1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177
|
set -e;
BT=${BT-../../bin/bedtools}
htsutil=${htsutil-../htsutil}
FAILURES=0;
check()
{
if diff $1 $2; then
echo ok
else
FAILURES=$(expr $FAILURES + 1);
echo fail
fi
}
###########################################################
# Test a basic self intersection
############################################################
echo -e " intersect.t01...\c"
echo \
"chr1 10 20 a1 1 +
chr1 100 200 a2 2 -" > exp
$BT intersect -a a.bed -b a.bed > obs
check obs exp
rm obs exp
###########################################################
# Test a basic self intersection with -v
############################################################
echo -e " intersect.t02...\c"
# expectation is empty set
touch exp
$BT intersect -a a.bed -b a.bed -v > obs
check obs exp
rm obs exp
###########################################################
# Test -c
############################################################
echo -e " intersect.t03...\c"
echo \
"chr1 10 20 a1 1 + 0
chr1 100 200 a2 2 - 2" > exp
$BT intersect -a a.bed -b b.bed -c > obs
check obs exp
rm obs exp
###########################################################
# Test -c with -s
############################################################
echo -e " intersect.t04...\c"
echo \
"chr1 10 20 a1 1 + 0
chr1 100 200 a2 2 - 1" > exp
$BT intersect -a a.bed -b b.bed -c -s > obs
check obs exp
rm obs exp
###########################################################
# Test -c with -s and -f
############################################################
echo -e " intersect.t05...\c"
echo \
"chr1 10 20 a1 1 + 0
chr1 100 200 a2 2 - 0" > exp
$BT intersect -a a.bed -b b.bed -c -s -f 0.1 > obs
check obs exp
rm obs exp
###########################################################
# Test plain a and b intersect
############################################################
echo -e " intersect.t06...\c"
echo \
"chr1 100 101 a2 2 -
chr1 100 110 a2 2 -" > exp
$BT intersect -a a.bed -b b.bed > obs
check obs exp
rm obs exp
###########################################################
# Test with -wa
############################################################
echo -e " intersect.t07...\c"
echo \
"chr1 100 200 a2 2 -
chr1 100 200 a2 2 -" > exp
$BT intersect -a a.bed -b b.bed -wa > obs
check obs exp
rm obs exp
###########################################################
# Test with -wa and -wb
############################################################
echo -e " intersect.t08...\c"
echo \
"chr1 100 200 a2 2 - chr1 90 101 b2 2 -
chr1 100 200 a2 2 - chr1 100 110 b3 3 +" > exp
$BT intersect -a a.bed -b b.bed -wa -wb > obs
check obs exp
rm obs exp
###########################################################
# Test with -wo (write overlap)
############################################################
echo -e " intersect.t09...\c"
echo \
"chr1 100 200 a2 2 - chr1 90 101 b2 2 - 1
chr1 100 200 a2 2 - chr1 100 110 b3 3 + 10" > exp
$BT intersect -a a.bed -b b.bed -wo > obs
check obs exp
rm obs exp
###########################################################
# Test with -wao (write all overlap)
############################################################
echo -e " intersect.t10...\c"
echo \
"chr1 10 20 a1 1 + . -1 -1 . -1 . 0
chr1 100 200 a2 2 - chr1 90 101 b2 2 - 1
chr1 100 200 a2 2 - chr1 100 110 b3 3 + 10" > exp
$BT intersect -a a.bed -b b.bed -wao > obs
check obs exp
rm obs exp
###########################################################
# Test with -wo (write overlap) with -s
############################################################
echo -e " intersect.t11...\c"
echo \
"chr1 100 200 a2 2 - chr1 90 101 b2 2 - 1" > exp
$BT intersect -a a.bed -b b.bed -wo -s > obs
check obs exp
rm obs exp
###########################################################
# Test with -wao (write all overlap) with -s
############################################################
echo -e " intersect.t12...\c"
echo \
"chr1 10 20 a1 1 + . -1 -1 . -1 . 0
chr1 100 200 a2 2 - chr1 90 101 b2 2 - 1" > exp
$BT intersect -a a.bed -b b.bed -wao -s > obs
check obs exp
rm obs exp
###########################################################
# Test A as -
############################################################
echo -e " intersect.t13...\c"
echo \
"chr1 100 101 a2 2 -
chr1 100 110 a2 2 -" > exp
cat a.bed | $BT intersect -a - -b b.bed > obs
check obs exp
rm obs exp
###########################################################
# Test A as stdin
############################################################
echo -e " intersect.t14...\c"
echo \
"chr1 100 101 a2 2 -
chr1 100 110 a2 2 -" > exp
cat a.bed | $BT intersect -a stdin -b b.bed > obs
check obs exp
rm obs exp
###########################################################
# Test B as -
############################################################
echo -e " intersect.t15...\c"
echo \
"chr1 100 101 a2 2 -
chr1 100 110 a2 2 -" > exp
cat b.bed | $BT intersect -a a.bed -b - > obs
check obs exp
rm obs exp
###########################################################
# Test A as stdin
############################################################
echo -e " intersect.t16...\c"
echo \
"chr1 100 101 a2 2 -
chr1 100 110 a2 2 -" > exp
cat b.bed | $BT intersect -a a.bed -b stdin > obs
check obs exp
rm obs exp
###########################################################
###########################################################
# -split #
###########################################################
###########################################################
$htsutil samtobam one_block.sam one_block.bam
$htsutil samtobam two_blocks.sam two_blocks.bam
$htsutil samtobam three_blocks.sam three_blocks.bam
$htsutil samtobam split.issue750.sam split.issue750.bam
##################################################################
# Test three blocks matches BED without -split
##################################################################
echo -e " intersect.t17...\c"
echo \
"three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp
$BT intersect -abam three_blocks.bam -b three_blocks_nomatch.bed | $htsutil viewbamrecords > obs
check obs exp
rm obs exp
##################################################################
# Test three blocks does not match BED with -split
##################################################################
echo -e " intersect.t18...\c"
touch exp
