1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281
|
# -*-Perl-*- Test Harness script for Bioperl
# $Id: Quality.t 16103 2009-09-16 04:27:51Z cjfields $
use strict;
BEGIN {
use lib '.';
use Bio::Root::Test;
test_begin(-tests => 61);
use_ok('Bio::Seq::Quality');
}
use Bio::SeqIO;
my $DEBUG = test_debug();
# create some random sequence object with no id
my $seqobj_broken = Bio::Seq::Quality->new( -seq => "ATCGATCGA",
);
my $seqobj;
lives_ok {
$seqobj = Bio::Seq::Quality->new( -seq => "ATCGATCGA",
-id => 'QualityFragment-12',
-accession_number => 'X78121',
);
};
# create some random quality object with the same number of qualities and the same identifiers
my $string_quals = "10 20 30 40 50 40 30 20 10";
my $qualobj;
lives_ok {
$qualobj = Bio::Seq::Quality->new( -qual => $string_quals,
-id => 'QualityFragment-12',
-accession_number => 'X78121',
);
};
# check to see what happens when you construct the Quality object
ok my $swq1 = Bio::Seq::Quality->new( -seq => "ATCGATCGA",
-id => 'QualityFragment-12',
-accession_number => 'X78121',
-qual => $string_quals);
print("Testing various weird constructors...\n") if $DEBUG;
print("\ta) No ids, Sequence object, no quality...\n") if $DEBUG;
# w for weird
my $wswq1;
lives_ok {
$wswq1 = Bio::Seq::Quality->new( -seq => "ATCGATCGA",
-qual => "");
};
print $@ if $DEBUG;
print("\tb) No ids, no sequence, quality object...\n") if $DEBUG;
# note that you must provide a alphabet for this one.
$wswq1 = Bio::Seq::Quality->new( -seq => "",
-qual => $string_quals,
-alphabet => 'dna'
);
print("\tc) Absolutely nothing. (HAHAHAHA)...\n") if $DEBUG;
lives_ok {
$wswq1 = Bio::Seq::Quality->new( -seq => "",
-qual => "",
-alphabet => 'dna'
);
};
print("\td) Absolutely nothing but an ID\n") if $DEBUG;
lives_ok {
$wswq1 = Bio::Seq::Quality->new( -seq => "",
-qual => "",
-alphabet => 'dna',
-id => 'an object with no sequence and no quality but with an id'
);
};
print("\td) No sequence, No quality, No ID...\n") if $DEBUG;
warnings_like {
$wswq1 = Bio::Seq::Quality->new( -seq => "",
-qual => "",
-verbose => 0);
} qr/Got a sequence with no letters in it cannot guess alphabet/;
print("Testing various methods and behaviors...\n") if $DEBUG;
print("1. Testing the seq() method...\n") if $DEBUG;
print("\t1a) get\n") if $DEBUG;
my $original_seq = $swq1->seq();
is ($original_seq, "ATCGATCGA");
print("\t1b) set\n") if $DEBUG;
ok ($swq1->seq("AAAAAAAAAAAA"));
print("\t1c) get (again, to make sure the set was done.)\n") if $DEBUG;
is($swq1->seq(), "AAAAAAAAAAAA");
print("\tSetting the sequence back to the original value...\n") if $DEBUG;
$swq1->seq($original_seq);
print("2. Testing the qual() method...\n") if $DEBUG;
print("\t2a) get\n") if $DEBUG;
my @qual = @{$swq1->qual()};
my $str_qual = join(' ',@qual);
is $str_qual, "10 20 30 40 50 40 30 20 10";
print("\t2b) set\n") if $DEBUG;
ok $swq1->qual("10 10 10 10 10");
print("\t2c) get (again, to make sure the set was done.)\n") if $DEBUG;
my @qual2 = @{$swq1->qual()};
my $str_qual2 = join(' ',@qual2);
is($str_qual2, "10 10 10 10 10 0 0 0 0"); ###!
