingly used the programs <tt>augustus</tt> and <tt>etraining</tt>. This ususally increases prediction accuracy by a few percent points,
but runs for hours or days. It may be skipped and only etraining be run once (step 3. above),
which is very quick. <tt>augustus</tt> and <tt>etraining</tt> must be in the <tt>$PATH</tt>.</p>
<p>
You need to tell optimize_augustus.pl, which metaparameters it should optimize.
Do this by adjusting the file <tt>config/species/generic/generic_metapars.cfg</tt>.
(You may also make a copy of it and then use the command line parameter
--metapars=nameofmycopy to the script optimize_augustus.pl.)<br><br>
<span class="assignment">Run</span>
<pre><div class="code">optimize_augustus.pl --species=bug genes.gb.train # <span style="color:red">takes ~1d</span></div></pre>
<p>
<a href="javascript:onoff('optim')" class="dlink"><span id="optim" title="optimd" class="dcross">[+]</span>
<span class="dtitle">What <tt>optimize_augustus.pl</tt> does...</span></a> <br>
<div id="optimd" class="details" style="display:none;">
<p>
In an evaluation step this script does the following 10 fold cross validation.
It splits the set <tt>genes.gb.train</tt> randomly into 10 sets (buckets)
of ±1 equal size. Then takes 9 of the 10 sets for training and the other
one for evaluating the prediction accuracy using the annotation of the genbank file.
The 10 possible buckets for evaluating are rotated and each case the other sequences
are used for training.</p>
<p> On each prediction it computes a single target value that is subject to optimization.
The target is a a weighted average of the sensitivities and specificities on the
base, exon and gene level. (Feel free to change the weighing to your preferences in
the function 'sub gettarget'.)<p>
<p>
For a meta parameter the script repeats above evaluation step for different values of
the meta parameter. If it finds an improvement in the target value it adjusts the value
of the meta parameter in your <tt>bug_parameters.cfg</tt> file. It tries new values for
the parameter until it finds no more improvement. Then it optimizes the next meta parameter.
When it has optimized all meta parameters once, it repeats with the first meta parameter. </p>
<p>It does at most 5 rounds of optimizations, but stops earlier if no improvements are found.
It is possible to interrupt the script of you cannot wait for it to finish.
This script probably has to run over night with <tt>nohup</tt> or <tt>screen</tt>. When
it is done your <tt>bug_parameters.cfg</tt> should have better suited meta parameters
for your species and your training set.
</div>
<p>
After <tt>optimize_augustus.pl</tt> has finished or (after you have interrupted it)
you should <span class="assignment">(re)train AUGUSTUS</span> with the meta parameters it has
set.
<pre><div class="code">etraining --species=bug genes.gb.train</div></pre>
<p>If you have a test set, you can now <span class="assignment">check the prediction
accuracy</span> on this test set by running
<pre><div class="code">augustus --species=bug genes.test.gb</div></pre>
<p>The end of the output will then contain a summary of the accuracy of
the prediction. If the gene level sensitivity is below 20% it is likely
that the training set is not large enough, that it doesn't have a good
quality or that the species is somehow 'special'.
<br>If you succeeded in creating a good AUGUSTUS version for your
species I would be very interested in your results. If possible please
share your results by giving me the packed <tt>config/yourspecies</tt> folder.
</p>
<p><font size=+2><b>4. SPECIAL CASE: ORGANISM WITH DIFFERENT GENETIC CODE</b></font><br>
<p> AUGUSTUS can be told to use a different <a href="http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi?mode=c">translation table</a>,
in particular one with a different set of stop codons.
This is useful for a small number of species such as <i>Tetrahymena thermophilia</i>, in which some codons translate
to a different amino acid than usual. If you train AUGUSTUS for such a species set the variable <i>translation_table</i>
in the parameter file of your species. Further, adjust the stop codon probabilities in the same config file. E.g. say
<p style="margin-left:20px;">
translation_table 6<br>
/Constant/amberprob 0 # Prob(stop codon = tag), if 0 tag is assumed to code for amino acid<br>
/Constant/ochreprob 0 # Prob(stop codon = taa), if 0 taa is assumed to code for amino acid<br>
/Constant/opalprob 1 # Prob(stop codon = tga), if 0 tga is assumed to code for amino acid
</p>
in the case of <i>Tetrahymena</i>, where <tt>taa</tt> and <tt>tag</tt> are coding for glutamine (Q).
<p>
Choose the translation table number accoding to this table. translation_table=1 is
the default value and the standard with stop codons taa, tga, tag. If you have a species with the standard genetic code you don't have to do anything.
In case your species' code is not covered by this table send us a note with the string of 64 one-letter amino acid codes in the codon order below.