$BT intersect -abam three_blocks.bam -b three_blocks_nomatch.bed -split | $htsutil viewbamrecords > obs
check obs exp
rm obs exp
##################################################################
# Test three blocks matches BED with -split
##################################################################
echo -e " intersect.t19...\c"
echo \
"three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp
$BT intersect -abam three_blocks.bam -b three_blocks_match.bed -split | $htsutil viewbamrecords > obs
check obs exp
rm obs exp
##################################################################
# Test three blocks does not match BED with -split and -s
# BAM os -, BED is +
##################################################################
echo -e " intersect.t20...\c"
touch exp
$BT intersect -abam three_blocks.bam -b three_blocks_match.bed -split -s | $htsutil viewbamrecords > obs
check obs exp
rm obs exp
##################################################################
# Test three blocks match BED that overlap 1bp with -split
##################################################################
echo -e " intersect.t21...\c"
echo \
"three_blocks 16 chr1 1 40 10M10N10M10N10M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp
$BT intersect -abam three_blocks.bam -b three_blocks_match_1bp.bed -split | $htsutil viewbamrecords > obs
check obs exp
rm obs exp
################################################################################
# Test three blocks does not match BED that overlap 1bp with -split and -f 0.1
################################################################################
echo -e " intersect.t22...\c"
touch exp
$BT intersect -abam three_blocks.bam -b three_blocks_match_1bp.bed -split -f 0.1 | $htsutil viewbamrecords > obs
check obs exp
rm obs exp
###########################################################
# Test three blocks with -split -wo only shows 5 overlap
# bases, not ten.
############################################################
echo -e " intersect.t22.a...\c"
echo "chr1 0 50 three_blocks_match 0 + 0 0 0 3 10,10,10, 0,20,40, chr1 5 15 5" > exp
$BT intersect -a three_blocks_match.bed -b d.bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Same test but for BAM file
############################################################
echo -e " intersect.t22.b...\c"
echo "chr1 0 50 three_blocks_match 255 + 0 50 0,0,0 3 10,10,10, 0,20,40, chr1 5 15 5" > exp
$BT intersect -a three_blocks_match.bam -b d.bed -split -wo -bed > obs
check obs exp
rm obs exp
###########################################################
# Test three blocks with -split -wo, and DB record also has
# blocks that somewhat intersect
############################################################
echo -e " intersect.t22.c...\c"
echo "chr1 0 50 three_blocks_match 0 + 0 0 0 3 10,10,10, 0,20,40, chr1 0 45 three_blocks_match 0 + 0 0 0 2 5,10, 25,35, 10" > exp
$BT intersect -a three_blocks_match.bed -b two_blocks_partial.bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Same test but for BAM file
############################################################
echo -e " intersect.t22.d...\c"
echo "chr1 0 50 three_blocks_match 255 + 0 50 0,0,0 3 10,10,10, 0,20,40, chr1 0 45 three_blocks_match 0 + 0 0 0 2 5,10, 25,35, 10" > exp
$BT intersect -a three_blocks_match.bam -b two_blocks_partial.bed -split -wo -bed > obs
check obs exp
rm obs exp
###########################################################
# Test three blocks with -split -wo, and DB record also has
# blocks that do not intersect
############################################################
echo -e " intersect.t22.e...\c"
touch exp
$BT intersect -a three_blocks_match.bed -b three_blocks_nomatch.bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Same test but for BAM file
############################################################
echo -e " intersect.t22.f...\c"
touch exp
$BT intersect -a three_blocks_match.bam -b three_blocks_nomatch.bed -split -wo -bed > obs
check obs exp
rm obs exp
###########################################################
# Added split test from bug150. See that overlap bases
# with -split are correctly affected by overlap fraction
############################################################
echo -e " intersect.t22.g...\c"
echo \
"chr2 1000 16385 A 0 - 0 0 0 2 1,1, 0,15384, chr2 1000 16385 A 0 - 0 0 0 2 1,1, 0,15384, 2" > exp
$BT intersect -a bug150_a.bed -b bug150_b.bed -s -split -wo > obs
check exp obs
rm exp obs
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
############################################################
echo -e " intersect.t22.h...\c"
echo \
"chr1 0 30 one_block_one_exon_30bp 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 30
chr1 80 110 one_block_one_exon_20bp 40 - 80 110 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 20
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110, chr1 0 100 exon1 1 + 10
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110, chr1 200 300 exon2 2 - 20" > exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -f 0.5 -bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
# With -u
############################################################
echo -e " intersect.t22.i...\c"
echo \
"chr1 0 30 one_block_one_exon_30bp 40 - 0 30 0,0,0 1 30, 0,
chr1 80 110 one_block_one_exon_20bp 40 - 80 110 0,0,0 1 30, 0,
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110," > exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -f 0.5 -bed -split -u > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
# Increase fraction of overlap
############################################################
echo -e " intersect.t22.j...\c"
echo \
"chr1 0 30 one_block_one_exon_30bp 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 30
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110, chr1 0 100 exon1 1 + 10
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110, chr1 200 300 exon2 2 - 20" > exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -f 0.7 -bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
# Increase fraction of overlap
############################################################
echo -e " intersect.t22.j...\c"
echo \
"chr1 0 30 one_block_one_exon_30bp 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 30
chr1 80 110 one_block_one_exon_20bp 40 - 80 110 0,0,0 1 30, 0, . -1 -1 . -1 . 0
