1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530
|
# $Id: Results.pm 16123 2009-09-17 12:57:27Z cjfields $
#
# BioPerl module for Bio::Tools::Spidey::Results
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Ryan Golhar <golharam@umdnj.edu>
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::Tools::Spidey::Results - Results of a Spidey run
=head1 SYNOPSIS
use Bio::Tools::Spidey::Results;
my $spidey = Bio::Tools::Spidey::Results->new(-file => 'result.spidey' );
# or
my $spidey = Bio::Tools::Spidey::Results->new( -fh => \*INPUT );
# get the exons before doing anything else
my $exonset = $spidey->next_exonset();
# parse the results
my @exons = $exonset->sub_SeqFeature();
print "Total no of Exons: ", scalar(@exons), "\n";
print "Genomic sequence length: ", $spidey->genomic_dna_length(), "\n";
# $exonset is-a Bio::SeqFeature::Generic with Bio::Tools::Spidey::Exons
# as sub features
print "Delimited on sequence ", $exonset->seq_id(), " from ",
$exonset->start(), " to ", $exonset->end(), "\n";
foreach my $exon ( $exonset->sub_SeqFeature() ) {
# $exon is-a Bio::SeqFeature::FeaturePair
print "Exon from ", $exon->start, " to ", $exon->end,
" on strand ", $exon->strand(), "\n";
# you can get out what it matched using the est_hit attribute
my $homol = $exon->est_hit();
print "Matched to sequence ", $homol->seq_id,
" at ", $homol->start," to ", $homol->end, "\n";
}
# essential if you gave a filename at initialization (otherwise
# the file stays open)
$spidey->close();
=head1 DESCRIPTION
The spidey module provides a parser and results object for spidey
output. The spidey results are specialised types of SeqFeatures,
meaning you can add them to AnnSeq objects fine, and manipulate them
in the "normal" seqfeature manner.
The spidey Exon objects are Bio::SeqFeature::FeaturePair inherited
objects. The $esthit = $exon-E<gt>est_hit() is the alignment as a
feature on the matching object (normally, a cDNA), in which the
start/end points are where the hit lies.
To make this module work sensibly you need to run
spidey -i genomic.fasta -m cDNA.fasta
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
web:
http://bugzilla.open-bio.org/
=head1 AUTHOR - Ryan Golhar
Email golharam@umdnj.edu
=head1 APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Tools::Spidey::Results;
use strict;
use File::Basename;
use Bio::Root::Root;
use Bio::Tools::Spidey::Exon;
use base qw(Bio::Tools::AnalysisResult);
sub _initialize_state {
my($self,@args) = @_;
# call the inherited method first
my $make = $self->SUPER::_initialize_state(@args);
# my ($est_is_first) = $self->_rearrange([qw(ESTFIRST)], @args);
# delete($self->{'_est_is_first'});
# $self->{'_est_is_first'} = $est_is_first if(defined($est_is_first));
$self->analysis_method("Spidey");
}
=head2 analysis_method
Usage : $spidey->analysis_method();
Purpose : Inherited method. Overridden to ensure that the name matches
/Spidey/i.
Returns : String
Argument : n/a
=cut
#-------------
sub analysis_method {
#-------------
my ($self, $method) = @_;
if($method && ($method !~ /Spidey/i)) {
$self->throw("method $method not supported in " . ref($self));
}
return $self->SUPER::analysis_method($method);
}
=head2 parse_next_alignment
Title : parse_next_alignment
Usage : @exons = $spidey_result->parse_next_alignment;
foreach $exon (@exons) {
# do something
}
Function: Parses the next alignment of the Spidey result file and returns the
found exons as an array of Bio::Tools::Spidey::Exon objects. Call
this method repeatedly until an empty array is returned to get the
results for all alignments.
Example :
Returns : An array of Bio::Tools::Spidey::Exon objects
Args :
=cut
sub parse_next_alignment {
my ($self) = @_;
# for strand 1 = plus, -1 = minus
my ($started,$version,$strand, $exoncount) = (0,0,0,-1);
my (%seq1props,%seq2props,@exons);
# we refer to the properties of each seq by reference
while(defined($_ = $self->_readline())) {
chomp;
