1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634
|
# $Id: StandAloneBlast.pm 16123 2009-09-17 12:57:27Z cjfields $
#
# BioPerl module for Bio::Tools::Run::StandAloneBlast
#
# Copyright Peter Schattner
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Tools::Run::StandAloneBlast - Object for the local execution
of the NCBI BLAST program suite (blastall, blastpgp, bl2seq).
There is experimental support for WU-Blast and NCBI rpsblast.
=head1 SYNOPSIS
# Local-blast "factory object" creation and blast-parameter
# initialization:
@params = (-database => 'swissprot', -outfile => 'blast1.out');
$factory = Bio::Tools::Run::StandAloneBlast->new(@params);
# Blast a sequence against a database:
$str = Bio::SeqIO->new(-file=>'t/amino.fa', -format => 'Fasta');
$input = $str->next_seq();
$input2 = $str->next_seq();
$blast_report = $factory->blastall($input);
# Run an iterated Blast (psiblast) of a sequence against a database:
$factory->j(3); # 'j' is blast parameter for # of iterations
$factory->outfile('psiblast1.out');
$factory = Bio::Tools::Run::StandAloneBlast->new(@params);
$blast_report = $factory->blastpgp($input);
# Use blast to align 2 sequences against each other:
$factory = Bio::Tools::Run::StandAloneBlast->new(-outfile => 'bl2seq.out');
$factory->bl2seq($input, $input2);
# Experimental support for WU-Blast 2.0
my $factory = Bio::Tools::Run::StandAloneBlast->new(-program =>"wublastp",
-database =>"swissprot",
-e => 1e-20);
my $blast_report = $factory->wublast($seq);
# Experimental support for NCBI rpsblast
my $factory = Bio::Tools::Run::StandAloneBlast->new(-db => 'CDD/Cog',
-expect => 0.001);
$factory->F('T'); # turn on SEG filtering of query sequence
my $blast_report = $factory->rpsblast($seq);
# Use the experimental fast Blast parser, 'blast_pull'
my $factory = Bio::Tools::Run::StandAloneBlast->new(-_READMETHOD =>'blast_pull',
@other_params);
# Various additional options and input formats are available,
# see the DESCRIPTION section for details.
=head1 DESCRIPTION
This DESCRIPTION only documents Bio::Tools::Run::StandAloneBlast: - a
Bioperl object for running the NCBI standAlone BLAST package. Blast
itself, is a large & complex program - for more information regarding
BLAST, please see the BLAST documentation which accompanies the BLAST
distribution. BLAST is available from ftp://ncbi.nlm.nih.gov/blast/.
A source of confusion in documenting a BLAST interface is that the
term "program" is used in - at least - three different ways in the
BLAST documentation. In this DESCRIPTION, "program" will refer to the
BLAST routine set by the BLAST C<-p> parameter that can be set to blastn,
blastp, tblastx etc. We will use the term Blast "executable" to refer
to the various different executable files that may be called - ie.
blastall, blastpgp or bl2seq. In addition, there are several BLAST
capabilities, which are also referred to as "programs", and are
implemented by using specific combinations of BLAST executables,
programs and parameters. They will be referred by their specific
names - eg PSIBLAST and PHIBLAST.
Before running StandAloneBlast it is necessary: to install BLAST
on your system, to edit set the environmental variable $BLASTDIR
or your $PATH variable to point to the BLAST directory, and to
ensure that users have execute privileges for the BLAST program.
If the databases which will be searched by BLAST are located in the
data subdirectory of the blast program directory (the default
installation location), StandAloneBlast will find them; however,
if the database files are located in any other location, environmental
variable $BLASTDATADIR will need to be set to point to that directory.
The use of the StandAloneBlast module is as follows: Initially, a
local blast "factory object" is created. The constructor may be passed
an optional array of (non-default) parameters to be used by the
factory, eg:
@params = (-program => 'blastn', -database => 'ecoli.nt');
$factory = Bio::Tools::Run::StandAloneBlast->new(@params);
Any parameters not explicitly set will remain as the defaults of the
BLAST executable. Note each BLAST executable has somewhat different
parameters and options. See the BLAST Documentation for a description
or run the BLAST executable from the command line followed solely with
a "-" to see a list of options and default values for that executable;
eg E<gt>blastall -.
