1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71
|
# -*-Perl-*-
## Bioperl Test Harness Script for Modules
## $Id: seqfeaturePrimer.t,v 1.3 2002/10/30 14:21:59 heikki Exp $
#
# modeled after the t/Allele.t test script
use strict;
#use Dumpvalue qw(dumpValue);
BEGIN {
# to handle systems with no installed Test module
# we include the t dir (where a copy of Test.pm is located)
# as a fallback
eval { require Test; };
if( $@ ) {
use lib 't';
}
use Test;
plan tests => 8;
}
my $DEBUG = $ENV{'BIOPERLDEBUG'};
#my $dumper = new Dumpvalue();
print("Checking to see if Bio::SeqFeature::Primer is available.\n") if $DEBUG;
use Bio::SeqFeature::Primer;
ok(1);
print("Checking to see if a BSFP object can be created:\n") if $DEBUG;
# yes sure, but first scope a few variables
my $seqsequence = "gcatcgatctagctagcta";
my $primersequence = "aaaaaacgatcgatcgtagctagct";
my $seqname = "chads_nifty_sequence";
my $primername = "chads_nifty_primer";
# ok, and what about variables governing where the feature is located?
# check the primer3docs, luke...
# TARGET=513,26
# PRIMER_FIRST_BASE_INDEX=1
# PRIMER_LEFT=484,20
print("Checking to see if the BSFP object can be constructed with a bio::seq object\n") if $DEBUG;
my $seq = new Bio::Seq( -seq => $seqsequence, -id =>$seqname);
my $bsfp_seq = new Bio::SeqFeature::Primer( -sequence => $seq,
-TARGET => '5,3' );
ok(ref($bsfp_seq) eq "Bio::SeqFeature::Primer");
print("Checking to see if the BSFP object can be constructed with scalars\n") if $DEBUG;
my $bsfp_scalar = new Bio::SeqFeature::Primer( -sequence => $primersequence,
-id => $primername,
-TARGET => '5,3' );
ok(ref($bsfp_scalar) eq "Bio::SeqFeature::Primer");
print("Checking to see that seq() returns a Bio::Seq object and that the object is the right one.\n") if $DEBUG;
ok(ref($bsfp_scalar->seq()) eq "Bio::Seq");
print("First for the scalar-ily created one.\n") if $DEBUG;
print("id ok?\n") if $DEBUG;
ok($bsfp_scalar->seq()->id() eq $primername);
print("sequence ok?\n") if $DEBUG;
ok($bsfp_scalar->seq()->seq() eq $primersequence);
print("Now for the seq-ily created one\n") if $DEBUG;
print("id ok?\n") if $DEBUG;
ok($bsfp_seq->seq()->display_id() eq $seqname);
print("sequence ok?\n") if $DEBUG;
ok($bsfp_seq->seq()->seq() eq $seqsequence);
print("Here is the structure of the BSFP_scalar object:\n") if $DEBUG;
# $dumper->dumpValue($bsfp_scalar);
|