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110, chr1 0 100 exon1 1 + 10
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110, chr1 200 300 exon2 2 - 20" > exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -f 0.7 -bed -split -wao > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
# Increase fraction of overlap
############################################################
echo -e " intersect.t22.k...\c"
echo \
"chr1 0 30 one_block_one_exon_30bp 40 - 0 30 0,0,0 1 30, 0,
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110," > exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -f 0.7 -bed -split -u > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
# With -r
############################################################
echo -e " intersect.t22.l...\c"
touch exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -f 0.5 -bed -split -wo -r > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
# With -r, lowering -f
############################################################
echo -e " intersect.t22.m...\c"
echo \
"chr1 0 30 one_block_one_exon_30bp 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 30
chr1 80 110 one_block_one_exon_20bp 40 - 80 110 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 20
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110, chr1 0 100 exon1 1 + 10
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110, chr1 200 300 exon2 2 - 20" > exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -f 0.1 -bed -split -r -wo > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
# With -F
############################################################
echo -e " intersect.t22.n...\c"
touch exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -F 0.5 -bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
# With -F, lowering
############################################################
echo -e " intersect.t22.o...\c"
touch exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -F 0.31 -bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
# With -F, lowering
############################################################
echo -e " intersect.t22.p...\c"
echo \
"chr1 0 30 one_block_one_exon_30bp 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 30" > exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -F 0.30 -bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
# With -F, lowering
############################################################
echo -e " intersect.t22.q...\c"
echo \
"chr1 0 30 one_block_one_exon_30bp 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 30
chr1 80 110 one_block_one_exon_20bp 40 - 80 110 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 20" > exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -F 0.20 -bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
# With -F, lowering
############################################################
echo -e " intersect.t22.r...\c"
echo \
"chr1 0 30 one_block_one_exon_30bp 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 30
chr1 80 110 one_block_one_exon_20bp 40 - 80 110 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 20
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110, chr1 0 100 exon1 1 + 10
chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110, chr1 200 300 exon2 2 - 20" > exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -F 0.10 -bed -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
############################################################
echo -e " intersect.t22.s...\c"
echo \
"chr1 90 220 two_blocks_two_exons 40 - 90 220 0,0,0 2 10,20, 0,110, chr1 200 300 exon2 2 - 20" > exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -f 0.5 -bed -split -wo -s > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #750:
# https://github.com/arq5x/bedtools2/issues/750
############################################################
echo -e " intersect.t22.t...\c"
echo \
"chr1 0 30 one_block_one_exon_30bp 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 30
chr1 80 110 one_block_one_exon_20bp 40 - 80 110 0,0,0 1 30, 0, chr1 0 100 exon1 1 + 20" > exp
$BT intersect -a split.issue750.bam -b exons.issue750.bed -f 0.5 -bed -split -wo -S > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #773:
# https://github.com/arq5x/bedtools2/issues/773
############################################################
echo -e " intersect.t22.u...\c"
echo \
"X 10 30 A2 1 + 0 30 255,0,0 1 20 0 X 0 20 B1 0 + 10
X 10 30 A2 1 + 0 30 255,0,0 1 20 0 X 0 20 B2 0 + 10" > exp
$BT intersect -a issue_773_b.bed -b issue_773_y.bed -f 0.5 -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #773:
# https://github.com/arq5x/bedtools2/issues/773
############################################################
echo -e " intersect.t22.v...\c"
touch exp
$BT intersect -a issue_773_b.bed -b issue_773_y.bed -f 0.6 -split -wo > obs
check obs exp
rm obs exp
###########################################################
# Test that -f is based on the cumulative fraction of the
# split overlaps for the A interval, not based on _each_
# alignment. See issue #773:
# https://github.com/arq5x/bedtools2/issues/773
############################################################
echo -e " intersect.t22.w...\c"
echo \
"X 10 30 A2 1 + 0 30 255,0,0 1 20 0 . -1 -1 . -1 . 0" > exp
$BT intersect -a issue_773_b.bed -b issue_773_y.bed -f 0.6 -split -wao > obs
check obs exp
rm obs exp
##################################################################
# Test that only the mapped read is is found as an intersection
##################################################################
echo -e " intersect.t23...\c"
echo \
"mapped 16 chr1 1 40 30M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp
$htsutil samtobam mapped_and_unmapped.sam | $BT intersect -abam - -b a.bed | $htsutil viewbamrecords > obs
check obs exp
rm obs exp
##################################################################
# Test that an unmapped read is handled properly with -v
##################################################################
echo -e " intersect.t24...\c"
echo \
"umapped 4 * 1 40 30M * 0 0 GAAGGCCACCGCCGCGGTTATTTTCCTTCA CCCDDB?=FJIIJIGFJIJHIJJJJJJJJI MD:Z:50" > exp
$htsutil samtobam mapped_and_unmapped.sam | $BT intersect -abam - -b a.bed -v | $htsutil viewbamrecords > obs
check obs exp
rm obs exp
