1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131
|
# -*-Perl-*- Test Harness script for Bioperl
# $Id: Perl.t 15112 2008-12-08 18:12:38Z sendu $
use strict;
BEGIN {
use lib '.';
use Bio::Root::Test;
test_begin(-tests => 29,
-requires_module => 'IO::String');
use_ok('Bio::Perl');
}
# Bio::Perl isn't OO so we don't see Bio::Perl->new() here
my ($seq_object,$filename,@seq_object_array);
# will guess file format from extension
$filename = test_input_file('cysprot1.fa');
ok ($seq_object = read_sequence($filename));
isa_ok $seq_object, 'Bio::SeqI';
# forces genbank format
$filename = test_input_file('AF165282.gb');
ok ($seq_object = read_sequence($filename,'genbank'));
isa_ok $seq_object, 'Bio::SeqI';
# reads an array of sequences
$filename = test_input_file('amino.fa');
is (@seq_object_array = read_all_sequences($filename,'fasta'), 2);
isa_ok $seq_object_array[0], 'Bio::SeqI';
isa_ok $seq_object_array[1], 'Bio::SeqI';
$filename = test_output_file();
ok write_sequence(">$filename",'genbank',$seq_object);
ok ($seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA","myname","AL12232"));
isa_ok $seq_object, 'Bio::SeqI';
my $trans;
ok ($trans = translate($seq_object));
isa_ok $trans, 'Bio::SeqI';
ok ($trans = translate("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA"));
isa_ok $trans, 'Bio::PrimarySeqI';
ok ($trans = translate_as_string($seq_object));
is $trans, 'IGLGTQFVCYM';
$trans = '';
ok ($trans = translate_as_string("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA"));
is $trans, 'IGLGTQFVCYM';
# we need to keep tests that depend on net connection at the end
# these now run only with BIOPERLDEBUG set
SKIP: {
test_skip(-tests => 10, -requires_networking => 1);
# swissprot
SKIP: {
eval {
$seq_object = get_sequence('swissprot',"ROA1_HUMAN");
};
if ($@) {
skip("problem connecting to SwissProt:$@",2);
} else {
ok $seq_object;
isa_ok $seq_object, 'Bio::SeqI';
}
}
# embl
SKIP: {
eval {
$seq_object = get_sequence('embl',"BUM");
};
if ($@) {
skip("problem connecting to EMBL:$@",2);
} else {
ok $seq_object;
isa_ok $seq_object, 'Bio::SeqI';
}
}
# genbank
SKIP: {
eval {
$seq_object = get_sequence('genbank',"AI129902");
};
if ($@) {
skip("problem connecting to GenBank:$@",2);
} else {
ok $seq_object;
isa_ok $seq_object, 'Bio::SeqI';
}
}
# refseq
SKIP: {
eval {
$seq_object = get_sequence('genbank',"NM_006732");
};
if( $@ ) {
skip("problem connecting to RefSeq:$@",2);
} else {
ok $seq_object;
isa_ok $seq_object, 'Bio::SeqI';
}
}
# genpept
SKIP: {
eval {
$seq_object = get_sequence('genpept',"AAC06201");
};
if ($@) {
skip("problem connecting to RefSeq:$@",2);
} else {
ok $seq_object;
isa_ok $seq_object, 'Bio::SeqI';
}
}
}
|