</p>
<table border="1" rules="groups">
<colgroup>
<col width="7*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*">
<col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*">
<col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*">
<col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*"><col width="1*">
</colgroup>
<thead>
<tr>
<td>translation </td>
<td>a</td><td>a</td><td>a</td><td>a</td><td>a</td><td>a</td><td>a</td><td>a</td><td>a</td><td>a</td><td>a</td><td>a</td><td>a</td><td>a</td><td>a</td><td>a</td>
<td>c</td><td>c</td><td>c</td><td>c</td><td>c</td><td>c</td><td>c</td><td>c</td><td>c</td><td>c</td><td>c</td><td>c</td><td>c</td><td>c</td><td>c</td><td>c</td>
<td>g</td><td>g</td><td>g</td><td>g</td><td>g</td><td>g</td><td>g</td><td>g</td><td>g</td><td>g</td><td>g</td><td>g</td><td>g</td><td>g</td><td>g</td><td>g</td>
<td>t</td><td>t</td><td>t</td><td>t</td><td>t</td><td>t</td><td>t</td><td>t</td><td>t</td><td>t</td><td>t</td><td>t</td><td>t</td><td>t</td><td>t</td><td>t</td>
</tr>
<tr>
<td>table</td>
<td>a</td><td>a</td><td>a</td><td>a</td><td>c</td><td>c</td><td>c</td><td>c</td><td>g</td><td>g</td><td>g</td><td>g</td><td>t</td><td>t</td><td>t</td><td>t</td>
<td>a</td><td>a</td><td>a</td><td>a</td><td>c</td><td>c</td><td>c</td><td>c</td><td>g</td><td>g</td><td>g</td><td>g</td><td>t</td><td>t</td><td>t</td><td>t</td>
<td>a</td><td>a</td><td>a</td><td>a</td><td>c</td><td>c</td><td>c</td><td>c</td><td>g</td><td>g</td><td>g</td><td>g</td><td>t</td><td>t</td><td>t</td><td>t</td>
<td>a</td><td>a</td><td>a</td><td>a</td><td>c</td><td>c</td><td>c</td><td>c</td><td>g</td><td>g</td><td>g</td><td>g</td><td>t</td><td>t</td><td>t</td><td>t</td>
</tr>
<tr>
<td>number</td>
<td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td>
<td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td>
<td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td>
<td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td><td>a</td><td>c</td><td>g</td><td>t</td>
</tr>
</thead>
<tbody>
<tr><td><b>1</b></td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>R</TD><TD>S</TD><TD>R</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><td>*</td><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td> 2</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><td>*</td><TD>S</TD><td>*</td><TD>S</TD><TD>M</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>W</TD><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td> 3</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>R</TD><TD>S</TD><TD>R</TD><TD>S</TD><TD>M</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>W</TD><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td> 4</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>R</TD><TD>S</TD><TD>R</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>W</TD><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td> 5</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>M</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>W</TD><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td> 6</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>R</TD><TD>S</TD><TD>R</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>Q</TD><TD>Y</TD><TD>Q</TD><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><td>*</td><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td> 9</td><TD>N</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>W</TD><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td>10</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>R</TD><TD>S</TD><TD>R</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>C</TD><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td>11</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>R</TD><TD>S</TD><TD>R</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><td>*</td><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td>12</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>R</TD><TD>S</TD><TD>R</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>S</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><td>*</td><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td>13</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>G</TD><TD>S</TD><TD>G</TD><TD>S</TD><TD>M</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>W</TD><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td>14</td><TD>N</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>Y</TD><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>W</TD><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td>15</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>R</TD><TD>S</TD><TD>R</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><TD>Q</TD><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><td>*</td><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td>16</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>R</TD><TD>S</TD><TD>R</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><TD>L</TD><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><td>*</td><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td>21</td><TD>N</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>M</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>W</TD><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td>22</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>R</TD><TD>S</TD><TD>R</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><TD>L</TD><TD>Y</TD><td>*</td><TD>S</TD><TD>S</TD><TD>S</TD><td>*</td><TD>C</TD><TD>W</TD><TD>C</TD><TD>L</TD><TD>F</TD><TD>L</TD><TD>F</TD></tr>
<tr><td>23</td><TD>K</TD><TD>N</TD><TD>K</TD><TD>N</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>T</TD><TD>R</TD><TD>S</TD><TD>R</TD><TD>S</TD><TD>I</TD><TD>I</TD><TD>M</TD><TD>I</TD><TD>Q</TD><TD>H</TD><TD>Q</TD><TD>H</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>P</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>R</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>L</TD><TD>E</TD><TD>D</TD><TD>E</TD><TD>D</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>A</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>G</TD><TD>V</TD><TD>V</TD><TD>V</TD><TD>V</TD><td>*</td><TD>Y</TD><td>*</td><TD>Y</TD><TD>S</TD><TD>S</TD><TD>S</TD><TD>S</TD><td>*</td><TD>C</TD><TD>W</TD><TD>C</TD><td>*</td><TD>F</TD><TD>L</TD><TD>F</TD></tr>
</tbody>
</table>
</body></html>
|