##################################################################
# Test -c with BAM input
##################################################################
echo -e " intersect.t25...\c"
echo \
"chr1 0 30 one_blocks 40 - 0 30 0,0,0 1 30, 0, 1" > exp
$BT intersect -abam one_block.bam -b c.bed -c -bed > obs
check obs exp
rm obs exp
##################################################################
# Test -wo with BAM input
##################################################################
echo -e " intersect.t26...\c"
echo \
"chr1 0 30 one_blocks 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 c1 1 + 30" > exp
$BT intersect -abam one_block.bam -b c.bed -wo -bed > obs
check obs exp
rm obs exp
##################################################################
# Test -wao with BAM input
##################################################################
echo -e " intersect.t27...\c"
echo \
"chr1 0 30 one_blocks 40 - 0 30 0,0,0 1 30, 0, chr1 0 100 c1 1 + 30" > exp
$BT intersect -abam one_block.bam -b c.bed -wo -bed > obs
check obs exp
##################################################################
# Test BED3 with BED3
##################################################################
echo -e " intersect.t28...\c"
echo \
"chr1^I10^I20^Ichr1^I10^I20" > exp
$BT intersect -a bed3.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test BED4 with BED3
##################################################################
echo -e " intersect.t29...\c"
echo \
"chr1^I10^I20^I345.7^Ichr1^I10^I20" > exp
$BT intersect -a bed4.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test BED5 with BED3
##################################################################
echo -e " intersect.t30...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^Ichr1^I10^I20" > exp
$BT intersect -a bed5.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test BED6 (without a proper strand) with BED3
##################################################################
echo -e " intersect.t31...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I11^Ichr1^I10^I20" > exp
$BT intersect -a bed6.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test BED6 (with a strand) with BED3
##################################################################
echo -e " intersect.t32...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I-^Ichr1^I10^I20" > exp
$BT intersect -a bed6.strand.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test BED PLUS with BED3
##################################################################
echo -e " intersect.t33...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I11^Ifoo^Ibar^Ibiz^I11^Ibang^Ibop^I99^Ichr1^I10^I20" > exp
$BT intersect -a bedplus.bed -b bed3.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test for strand matches with BED3
##################################################################
echo -e " intersect.t34...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I11^Ichr1^I10^I20^I345.7^Iwhy?^I-" > exp
$BT intersect -a bed6.bed -b bed6.strand.bed -wa -wb | cat -t > obs
check obs exp
##################################################################
# Test for strand matches with BED3
##################################################################
echo -e " intersect.t35...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I-^Ichr1^I10^I20^I345.7^Iwhy?^I-" > exp
$BT intersect -a bed6.strand.bed -b bed6.strand2.bed -wa -wb -s | cat -t > obs
check obs exp
##################################################################
# Test for strand matches with BED3
##################################################################
echo -e " intersect.t36...\c"
echo \
"chr1^I10^I20^I345.7^Iwhy?^I-^Ichr1^I11^I21^I345.7^Iwhy?^I+" > exp
$BT intersect -a bed6.strand.bed -b bed6.strand2.bed -wa -wb -S | cat -t > obs
check obs exp
rm obs exp
##################################################################
# Test that intersect of bed query with BAM DB gives Bed output.
##################################################################
echo -e " intersect.t37...\c"
echo \
"chr1 10 20 a1 1 +
chr1 100 200 a2 2 -" > exp
$BT intersect -a a.bed -b a.bam > obs
check obs exp
rm obs exp
##################################################################
# Test that -split works on identical records even if
# -f 1 is ued (100% overlap)
##################################################################
echo -e " intersect.t38...\c"
echo \
"chr1 1 100 A 0 + 1 100 0 2 10,10 0,90 chr1 1 100 B 0 + 1 100 0 2 10,10 0,90 20" > exp
$BT intersect -wao -f 1 -split -a splitBug155_a.bed -b splitBug155_b.bed > obs
check obs exp
rm obs exp
##################################################################
# Test that fractional overlap must be greater than 0.0
##################################################################
echo -e " intersect.t39...\c"
echo \
"***** ERROR: -f must be in the range (0.0, 1.0]. *****" > exp
$BT intersect -a a.bed -b b.bed -f 0.0 2>&1 > /dev/null | cat - | tail -1 > obs
check exp obs
rm exp obs
##################################################################
# Test that fractional overlap must be <= than 1.0
##################################################################
echo -e " intersect.t40...\c"
echo \
"***** ERROR: -f must be in the range (0.0, 1.0]. *****" > exp
$BT intersect -a a.bed -b b.bed -f 1.00001 2>&1 > /dev/null | cat - | tail -1 > obs
check exp obs
rm exp obs
##################################################################
# bug167_strandSweep.bed
##################################################################
echo -e " intersect.t41...\c"
echo \
"22" > exp
$BT intersect -a bug167_strandSweep.bed -b bug167_strandSweep.bed -sorted -s -wa -wb | wc -l | sed 's/^[ \t]*//' > obs
check exp obs
rm exp obs
##################################################################
# bug167_strandSweep.bed
##################################################################
echo -e " intersect.t42...\c"
echo \
"20" > exp
$BT intersect -a bug167_strandSweep.bed -b bug167_strandSweep.bed -sorted -S -wa -wb | wc -l | sed 's/^[ \t]*//' > obs
check exp obs
rm exp obs
rm one_block.bam two_blocks.bam three_blocks.bam
##################################################################
# Bug 187 0 length records
##################################################################
echo -e " intersect.t43...\c"