#
# bascially, parse a Spidey result...
#
# matches: --SPIDEY version 1.40--
if( /^--SPIDEY\s+version\s+(\d+\.\d+)--/) {
if($started) {
$self->_pushback($_);
return \@exons;
}
$version = $1;
if ($version != 1.40) {
$self->throw("Spidey parser only designed to work with Spidey v1.40\n");
}
$started = 1;
} elsif (/^Genomic:\s+(\S+)\s.*,\s+(\d+)\sbp$/ ) {
# matches: Genomic: lcl|some_name other information, 1234 bp
# $seq1props{'filename'} = $1;
$seq1props{'seqname'} = $1;
$seq1props{'length'} = $2;
$self->genomic_dna_length($seq1props{'length'});
} elsif( /^mRNA:\s+(\S+)\s.*,(?:\s+mRNA\s+sequence,)?\s(\d+)\sbp$/ ) {
# matches: mRNA:
# $seq2props{'filename'} = $1;
$seq2props{'seqname'} = $1;
$seq2props{'length'} = $2;
} elsif( /^Strand:/ ) {
if (/plus/) {
$strand = 1;
} else {
$strand = -1;
}
} elsif( /^Number of exons: (\d+)/ ) {
$exoncount = $1;
my ($genomic_start, $genomic_stop, $cdna_start, $cdna_stop,
$id, $mismatches, $gaps, $splice_donor,
$splice_acceptor, $uncertain);
# the next $exoncount lines contains information
# about the matches of each exon. we should parse
# this information here
for (my $ec = 1; $ec <= $exoncount; $ec++) {
if (defined($_ = $self->_readline())) {
chomp;
if (/^Exon\s$ec[\(\)-]*:\s(\d+)-(\d+)\s\(gen\)\s+(\d+)-(\d+)\s\(mRNA\)\s+id\s([\d\.inf-]+)%\s+mismatches\s(\d+)\s+gaps\s(\d+)\s+splice\ssite\s\(d\s+a\):\s(\d+)\s+(\d+)\s*(\w*)/) {
$genomic_start = $1;
$genomic_stop = $2;
$cdna_start = $3;
$cdna_stop = $4;
$id = $5;
$mismatches = $6;
$gaps = $7;
$splice_donor = $8;
$splice_acceptor = $9;
$uncertain = $10;
} else {
$self->throw( "Failed to match anything:\n$_\n");
}
my $exon = Bio::Tools::Spidey::Exon->new
(-start => $genomic_start,
-end => $genomic_stop,
-strand => $strand);
$exon->seq_id($seq1props{'seqname'});
# feature1 is supposed to be initialized to a Similarity object, but we provide a safety net
if ($exon->feature1->can('seqlength')) {
$exon->feature1->seqlength($seq1props{'length'});
} else {
$exon->feature1->add_tag_value('seqlength', $seq1props{'length'});
}
# create and initialize the feature wrapping the 'hit' (the cDNA)
my $fea2 = Bio::SeqFeature::Similarity->new
(-start => $cdna_start,
-end => $cdna_stop,
-strand => $strand,
-seq_id => $seq2props{'seqname'},
-primary => "aligning_cDNA");
$fea2->seqlength($seq2props{'length'});
# store
$exon->est_hit($fea2);
# general properties
$exon->source_tag($self->analysis_method());
$exon->percentage_id($5);
$exon->mismatches($6);
$exon->gaps($7);
$exon->donor($8);
$exon->acceptor($9);
# push onto array
push(@exons, $exon);
} else {
$self->throw("Unexpected end of file reached\n");
}
}
} elsif( /^Number of splice sites:\s+(\d+)/ ) {
$self->splicesites($1);
} elsif( /^mRNA coverage:\s+(\d+)%/ ) {
$self->est_coverage($1);
} elsif(/^overall percent identity:\s+([\d\.]+)%/ ) {
$self->overall_percentage_id($1);
} elsif(/^Missing mRNA ends:\s+(\w+)/ ) {
$self->missing_mrna_ends($1);
} elsif( /^Exon (\d+): (\d+)-(\d+) \(gen\)\s+(\d+)-(\d+) \(mRNA\)/ ) {
my ($exon_num, $gen_start, $gen_stop, $cdna_start, $cdna_stop);
$exon_num = $1;
$gen_start = $2;
$gen_stop = $3;
$cdna_start = $4;
$cdna_stop = $5;
} elsif( /No alignment found/ ) {
return [];
} else {
#$self->debug("unmatched $_\n");
}
}
# Typical format:
# Exon 1: 36375798-36375691 (gen) 1-108 (mRNA)
#
#
# CCTCTTTTTCTTTGCAGGGTATATACCCAGTTACTTAGACAAGGATGAGCTATGTGTAGT
# | ||||||||||||||||||||||||||||||||||||||||||||||
# ATGTCAGGGTATATACCCAGTTACTTAGACAAGGATGAGCTATGTGTAGT
# M S G Y I P S Y L D K D E L C V V
#
#
# ATGTGGGGACAAAGCCACCGGATATCATTATCGCTGCATCACTTGTGAAGGTTGCAAGGT
# ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
# ATGTGGGGACAAAGCCACCGGATATCATTATCGCTGCATCACTTGTGAAGGTTGCAAG
# C G D K A T G Y H Y R C I T C E G C K
#
#
# AAATGGCA
#
@exons ? return \@exons : return ;
}
=head2 next_exonset
Title : next_exonset
Usage : $exonset = $spidey_result->parse_next_exonset;
print "Exons start at ", $exonset->start(),
"and end at ", $exonset->end(), "\n";
for $exon ($exonset->sub_SeqFeature()) {
# do something
}
Function: Parses the next alignment of the Spidey result file and returns the
set of exons as a container of features. The container is itself
a Bio::SeqFeature::Generic object, with the Bio::Tools::Spidey::Exon
objects as sub features. Start, end, and strand of the container
will represent the total region covered by the exons of this set.