BLAST parameters can be changed and/or examined at any time after the
factory has been created. The program checks that any
parameter/switch being set/read is valid. Except where specifically
noted, StandAloneBlast uses the same single-letter, case-sensitive
parameter names as the actual blast program. Currently no checks are
included to verify that parameters are of the proper type (e.g. string
or numeric) or that their values are within the proper range.
As an example, to change the value of the Blast parameter 'e' ('e' is
the parameter for expectation-value cutoff)
$expectvalue = 0.01;
$factory->e($expectvalue);
Note that for improved script readibility one can modify the name of
the (ncbi) BLAST parameters as desired as long as the initial letter (and
case) of the parameter are preserved, e.g.:
$factory->expectvalue($expectvalue);
Unfortunately, some of the BLAST parameters are not the single
letter one might expect (eg "iteration round" in blastpgp is 'j').
Again one can check by using, for example:
> blastpgp -
Wublast parameters need to be complete (ie. don't truncate them to their
first letter), but are case-insensitive.
Once the factory has been created and the appropriate parameters set,
one can call one of the supported blast executables. The input
sequence(s) to these executables may be fasta file(s) as described in
the BLAST documentation.
$inputfilename = 't/testquery.fa';
$blast_report = $factory->blastall($inputfilename);
In addition, sequence input may be in the form of either a Bio::Seq
object or (a reference to) an array of Bio::Seq objects, e.g.:
$input = Bio::Seq->new(-id => "test query",
-seq => "ACTACCCTTTAAATCAGTGGGGG");
$blast_report = $factory->blastall($input);
NOTE: Use of the BPlite method has been deprecated and is no longer supported.
For blastall and non-psiblast blastpgp runs, report object is aL<Bio::SearchIO>
object, selected by the user with the parameter _READMETHOD. The leading
underscore is needed to distinguish this option from options which are passed to
the BLAST executable. The default parser is Bio::SearchIO::blast. In any case,
the "raw" blast report is also available. The filename is set by the 'outfile'
parameter and has the default value of "blastreport.out".
For psiblast execution in the BLAST "jumpstart" mode, the program must
be passed (in addition to the query sequence itself) an alignment
containing the query sequence (in the form of a SimpleAlign object) as
well as a "mask" specifying at what residues position-specific scoring
matrices (PSSMs) are to used and at what residues default scoring
matrices (eg BLOSUM) are to be used. See psiblast documentation for
more details. The mask itself is a string of 0's and 1's which is the
same length as each sequence in the alignment and has a "1" at
locations where (PSSMs) are to be used and a "0" at all other
locations. So for example:
$str = Bio::AlignIO->new(-file => "cysprot.msf",
-format => 'msf');
$aln = $str->next_aln();
$len = $aln->length_aln();
$mask = '1' x $len;
# simple case where PSSM's to be used at all residues
$report = $factory->blastpgp("cysprot1.fa", $aln, $mask);
For bl2seq execution, StandAloneBlast.pm can be combined with
AlignIO.pm to directly produce a SimpleAlign object from the alignment
of the two sequences produced by bl2seq as in:
# Get 2 sequences
$str = Bio::SeqIO->new(-file=>'t/amino.fa' , -format => 'Fasta');
my $seq3 = $str->next_seq();
my $seq4 = $str->next_seq();
# Run bl2seq on them
$factory = Bio::Tools::Run::StandAloneBlast->new(-program => 'blastp',
-outfile => 'bl2seq.out');
my $bl2seq_report = $factory->bl2seq($seq3, $seq4);
# Use AlignIO.pm to create a SimpleAlign object from the bl2seq report
$str = Bio::AlignIO->new(-file=> 'bl2seq.out',-format => 'bl2seq');
$aln = $str->next_aln();
For more examples of syntax and use of StandAloneBlast.pm, the user is
encouraged to run the scripts standaloneblast.pl in the bioperl
examples/tools directory and StandAloneBlast.t in the bioperl t/
directory.