echo \
"chr7 33059403 33059403 chr7 33059336 33060883 NT5C3A intron 0
chr7 33059403 33059403 chr7 32599076 33069221 NAq intron 0" > exp
$BT intersect -a bug187_a.bed -b bug187_b.bed -wao > obs
check exp obs
rm exp obs
##################################################################
# see that naming conventions are tested with unsorted data.
##################################################################
echo -e " intersect.t44...\c"
echo \
"***** WARNING: File nonamecheck_a.bed has a record where naming convention (leading zero) is inconsistent with other files:
chr1 10 20" > exp
$BT intersect -a nonamecheck_a.bed -b nonamecheck_b.bed 2>&1 > /dev/null | cat - | head -2 > obs
check exp obs
rm exp obs
##################################################################
# see that differently named chroms don't work with -sorted
##################################################################
echo -e " intersect.t45...\c"
echo \
"***** WARNING: File nonamecheck_b.bed has a record where naming convention (leading zero) is inconsistent with other files:
chr01 15 25" > exp
$BT intersect -a nonamecheck_a.bed -b nonamecheck_b.bed -sorted 2>&1 > /dev/null | cat - | head -2 > obs
check exp obs
rm exp obs
##################################################################
# see that differently named chroms -sorted and -nonamecheck
# don't complain with -nonamecheck
##################################################################
echo -e " intersect.t46...\c"
touch exp
$BT intersect -a nonamecheck_a.bed -b nonamecheck_b.bed -sorted -nonamecheck 2>&1 > /dev/null | cat - > obs
check exp obs
rm exp obs
##################################################################
# see that SVLEN in VCF files is treated as zero length
# records when the SV type is an insertion
##################################################################
echo -e " intersect.t47...\c"
echo \
"chr1 1 a G <DEL> 70.90
chr1 1 a G <DEL> 70.90
chr1 4 a G <INS> 70.90" > exp
$BT intersect -a bug223_sv1_a.vcf -b bug223_sv1_b.vcf | cut -f1-6 > obs
check exp obs
rm exp obs
##################################################################
# see that SVLEN in VCF files can handle multiple numbers,
# at end of line, followed by NULL.
##################################################################
echo -e " intersect.t48...\c"
echo \
"chr1 1 a G <DEL> 70.90
chr1 1 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90" > exp
$BT intersect -a bug223_d.vcf -b bug223_d.vcf | cut -f1-6 > obs
check exp obs
rm exp obs
##################################################################
# see that SVLEN in VCF files can handle multiple numbers,
# at end of line, followed by a tab
##################################################################
echo -e " intersect.t49...\c"
echo \
"chr1 1 a G <DEL> 70.90
chr1 1 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90" > exp
$BT intersect -a bug223_e.vcf -b bug223_e.vcf | cut -f1-6 > obs
check exp obs
rm exp obs
##################################################################
# see that SVLEN in VCF files can handle single numbers,
# at end of line, followed by null
##################################################################
echo -e " intersect.t50...\c"
echo \
"chr1 1 a G <DEL> 70.90
chr1 1 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90
chr1 4 a G <DEL> 70.90" > exp
$BT intersect -a bug223_f.vcf -b bug223_f.vcf | cut -f1-6 > obs
check exp obs
rm exp obs
##################################################################
# Bug 44: test that bgzipped vcf file works correctly
# with race condition
##################################################################
echo -e " intersect.t51...\c"
echo \