See the documentation of parse_next_alignment() for further
reference about parsing and how the information is stored.
Example :
Returns : An Bio::SeqFeature::Generic object holding Bio::Tools::Spidey::Exon
objects as sub features.
Args :
=cut
sub next_exonset {
my $self = shift;
my $exonset;
# get the next array of exons
my $exons = $self->parse_next_alignment();
if( ! defined $exons ) {
$self->warn("No exons returned");
return;
}
if( @$exons == 0 ) {
return Bio::SeqFeature::Generic->new();
}
# create the container of exons as a feature object itself, with the
# data of the first exon for initialization
$exonset = Bio::SeqFeature::Generic->new('-start' => $exons->[0]->start(),
'-end' => $exons->[-1]->end(),
'-strand' => $exons->[0]->strand(),
'-primary' => "ExonSet");
$exonset->source_tag($exons->[0]->source_tag());
$exonset->seq_id($exons->[0]->seq_id());
# now add all exons as sub features, with enabling EXPANsion of the region
# covered in total
foreach my $exon (@$exons) {
$exonset->add_sub_SeqFeature($exon, 'EXPAND');
}
return $exonset;
}
=head2 next_feature
Title : next_feature
Usage : while($exonset = $spidey->next_feature()) {
# do something
}
Function: Does the same as L<next_exonset()>. See there for documentation of
the functionality. Call this method repeatedly until FALSE is
returned.
The returned object is actually a SeqFeatureI implementing object.
This method is required for classes implementing the
SeqAnalysisParserI interface, and is merely an alias for
next_exonset() at present.
Example :
Returns : A Bio::SeqFeature::Generic object.
Args :
=cut
sub next_feature {
my ($self,@args) = @_;
# even though next_exonset doesn't expect any args (and this method
# does neither), we pass on args in order to be prepared if this changes
# ever
return $self->next_exonset(@args);
}
=head2 genomic_dna_length
Title : genomic_dna_length
Usage : $spidey->genomic_dna_length();
Function: Returns the length of the genomic DNA used in this Spidey result
Example :
Returns : An integer value.
Args :
=cut
sub genomic_dna_length {
my ($self, @args) = @_;
my $val;
if(@args) {
$val = shift(@args);
$self->{'genomic_dna_length'} = $val;
} else {
$val = $self->{'genomic_dna_length'};
}
return $val;
}
=head2 splicesites
Title : splicesites
Usage : $spidey->splicesites();
Function: Returns the number of splice sites found in this Spidey result
Example :
Returns : An integer value.
Args :
=cut
sub splicesites {
my ($self, @args) = @_;
my $val;
if(@args) {
$val = shift(@args);
$self->{'splicesites'} = $val;
} else {
$val = $self->{'splicesites'};
}
return $val;
}
=head2 est_coverage
Title : est_coverage
Usage : $spidey->est_coverage();
Function: Returns the percent of est coverage in this Spidey result
Example :
Returns : An integer value.
Args :
=cut
sub est_coverage {
my ($self, @args) = @_;
my $val;
if(@args) {
$val = shift(@args);
$self->{'est_coverage'} = $val;
} else {
$val = $self->{'est_coverage'};
}
return $val;
}
=head2 overall_percentage_id
Title : overall_percentage_id
Usage : $spidey->overall_percentage_id();
Function: Returns the overall percent id in this Spidey result
Example :
Returns : An float value.
Args :
=cut
sub overall_percentage_id {
my ($self, @args) = @_;
my $val;
if(@args) {
$val = shift(@args);
$self->{'overall_percentage_id'} = $val;
} else {
$val = $self->{'overall_percentage_id'};
}
return $val;
}
=head2 missing_mrna_ends
Title : missing_mrna_ends
Usage : $spidey->missing_mrna_ends();
Function: Returns left/right/neither from Spidey
Example :
Returns : A string value.
Args :
=cut
sub missing_mrna_ends {
my ($self, @args) = @_;
my $val;
if(@args) {
$val = shift(@args);
$self->{'missing_mrna_ends'} = $val;
} else {
$val = $self->{'missing_mrna_ends'};
}
return $val;
}
1;
|