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via
the web:
http://bugzilla.open-bio.org/
=head1 AUTHOR - Peter Schattner
Email schattner at alum.mit.edu
=head1 MAINTAINER - Torsten Seemann
Email torsten at infotech.monash.edu.au
=head1 CONTRIBUTORS
Sendu Bala bix@sendu.me.uk (reimplementation)
=head1 APPENDIX
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
=cut
package Bio::Tools::Run::StandAloneBlast;
use strict;
use Bio::Root::IO;
use Bio::Seq;
use Bio::SeqIO;
use Bio::SearchIO;
use File::Spec;
use base qw(Bio::Tools::Run::WrapperBase Bio::Factory::ApplicationFactoryI);
our $AUTOLOAD;
our $DEFAULTBLASTTYPE = 'NCBI';
our $DEFAULTREADMETHOD = 'BLAST';
# If local BLAST databases are not stored in the standard
# /data directory, the variable BLASTDATADIR will need to be
# set explicitly
our $DATADIR = $ENV{'BLASTDATADIR'} || $ENV{'BLASTDB'};
if (! defined $DATADIR && defined $ENV{'BLASTDIR'}) {
my $dir = Bio::Root::IO->catfile($ENV{'BLASTDIR'}, 'data');
if (-d $dir) {
$DATADIR = $dir;
}
elsif ($ENV{'BLASTDIR'} =~ /bin/) {
$dir = $ENV{'BLASTDIR'};
$dir =~ s/bin/data/;
$DATADIR = $dir if -d $dir;
}
}
=head2 new
Title : new
Usage : my $obj = Bio::Tools::Run::StandAloneBlast->new();
Function: Builds a newBio::Tools::Run::StandAloneBlast object
Returns : Bio::Tools::Run::StandAloneNCBIBlast or StandAloneWUBlast
Args : -quiet => boolean # make program execution quiet
-_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
# the parsing method, case insensitive
Essentially all BLAST parameters can be set via StandAloneBlast.pm.
Some of the most commonly used parameters are listed below. All
parameters have defaults and are optional except for -p in those programs that
have it. For a complete listing of settable parameters, run the relevant
executable BLAST program with the option "-" as in blastall -
Note that the input paramters (-i, -j, -input) should not be set directly by
you: this module sets them when you call one of the executable methods.
Blastall
-p Program Name [String]
Input should be one of "blastp", "blastn", "blastx",
"tblastn", or "tblastx".
-d Database [String] default = nr
The database specified must first be formatted with formatdb.
Multiple database names (bracketed by quotations) will be accepted.
An example would be -d "nr est"
-e Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
-S Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer]
default = 3
Blastpgp (including Psiblast)
-j is the maximum number of rounds (default 1; i.e., regular BLAST)
-h is the e-value threshold for including sequences in the
score matrix model (default 0.001)
-c is the "constant" used in the pseudocount formula specified in the paper (default 10)
-B Multiple alignment file for PSI-BLAST "jump start mode" Optional
-Q Output File for PSI-BLAST Matrix in ASCII [File Out] Optional
rpsblast
-d Database [String] default = (none - you must specify a database)
The database specified must first be formatted with formatdb.
Multiple database names (bracketed by quotations) will be accepted.
An example would be -d "Cog Smart"
-e Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
Bl2seq
-p Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String]
default = blastp
-o alignment output file [File Out] default = stdout
-e Expectation value (E) [Real] default = 10.0
-S Query strands to search against database (blastn only). 3 is both, 1 is top, 2 is bottom [Integer]
default = 3
WU-Blast
-p Program Name [String]
Input should be one of "wublastp", "wublastn", "wublastx",
"wutblastn", or "wutblastx".
-d Database [String] default = nr
The database specified must first be formatted with xdformat.