"MT 2706 . A G 2965 PASS BRF=0.05;FR=1;HP=1;HapScore=1;MGOF=17;MMLQ=30;MQ=62.05;NF=7607;NR=8147;PP=2965;QD=20;SC=AGGCGGGCATAACACAGCAAG;SbPval=0.52;Source=Platypus;TC=15840;TCF=7679;TCR=8161;TR=15754;WE=2749;WS=2693;CSQ=G|ENSG00000198763|ENST00000361453|Transcript|upstream_gene_variant||||||rs2854128|1764|1|MT-ND2|HGNC|7456|protein_coding|YES||ENSP00000355046|NU2M_HUMAN|Q7GXY9_HUMAN&Q5Q3P5_HUMAN&Q14X33_HUMAN&Q14WT3_HUMAN&A6ZH82_HUMAN&A6ZGN8_HUMAN&A6ZGG3_HUMAN|UPI0000000AA2||||||A:0.1656|||||||||||||,G|ENSG00000210151|ENST00000387416|Transcript|downstream_gene_variant||||||rs2854128|4740|-1|MT-TS1|HGNC|7497|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210077|ENST00000387342|Transcript|downstream_gene_variant||||||rs2854128|1036|1|MT-TV|HGNC|7500|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210144|ENST00000387409|Transcript|downstream_gene_variant||||||rs2854128|3120|-1|MT-TY|HGNC|7502|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210117|ENST00000387382|Transcript|upstream_gene_variant||||||rs2854128|2806|1|MT-TW|HGNC|7501|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210107|ENST00000387372|Transcript|downstream_gene_variant||||||rs2854128|1623|-1|MT-TQ|HGNC|7495|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210140|ENST00000387405|Transcript|downstream_gene_variant||||||rs2854128|3055|-1|MT-TC|HGNC|7477|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000211459|ENST00000389680|Transcript|downstream_gene_variant||||||rs2854128|1105|1|MT-RNR1|HGNC|7470|Mt_rRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210082|ENST00000387347|Transcript|non_coding_transcript_exon_variant&non_coding_transcript_variant|1036|||||rs2854128||1|MT-RNR2|HGNC|7471|Mt_rRNA|YES||||||||1/1|||A:0.1656|||||||||||||,G|ENSG00000210127|ENST00000387392|Transcript|downstream_gene_variant||||||rs2854128|2881|-1|MT-TA|HGNC|7475|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000198712|ENST00000361739|Transcript|upstream_gene_variant||||||rs2854128|4880|1|MT-CO2|HGNC|7421|protein_coding|YES||ENSP00000354876|COX2_HUMAN|Q7GXZ8_HUMAN&Q4R1L5_HUMAN&Q4R1L3_HUMAN&Q14XT3_HUMAN&K7WVJ5_HUMAN&H9E7W2_HUMAN&H9E7T7_HUMAN&H9E7P8_HUMAN&H9E7F7_HUMAN&E2DTL8_HUMAN&D3WYY9_HUMAN&D2Y6Y2_HUMAN&D2Y6Y1_HUMAN&B2YKU2_HUMAN|UPI0000000AA4||||||A:0.1656|||||||||||||,G|ENSG00000210049|ENST00000387314|Transcript|downstream_gene_variant||||||rs2854128|2059|1|MT-TF|HGNC|7481|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000198888|ENST00000361390|Transcript|upstream_gene_variant||||||rs2854128|601|1|MT-ND1|HGNC|7455|protein_coding|YES||ENSP00000354687|NU1M_HUMAN|Q85KV6_HUMAN&Q8WCX9_HUMAN&Q5Q757_HUMAN&Q14WI3_HUMAN&G3EBI1_HUMAN&D2Y6X8_HUMAN&D2Y6X6_HUMAN&A6ZHG8_HUMAN|UPI0000000AA1||||||A:0.1656|||||||||||||,G|ENSG00000209082|ENST00000386347|Transcript|upstream_gene_variant||||||rs2854128|524|1|MT-TL1|HGNC|7490|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000198804|ENST00000361624|Transcript|upstream_gene_variant||||||rs2854128|3198|1|MT-CO1|HGNC|7419|protein_coding|YES||ENSP00000354499|COX1_HUMAN|Q957U9_HUMAN&Q7GXY8_HUMAN&M9Z2G2_HUMAN&Q8HBX8_HUMAN&Q5Q1W2_HUMAN&Q4R1L4_HUMAN&Q14XD3_HUMAN&Q14X83_HUMAN&F8U4W0_HUMAN&D3WYY6_HUMAN&D3WYY5_HUMAN&D3WYY4_HUMAN&D2Y6W4_HUMAN&C8YAE4_HUMAN&C3UPN2_HUMAN&B7TCT8_HUMAN&B2Y9D8_HUMAN&A5YMT3_HUMAN&A1XP63_HUMAN&A0S1I7_HUMAN|UPI0000000AA3||||||A:0.1656|||||||||||||,G|ENSG00000210154|ENST00000387419|Transcript|upstream_gene_variant||||||rs2854128|4812|1|MT-TD|HGNC|7478|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210112|ENST00000387377|Transcript|upstream_gene_variant||||||rs2854128|1696|1|MT-TM|HGNC|7492|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210135|ENST00000387400|Transcript|downstream_gene_variant||||||rs2854128|2951|-1|MT-TN|HGNC|7493|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||,G|ENSG00000210100|ENST00000387365|Transcript|upstream_gene_variant||||||rs2854128|1557|1|MT-TI|HGNC|7488|Mt_tRNA|YES|||||||||||A:0.1656|||||||||||||;GR=3.07;PH=0.654;PS=0.002 GT:GL:GOF:GQ:NR:NV 1/1:-300,-298.01,0:3:99:2733:2718 1/1:-300,-298.01,0:17:99:6509:6461 1/1:-300,-298.01,0:2:99:6598:6575 MT 2591 2747 rRNA" > exp
$BT intersect -a bug44_a.vcf.gz -b bug44_b.bed -wa -wb > obs
check exp obs
rm exp obs
##################################################################
# Test basic -f functionality
##################################################################
echo -e " intersect.t52...\c"
echo "chr1 10 12 a1 1 +
chr2 10 12 a2 1 -" > exp