print("\tSetting the quality back to the original value...\n") if $DEBUG;
$swq1->qual($str_qual);
print("3. Testing the length() method...\n") if $DEBUG;
print("\t3a) When lengths are equal...\n") if $DEBUG;
is($swq1->length(), 9);
print("\t3b) When lengths are different\n") if $DEBUG;
$swq1->qual("10 10 10 10 10");
isnt ($swq1->length(), "DIFFERENT");
print("6. Testing the subqual() method...\n") if $DEBUG;
my $t_subqual = "10 20 30 40 50 60 70 80 90";
$swq1->qual($t_subqual);
print("\t6d) Testing the subqual at the start (border condition)\n") if $DEBUG;
# ok ('1 2 3' eq join(' ',@{$swq1->subqual(1,3)}));
print("\t6d) Testing the subqual at the end (border condition)\n") if $DEBUG;
# ok ('7 8 9' eq join(' ',@{$swq1->subqual(7,9)}));
print("\t6d) Testing the subqual in the middle\n") if $DEBUG;
# ok ('4 5 6' eq join(' ',@{$swq1->subqual(4,6)}));
print("7. Testing cases where quality is zero...\n") if $DEBUG;
$swq1 = Bio::Seq::Quality->new(-seq => 'G',
-qual => '0',
);
my $swq2 = Bio::Seq::Quality->new(-seq => 'G',
-qual => '65',
);
is $swq1->length, $swq2->length;
$swq1 = Bio::Seq::Quality->new(-seq => 'GC',
-qual => '0 0',
);
$swq2 = Bio::Seq::Quality->new(-seq => 'GT',
-qual => '65 0',
);
is $swq1->length, $swq2->length;
#
# end of test inherited from seqwithquality.t
#
#################################################################
#
# testing new functionality
#
my $qual = '0 1 2 3 4 5 6 7 8 9 11 12';
my $trace = '0 5 10 15 20 25 30 35 40 45 50 55';
ok my $seq = Bio::Seq::Quality->new
( -qual => $qual,
-trace_indices => $trace,
-seq => 'atcgatcgatcg',
-id => 'human_id',
-accession_number => 'S000012',
-verbose => $DEBUG >= 0 ? $DEBUG : 0
);
is_deeply $seq->qual, [split / /, $qual];
is_deeply $seq->trace, [split / /, $trace];
is_deeply $seq->trace_indices, [split / /, $trace]; #deprecated
is $seq->qual_text, $qual;
is $seq->trace_text, $trace;
is join (' ', @{$seq->subqual(2, 3)}), '1 2';
is $seq->subqual_text(2, 3), '1 2';
is join (' ', @{$seq->subqual(2, 3, "9 9")}), '9 9';
is $seq->subqual_text(2, 3, "8 8"), '8 8';
is join (' ', @{$seq->subtrace(2, 3)}), '5 10';
is $seq->subtrace_text(2, 3), '5 10';
is join (' ', @{$seq->subtrace(2, 3, "9 9")}), '9 9';
is $seq->subtrace_text(2, 3, "8 8"), '8 8';
is $seq->trace_index_at(5), 20;
is join(' ', @{$seq->sub_trace_index(5,6)}), "20 25";
is $seq->baseat(2), 't';
#############################################
#
# same tests using Seq::Meta::Array methods follow ...
#
my $meta = '0 1 2 3 4 5 6 7 8 9 11 12';
$trace = '0 5 10 15 20 25 30 35 40 45 50 55';
my @trace_array = qw(0 5 10 15 20 25 30 35 40 45 50 55);
ok $seq = Bio::Seq::Quality->new
( -meta => $meta,
-seq => 'atcgatcgatcg',
-id => 'human_id',
-accession_number => 'S000012',
-verbose => $DEBUG >= 0 ? $DEBUG : 0
);
$seq->named_meta('trace', \@trace_array);
is_deeply $seq->meta, [split / /, $meta];
is_deeply $seq->named_meta('trace'), [split / /, $trace];
is $seq->meta_text, $meta;
is $seq->named_meta_text('trace'), $trace;
is join (' ', @{$seq->submeta(2, 3)}), '1 2';
is $seq->submeta_text(2, 3), '1 2';
is join (' ', @{$seq->submeta(2, 3, "9 9")}), '9 9';
is $seq->submeta_text(2, 3, "8 8"), '8 8';
is join (' ', @{$seq->named_submeta('trace', 2, 3)}), '5 10';
is $seq->named_submeta_text('trace', 2, 3), '5 10';
is join (' ', @{$seq->named_submeta('trace', 2, 3, "9 9")}), '9 9';
is $seq->named_submeta_text('trace', 2, 3, "8 8"), '8 8';
ok $seq = Bio::Seq::Quality->new(
-seq => "ATGGGGGTGGTGGTACCCTATGGGGGTGGTGGTACCCT",
-qual => "10 59 12 75 63 76 84 36 42 10 35 97 81 50 81 53 93 13 38 10 59 12 75 63 76 84 36 42 10 35 97 81 50 81 53 93 13 38",
-trace_indices => "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38"
);
my $rev;
ok $rev = $seq->revcom;
is $rev->seq, 'AGGGTACCACCACCCCCATAGGGTACCACCACCCCCAT';
is $rev->qual_text, "38 13 93 53 81 50 81 97 35 10 42 36 84 76 63 75 12 59 10 38 13 93 53 81 50 81 97 35 10 42 36 84 76 63 75 12 59 10";
# selecting ranges based on quality
# test seq with three high quality regions (13, 12 and 3), one very short (3)
ok $seq = Bio::Seq::Quality->new(
-seq => "ATGGGGGTGGTGGTACCCTATGGGGGTGGTGGTACCCT",
-qual => "0 5 10 20 30 40 40 50 50 50 50 50 40 10 10 10 5 5 20 20 30 40 50 44 44 50 50 50 50 50 5 5 40 40 40 40 50 50"
);
is $seq->threshold, undef;
is $seq->threshold(10), 10;
is $seq->threshold(13), 13;
is $seq->count_clear_ranges, 3;
my $newseq = $seq->get_clear_range;
is $newseq->length, 12;
my @ranges = $seq->get_all_clean_ranges;
is scalar @ranges, 3;
my $min_length = 10;
@ranges = $seq->get_all_clean_ranges($min_length);
is scalar @ranges, 2;
my $seqio = Bio::SeqIO->new(
-file => test_input_file('test_clear_range.fastq'),
-format => 'fastq'
);
while ( my $seq = $seqio->next_seq() ) {
$seq->threshold(15);
lives_ok { my $newqualobj = $seq->get_clear_range };
}
|