-E Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
=cut
sub new {
my ($caller, @args) = @_;
my $class = ref($caller) || $caller;
# Because of case-sensitivity issues, ncbi and wublast methods are
# mutually exclusive. We can't load ncbi methods if we start with wublast
# (and vice versa) since wublast e() and E() should be the same thing,
# whilst they must be different things in ncbi blast.
#
# Solution: split StandAloneBlast out into two more modules for NCBI and WU
if ($class =~ /NCBI|WU/) {
return $class->SUPER::new(@args);
}
my %args = @args;
my $blasttype = $DEFAULTBLASTTYPE;
while (my ($attr, $value) = each %args) {
if ($attr =~/^-?\s*program\s*$|^-?p$/) {
if ($value =~ /^wu*/) {
$blasttype = 'WU';
}
}
}
my $module = "Bio::Tools::Run::StandAlone${blasttype}Blast";
Bio::Root::Root->_load_module($module);
return $module->new(@args);
}
=head2 executable
Title : executable
Usage : my $exe = $blastfactory->executable('blastall');
Function: Finds the full path to the executable
Returns : string representing the full path to the exe
Args : [optional] name of executable to set path to
[optional] boolean flag whether or not warn when exe is not found
=cut
sub executable {
my ($self, $exename, $exe, $warn) = @_;
$exename = 'blastall' unless (defined $exename || $self =~ /WUBlast/);
$self->program_name($exename);
if( defined $exe && -x $exe ) {
$self->{'_pathtoexe'}->{$exename} = $exe;
}
unless( defined $self->{'_pathtoexe'}->{$exename} ) {
my $f = $self->program_path($exename);
$exe = $self->{'_pathtoexe'}->{$exename} = $f if(-e $f && -x $f );
# This is how I meant to split up these conditionals --jason
# if exe is null we will execute this (handle the case where
# PROGRAMDIR pointed to something invalid)
unless( $exe ) { # we didn't find it in that last conditional
if( ($exe = $self->io->exists_exe($exename)) && -x $exe ) {
$self->{'_pathtoexe'}->{$exename} = $exe;
}
else {
$self->warn("Cannot find executable for $exename") if $warn;
$self->{'_pathtoexe'}->{$exename} = undef;
}
}
}
return $self->{'_pathtoexe'}->{$exename};
}
=head2 program_dir
Title : program_dir
Usage : my $dir = $factory->program_dir();
Function: Abstract get method for dir of program.
Returns : string representing program directory
Args : none
=cut
sub program_dir {
my $self = shift;
$self =~ /NCBIBlast/? $ENV{'BLASTDIR'}: $ENV{'WUBLASTDIR'};
}
sub program_name {
my $self = shift;
if (@_) { $self->{program_name} = shift }
return $self->{program_name} || '';
}
sub program {
my $self = shift;
if( wantarray ) {
return ($self->executable, $self->p());
} else {
return $self->executable(@_);
}
}
=head2 _setinput
Title : _setinput
Usage : Internal function, not to be called directly
Function: Create input file(s) for Blast executable
Example :
Returns : name of file containing Blast data input
Args : Seq object reference or input file name
=cut
sub _setinput {
my ($self, $executable, $input1, $input2) = @_;
my ($seq, $temp, $infilename1, $infilename2,$fh ) ;
# If $input1 is not a reference it better be the name of a file with
# the sequence/ alignment data...
$self->io->_io_cleanup();
SWITCH: {
unless (ref $input1) {
$infilename1 = (-e $input1) ? $input1 : 0 ;
last SWITCH;
}
# $input may be an array of BioSeq objects...
if (ref($input1) =~ /ARRAY/i ) {
($fh,$infilename1) = $self->io->tempfile();
$temp = Bio::SeqIO->new(-fh=> $fh, -format => 'fasta');
foreach $seq (@$input1) {
unless ($seq->isa("Bio::PrimarySeqI")) {return 0;}
$seq->display_id($seq->display_id);
$temp->write_seq($seq);
}
close $fh;
$fh = undef;
last SWITCH;
