1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
|
# -*-Perl-*- Test Harness script for Bioperl
# $Id: Splicedseq.t 15112 2008-12-08 18:12:38Z sendu $
use strict;
BEGIN {
use lib '.';
use Bio::Root::Test;
test_begin(-tests => 14);
use_ok('Bio::SeqIO');
}
ok my $str = Bio::SeqIO->new(
'-file'=> test_input_file('U58726.gb'),
'-format' => 'GenBank');
my $seq;
ok ( $seq = $str->next_seq() );
# Here is a cute way to verify the sequence by seeing if the
# the translation matches what is annotated in the file -js
foreach my $ft ( grep { $_->primary_tag eq 'CDS'}
$seq->top_SeqFeatures ) {
if( $ft->has_tag('translation') ) {
my ($translation) = $ft->each_tag_value('translation');
my $t = $ft->spliced_seq(-nosort => 1);
my $pepseq = $t->translate()->seq();
chop($pepseq);# chop is to remove stop codon
is($translation,$pepseq);
}
}
my $stream = Bio::SeqIO->new(-file => test_input_file('M12730.gb'),
-format => 'genbank');
# Jump down to M12730 which lists CDS join(1959..2355,1..92)
while ($seq->accession ne "M12730") {
$seq = $stream->next_seq;
}
ok(my @features = $seq->get_SeqFeatures(), "get_SeqFeatures()");
my $feat;
foreach my $feat2 ( @features ) {
next unless ($feat2->primary_tag eq "CDS");
my @db_xrefs = $feat2->get_tag_values("db_xref");
if (grep { $_ eq "GI:150830" } @db_xrefs) {
$feat = $feat2;
last;
}
}
my ($protein_seq) = $feat->get_tag_values("translation");
like($protein_seq, qr(^MKERYGTVYKGSQRLIDE.*ANEKQENALYLIIILSRTSIT$),
"protein sequence");
my ($nucleotide_seq) = $feat->spliced_seq(-nosort => 1)->seq;
like($nucleotide_seq, qr(^ATGAAAGAAAGATATGGA.*TCAAGGACTAGTATAACATAA$),
"nucleotide sequence - correct CDS range");
is(length($nucleotide_seq), 489, "nucleotide length");
|