$BT intersect -a x.bed -b y.bed -f 0.2 > obs
check exp obs
rm exp obs
echo -e " intersect.t53...\c"
echo -n "" > exp
$BT intersect -a x.bed -b y.bed -f 0.21 > obs
check exp obs
rm exp obs
##################################################################
# Test basic -F functionality
##################################################################
echo -e " intersect.t54...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -F 0.21 -wa -wb > obs
check exp obs
rm exp obs
##################################################################
# Test basic -f with -F
##################################################################
echo -e " intersect.t55...\c"
echo -n "" > exp
$BT intersect -a x.bed -b y.bed -f 0.21 -F 0.21 -wa -wb > obs
check exp obs
rm exp obs
echo -e " intersect.t56...\c"
echo -n "" > exp
$BT intersect -a x.bed -b y.bed -f 0.21 -r -wa -wb > obs
check exp obs
rm exp obs
echo -e " intersect.t57...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -f 0.19 -r -wa -wb > obs
check exp obs
rm exp obs
echo -e " intersect.t58...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -F 0.50 -wa -wb > obs
check exp obs
rm exp obs
echo -e " intersect.t59...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -f 0.19 -F 0.21 -wa -wb > obs
check exp obs
rm exp obs
echo -e " intersect.t60...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -f 0.19 -F 0.21 -wa -wb > obs
check exp obs
rm exp obs
echo -e " intersect.t61...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -f 0.19 -F 0.50 -wa -wb > obs
check exp obs
rm exp obs
echo -e " intersect.t62...\c"
echo -n "" > exp
$BT intersect -a x.bed -b y.bed -f 0.19 -F 0.51 -wa -wb > obs
check exp obs
rm exp obs
##################################################################
# Test basic -f with -F with BAM
##################################################################
echo -e " intersect.t63...\c"
echo -n "" > exp
$BT intersect -a x.bam -b y.bed -f 0.21 -F 0.21 -wa | $htsutil viewbamrecords > obs
check exp obs
rm exp obs
echo -e " intersect.t64...\c"
echo "a1 0 chr1 11 255 10M * 0 0 * *
a2 16 chr2 11 255 10M * 0 0 * *" > exp
$BT intersect -a x.bam -b y.bed -f 0.19 -F 0.21 -wa | $htsutil viewbamrecords > obs
check exp obs
rm exp obs
echo -e " intersect.t65...\c"
echo "a1 0 chr1 11 255 10M * 0 0 * *
a2 16 chr2 11 255 10M * 0 0 * *" > exp
$BT intersect -a x.bam -b y.bed -f 0.19 -F 0.21 -wa | $htsutil viewbamrecords > obs
check exp obs
rm exp obs
echo -e " intersect.t66...\c"
echo "a1 0 chr1 11 255 10M * 0 0 * *
a2 16 chr2 11 255 10M * 0 0 * *" > exp
$BT intersect -a x.bam -b y.bed -f 0.19 -F 0.50 -wa | $htsutil viewbamrecords > obs
check exp obs
rm exp obs
echo -e " intersect.t67...\c"
echo -n "" > exp
$BT intersect -a x.bam -b y.bed -f 0.19 -F 0.51 -wa | $htsutil viewbamrecords > obs
check exp obs
rm exp obs
##################################################################
# Test basic -f with -F and -e
##################################################################
echo -e " intersect.t68...\c"
echo "chr1 10 20 a1 1 + chr1 8 12 b1 1 +
chr2 10 20 a2 1 - chr2 8 12 b2 1 +" > exp
$BT intersect -a x.bed -b y.bed -f 0.21 -F 0.21 -wa -wb -e > obs
check exp obs
rm exp obs
##################################################################
# Test basic -split with BED12 w/ and w/o trailing commas for blocks
# Issue 366
##################################################################
echo -e " intersect.t69...\c"
echo "chr1 0 45 oneblock_comma 0 + 0 0 0 1 45, 0,
chr1 0 45 oneblock_comma 0 + 0 0 0 1 45, 0,
chr1 0 45 oneblock_comma 0 + 0 0 0 1 45, 0,
chr1 0 45 oneblock_comma 0 + 0 0 0 1 45, 0,
chr1 0 45 oneblock_nocomma 0 + 0 0 0 1 45 0
chr1 0 45 oneblock_nocomma 0 + 0 0 0 1 45 0
chr1 0 45 oneblock_nocomma 0 + 0 0 0 1 45 0
chr1 0 45 oneblock_nocomma 0 + 0 0 0 1 45 0
chr1 0 45 three_blocks_comma 0 + 0 0 0 3 10,10,10, 0,20,40,
chr1 0 45 three_blocks_comma 0 + 0 0 0 3 10,10,10, 0,20,40,
chr1 0 50 three_blocks_comma 0 + 0 0 0 3 10,10,10, 0,20,40,
chr1 0 50 three_blocks_comma 0 + 0 0 0 3 10,10,10, 0,20,40,