}
# $input may be a single BioSeq object...
elsif ($input1->isa("Bio::PrimarySeqI")) {
($fh,$infilename1) = $self->io->tempfile();
# just in case $input1 is taken from an alignment and has spaces (ie
# deletions) indicated within it, we have to remove them - otherwise
# the BLAST programs will be unhappy
my $seq_string = $input1->seq();
$seq_string =~ s/\W+//g; # get rid of spaces in sequence
$input1->seq($seq_string);
$temp = Bio::SeqIO->new(-fh=> $fh, '-format' => 'fasta');
$temp->write_seq($input1);
close $fh;
undef $fh;
last SWITCH;
}
$infilename1 = 0; # Set error flag if you get here
}
unless ($input2) { return $infilename1; }
SWITCH2: {
unless (ref $input2) {
$infilename2 = (-e $input2) ? $input2 : 0 ;
last SWITCH2;
}
if ($input2->isa("Bio::PrimarySeqI") && $executable eq 'bl2seq' ) {
($fh,$infilename2) = $self->io->tempfile();
$temp = Bio::SeqIO->new(-fh=> $fh, '-format' => 'Fasta');
$temp->write_seq($input2);
close $fh;
undef $fh;
last SWITCH2;
}
# Option for using psiblast's pre-alignment "jumpstart" feature
elsif ($input2->isa("Bio::SimpleAlign") && $executable eq 'blastpgp' ) {
# a bit of a lie since it won't be a fasta file
($fh,$infilename2) = $self->io->tempfile();
# first we retrieve the "mask" that determines which residues should
# by scored according to their position and which should be scored
# using the non-position-specific matrices
my @mask = split("", shift ); # get mask
# then we have to convert all the residues in every sequence to upper
# case at the positions that we want psiblast to use position specific
# scoring
foreach $seq ( $input2->each_seq() ) {
my @seqstringlist = split("",$seq->seq());
for (my $i = 0; $i < scalar(@mask); $i++) {
unless ( $seqstringlist[$i] =~ /[a-zA-Z]/ ) {next}
$seqstringlist[$i] = $mask[$i] ? uc $seqstringlist[$i]: lc $seqstringlist[$i] ;
}
my $newseqstring = join("", @seqstringlist);
$seq->seq($newseqstring);
}
# Now we need to write out the alignment to a file
# in the "psi format" which psiblast is expecting
$input2->map_chars('\.','-');
$temp = Bio::AlignIO->new(-fh=> $fh, '-format' => 'psi');
$temp->write_aln($input2);
close $fh;
undef $fh;
last SWITCH2;
}
$infilename2 = 0; # Set error flag if you get here
}
return ($infilename1, $infilename2);
}
=head1 Bio::Tools::Run::WrapperBase methods
=cut
=head2 no_param_checks
Title : no_param_checks
Usage : $obj->no_param_checks($newval)
Function: Boolean flag as to whether or not we should
trust the sanity checks for parameter values
Returns : value of no_param_checks
Args : newvalue (optional)
=cut
=head2 save_tempfiles
Title : save_tempfiles
Usage : $obj->save_tempfiles($newval)
Function:
Returns : value of save_tempfiles
Args : newvalue (optional)
=cut
=head2 outfile_name
Title : outfile_name
Usage : my $outfile = $tcoffee->outfile_name();
Function: Get/Set the name of the output file for this run
(if you wanted to do something special)
Returns : string
Args : [optional] string to set value to
=cut
=head2 tempdir
Title : tempdir
Usage : my $tmpdir = $self->tempdir();
Function: Retrieve a temporary directory name (which is created)
Returns : string which is the name of the temporary directory
Args : none
=cut
=head2 cleanup
Title : cleanup
Usage : $tcoffee->cleanup();
Function: Will cleanup the tempdir directory after a PAML run
Returns : none
Args : none
=cut
=head2 io
Title : io
Usage : $obj->io($newval)
Function: Gets a Bio::Root::IO object
Returns : Bio::Root::IO
Args : none
=cut
1;
|