1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180
|
# -*-Perl-*-
# $Id: Index.t,v 1.28 2003/06/10 21:34:57 jason Exp $
use strict;
my $exit;
BEGIN {
eval { require Test; };
use vars qw($NUMTESTS);
$NUMTESTS = 32;
if( $@ ) {
use lib 't';
}
use Test;
$exit = 0;
eval { require Bio::Index::Fasta;
require Bio::Index::SwissPfam;
require Bio::Index::EMBL;
require Bio::Index::GenBank;
require Bio::Index::Swissprot;
require DB_File;
};
if( $@ ) {
$exit = 1;
}
plan tests => $NUMTESTS;
}
END {
foreach ( $Test::ntest..$NUMTESTS) {
skip('DB_File not loaded because one or more of Storable, DB_File or File::Temp not installed',1);
}
foreach my $root ( qw( Wibbl Wibbl2 Wibbl3 Wibbl4 Wibbl5
) ) {
if( -e "$root" ) { unlink $root;}
if( -e "$root.pag") { unlink "$root.pag";}
if( -e "$root.dir") { unlink "$root.dir";}
}
}
exit(0) if $exit;
use Bio::Root::IO;
use Bio::DB::InMemoryCache;
eval { require Bio::DB::FileCache };
use vars qw ($dir);
($Bio::Root::IO::FILESPECLOADED && File::Spec->can('cwd') &&
($dir = File::Spec->cwd) ) ||
($dir = `pwd`) || ($dir = '.');
chomp( $dir );
{
my $ind = Bio::Index::Fasta->new(-filename => 'Wibbl',
-write_flag => 1,
-verbose => 0);
$ind->make_index(Bio::Root::IO->catfile($dir,"t","data","multifa.seq"));
$ind->make_index(Bio::Root::IO->catfile($dir,"t","data","seqs.fas"));
$ind->make_index(Bio::Root::IO->catfile($dir,"t","data","multi_1.fa"));
}
ok ( -e "Wibbl" || -e "Wibbl.pag" );
{
my %t_seq = (
HSEARLOBE => 321,
HSMETOO => 134,
MMWHISK => 62,
'gi|238775|bbs|65126' => 70,
);
my $ind = Bio::Index::Abstract->new(-FILENAME => 'Wibbl');
my $ok_3 = 1;
while (my($name, $length) = each %t_seq) {
my $seq = $ind->fetch($name);
if( defined($seq) and $seq->isa('Bio::SeqI') ) {
my $r_length = $seq->length;
unless ($r_length == $length) {
warn "$name - retrieved length '$r_length' doesn't match known length '$length'\n";
$ok_3 = 0;
}
} else {
warn "Didn't get sequence '$name' from index\n";
$ok_3 = 0;
}
}
ok $ok_3;
my $stream = $ind->get_PrimarySeq_stream();
my $ok_4 = 1;
while( my $seq2 = $stream->next_seq ) {
unless ($seq2->isa('Bio::PrimarySeqI')) {
$ok_4 = 0;
last; # no point continuing...
}
}
ok $ok_4;
}
{
my $ind = Bio::Index::SwissPfam->new(-filename=>'Wibbl2',
-write_flag=>1);
$ind->make_index(Bio::Root::IO->catfile($dir,"t","data","swisspfam.data"));
ok ( -e "Wibbl2" || -e "Wibbl2.pag" );
}
{
my $ind = Bio::Index::EMBL->new(-filename=>'Wibbl3',
-write_flag=>1);
$ind->make_index(Bio::Root::IO->catfile($dir,"t","data","test.embl"));
ok ( -e "Wibbl3" || -e "Wibbl3.pag" );
ok $ind->fetch('AL031232')->length, 4870;
}
{
my $ind = Bio::Index::Swissprot->new(-filename=>'Wibbl4',
-write_flag=>1);
$ind->make_index(Bio::Root::IO->catfile($dir,"t","data","roa1.swiss"));
ok ( -e "Wibbl4" || -e "Wibbl4.pag" );
ok ($ind->fetch('P09651')->display_id(), 'ROA1_HUMAN');
}
my $gb_ind;
{
$gb_ind = Bio::Index::GenBank->new(-filename=>'Wibbl5',
-write_flag=>1,
-verbose => 0);
$gb_ind->make_index(Bio::Root::IO->catfile($dir,"t","data","roa1.genbank"));
ok ( -e "Wibbl5" || -e "Wibbl5.pag" );
my $seq =$gb_ind->fetch('AI129902');
ok ($seq->length, 37);
ok ($seq->species->binomial, 'Homo sapiens');
}
my $cache = Bio::DB::InMemoryCache->new( -seqdb => $gb_ind );
ok ( $cache->get_Seq_by_id('AI129902') );
if (Bio::DB::FileCache->can('new')) {
$cache = Bio::DB::FileCache->new(-seqdb => $gb_ind,
-keep => 1,
-file => 'filecache.idx');
my $seq = $cache->get_Seq_by_id('AI129902');
ok ( $seq);
ok ( $seq->length, 37);
ok ( lc($seq->seq()), 'ctccgcgccaactccccccaccccccccccacacccc');
my ( $f1 ) = $seq->get_SeqFeatures();
ok ( ($f1->each_tag_value('sex'))[0], 'female');
ok ( ($f1->each_tag_value('lab_host'))[0], 'DH10B');
my $species = $seq->species;
ok( $species );
ok( $species->binomial, 'Homo sapiens');
ok( $species->species(), 'sapiens');
ok( $species->genus(), 'Homo');
ok ($species->common_name(), 'human');
$cache = undef;
$cache = Bio::DB::FileCache->new(-seqdb => $gb_ind,
-keep => 0,
-file => 'filecache.idx');
$seq = $cache->get_Seq_by_id('AI129902');
ok ( $seq);
ok ( $seq->length, 37);
ok ( lc($seq->seq()), 'ctccgcgccaactccccccaccccccccccacacccc');
( $f1 ) = $seq->get_SeqFeatures();
ok ( ($f1->each_tag_value('sex'))[0], 'female');
ok ( ($f1->each_tag_value('lab_host'))[0], 'DH10B');
$species = $seq->species;
ok( $species );
ok( $species->binomial, 'Homo sapiens');
ok( $species->species(), 'sapiens');
ok( $species->genus(), 'Homo');
ok ($species->common_name(), 'human');
} else {
skip('Bio::DB::FileCache not loaded because one or more of Storable, DB_File or File::Temp not installed',1);
}
|