chr1 0 45 three_blocks_nocomma 0 + 0 0 0 3 10,10,10 0,20,40
chr1 0 45 three_blocks_nocomma 0 + 0 0 0 3 10,10,10 0,20,40
chr1 0 50 three_blocks_nocomma 0 + 0 0 0 3 10,10,10 0,20,40
chr1 0 50 three_blocks_nocomma 0 + 0 0 0 3 10,10,10 0,20,40" > exp
$BT intersect -a blocks.bed12 -b blocks.bed12 -split > obs
check exp obs
rm exp obs
##################################################################
# Issue 311
##################################################################
echo -e " intersect.t70...\c"
echo "1 31 32 1 32 . A T 0 PASS DP=22" > exp
$BT intersect -a a.issue311.bed -b b.issue311.vcf -wb > obs
check exp obs
rm exp obs
echo -e " intersect.t71...\c"
echo "1 31 32 1 pseudogene exon 32 32 . - . gene_id \"ENSG00000224777\"; transcript_id \"ENST00000424047\"; exon_number \"1\"; gene_name \"OR4F2P\"; transcript_name \"OR4F2P-001\";" > exp
$BT intersect -a a.issue311.bed -b b.issue311.gff -wb > obs
check exp obs
rm exp obs
# GFF ----------
# BED -----------
echo -e " intersect.t72...\c"
echo "1 . . 16 20 . - . ." > exp
$BT intersect -a <(echo -e "1\t.\t.\t10\t20\t.\t-\t.\t.") -b <(echo -e "1\t15\t25") > obs
check exp obs
rm exp obs
# BED ----------
# GFF -----------
echo -e " intersect.t73...\c"
echo "1 15 20" > exp
$BT intersect -a <(echo -e "1\t15\t25") -b <(echo -e "1\t.\t.\t10\t20\t.\t-\t.\t.") > obs
check exp obs
rm exp obs
# GFF ----------
# BED -----------
echo -e " intersect.t74...\c"
echo "1 . . 15 20 . - . ." > exp
$BT intersect -a <(echo -e "1\t.\t.\t15\t25\t.\t-\t.\t.") -b <(echo -e "1\t10\t20") > obs
check exp obs
rm exp obs
# BED ----------
# GFF -----------
echo -e " intersect.t75...\c"
echo "1 15 20" > exp
$BT intersect -a <(echo -e "1\t15\t25") -b <(echo -e "1\t.\t.\t10\t20\t.\t-\t.\t.") > obs
check exp obs
rm exp obs
# GFF ----------
# BED -------------------
echo -e " intersect.t76...\c"
echo "1 . . 15 20 . - . ." > exp
$BT intersect -a <(echo -e "1\t.\t.\t15\t20\t.\t-\t.\t.") -b <(echo -e "1\t10\t25") > obs
check exp obs
rm exp obs
# BED ----------
# GFF --------------------
echo -e " intersect.t77...\c"
echo "1 15 20" > exp
$BT intersect -a <(echo -e "1\t15\t20") -b <(echo -e "1\t.\t.\t10\t25\t.\t-\t.\t.") > obs
check exp obs
rm exp obs
# GFF ----------
# BED -------------------
echo -e " intersect.t78...\c"
echo "1 . . 16 20 . - . ." > exp
$BT intersect -a <(echo -e "1\t.\t.\t10\t25\t.\t-\t.\t.") -b <(echo -e "1\t15\t20") > obs
check exp obs
rm exp obs
# BED ----------
# GFF --------------------
echo -e " intersect.t79...\c"
echo "1 14 20" > exp
$BT intersect -a <(echo -e "1\t10\t25") -b <(echo -e "1\t.\t.\t15\t20\t.\t-\t.\t.") > obs
check exp obs
rm exp obs
# Make sure 1bp of overlap is reported for a VCF SNP and 1-bp overlapping BED.
echo -e " intersect.t80...\c"
echo "chr1 1 . G C . . RS=797045043 chr1 0 1 1" > exp
$BT intersect -a jim.vcf -b jim.bed -wo > obs
check exp obs
rm exp obs
##################################################################
# Issue 316. SVLEN and END
##################################################################
echo -e " intersect.t81...\c"
echo "##fileformat=VCF4.1
#CHROM POS ID REF ALT QUAL FILTER INFO
1 32 . A <DEL> 0 PASS DP=22;END=52" > a
echo "##fileformat=VCF4.1
#CHROM POS ID REF ALT QUAL FILTER INFO
1 52 . A T 0 PASS DP=22;SVLEN=100" > b
echo "1 32 . A <DEL> 0 PASS DP=22;END=52" > exp
$BT intersect -a a -b b > obs
check exp obs
rm exp obs a b
echo -e " intersect.t82...\c"
echo "##fileformat=VCF4.1
#CHROM POS ID REF ALT QUAL FILTER INFO
1 32 . A <DEL> 0 PASS DP=22;END=51" > a
echo "##fileformat=VCF4.1
#CHROM POS ID REF ALT QUAL FILTER INFO
1 52 . A T 0 PASS DP=22;SVLEN=100" > b
echo -n "" > exp
$BT intersect -a a -b b > obs
check exp obs
rm exp obs a b
STARTWD=$(pwd);
for ADDITIONAL_TEST in \
new_test-intersect.sh \
multi_intersect/test-multi_intersect.sh \
sortAndNaming/test-sort-and-naming.sh \
; do
# In case the cd operation fails, combine it with the script execution
cd $(dirname "${STARTWD}/${ADDITIONAL_TEST}") \
&& bash $(basename "${STARTWD}/${ADDITIONAL_TEST}") \
|| FAILURES=$(expr $FAILURES + 1);
done
[[ $FAILURES -eq 0 ]] || exit 1;
|