1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290
|
# -*-Perl-*- Test Harness script for Bioperl
# $Id: SeqUtils.t 16151 2009-09-22 16:52:29Z cjfields $
use strict;
BEGIN {
use lib '.';
# use List::MoreUtils qw(uniq);
use Bio::Root::Test;
test_begin(-tests => 51);
use_ok('Bio::PrimarySeq');
use_ok('Bio::SeqUtils');
use_ok('Bio::LiveSeq::Mutation');
use_ok('Bio::SeqFeature::Generic');
use_ok('Bio::Annotation::SimpleValue');
}
my ($seq, $util, $ascii, $ascii_aa, $ascii3);
# Entire alphabet now IUPAC-endorsed and used in GenBank (Oct 2006)
$ascii = 'ABCDEFGHIJKLMNOPQRSTUVWXYZ';
$ascii_aa = 'ABCDEFGHIJKLMNOPQRSTUVWXYZ';
$ascii3 =
'AlaAsxCysAspGluPheGlyHisIleXleLysLeuMetAsnPylProGlnArgSerThrSecValTrpXaaTyrGlx';
$seq = Bio::PrimarySeq->new('-seq'=> $ascii,
'-alphabet'=>'protein',
'-id'=>'test');
# one letter amino acid code to three letter code
ok $util = Bio::SeqUtils->new();
is $util->seq3($seq), $ascii3;
#using anonymous hash
is (Bio::SeqUtils->seq3($seq), $ascii3);
is (Bio::SeqUtils->seq3($seq, undef, ','),
'Ala,Asx,Cys,Asp,Glu,Phe,Gly,His,Ile,Xle,Lys,'.
'Leu,Met,Asn,Pyl,Pro,Gln,Arg,Ser,Thr,Sec,Val,Trp,Xaa,Tyr,Glx');
$seq->seq('asd-KJJK-');
is (Bio::SeqUtils->seq3($seq, '-', ':'),
'Ala:Ser:Asp:Ter:Lys:Xle:Xle:Lys:Ter');
# three letter amino acid code to one letter code
ok (Bio::SeqUtils->seq3in($seq, 'AlaPYHCysAspGlu'));
is $seq->seq, 'AXCDE';
is (Bio::SeqUtils->seq3in($seq, $ascii3)->seq, $ascii_aa);
#
# Tests for multiframe translations
#
$seq = Bio::PrimarySeq->new('-seq'=> 'agctgctgatcggattgtgatggctggatggcttgggatgctgg',
'-alphabet'=>'dna',
'-id'=>'test2');
my @a = $util->translate_3frames($seq);
is scalar @a, 3;
#foreach $a (@a) {
# print 'ID: ', $a->id, ' ', $a->seq, "\n";
#}
@a = $util->translate_6frames($seq);
is scalar @a, 6;
#foreach $a (@a) {
# print 'ID: ', $a->id, ' ', $a->seq, "\n";
#}
#
# test for valid AA return
#
my @valid_aa = sort Bio::SeqUtils->valid_aa;
is(@valid_aa, 27);
is($valid_aa[1], 'A');
@valid_aa = sort Bio::SeqUtils->valid_aa(1);
is(@valid_aa, 27);
is ($valid_aa[1], 'Arg');
my %valid_aa = Bio::SeqUtils->valid_aa(2);
is keys %valid_aa, 54;
is($valid_aa{'C'}, 'Cys');
is( $valid_aa{'Cys'}, 'C');
#
# Mutate
#
my $string1 = 'aggt';
$seq = Bio::PrimarySeq->new('-seq'=> 'aggt',
'-alphabet'=>'dna',
'-id'=>'test3');
# point
Bio::SeqUtils->mutate($seq,
Bio::LiveSeq::Mutation->new(-seq => 'c',
-pos => 3
)
);
is $seq->seq, 'agct';
# insertion and deletion
my @mutations = (
Bio::LiveSeq::Mutation->new(-seq => 'tt',
-pos => 2,
-len => 0
),
Bio::LiveSeq::Mutation->new(-pos => 2,
-len => 2
)
);
Bio::SeqUtils->mutate($seq, @mutations);
is $seq->seq, 'agct';
# insertion to the end of the sequence
Bio::SeqUtils->mutate($seq,
Bio::LiveSeq::Mutation->new(-seq => 'aa',
-pos => 5,
-len => 0
)
);
is $seq->seq, 'agctaa';
#
# testing Bio::SeqUtils->cat
#
# PrimarySeqs
my $primseq1 = Bio::PrimarySeq->new(-id => 1, -seq => 'acgt', -description => 'master');
my $primseq2 = Bio::PrimarySeq->new(-id => 2, -seq => 'tgca');
Bio::SeqUtils->cat($primseq1, $primseq2);
is $primseq1->seq, 'acgttgca';
is $primseq1->description, 'master';
#should work for Bio::LocatableSeq
#should work for Bio::Seq::MetaI Seqs?
# Bio::SeqI
my $seq1 = Bio::Seq->new(-id => 1, -seq => 'aaaa', -description => 'first');
my $seq2 = Bio::Seq->new(-id => 2, -seq => 'tttt', -description => 'second');
my $seq3 = Bio::Seq->new(-id => 3, -seq => 'cccc', -description => 'third');
# annotations
my $ac2 = Bio::Annotation::Collection->new();
my $simple1 = Bio::Annotation::SimpleValue->new(
-tagname => 'colour',
-value => 'blue'
), ;
my $simple2 = Bio::Annotation::SimpleValue->new(
-tagname => 'colour',
-value => 'black'
), ;
$ac2->add_Annotation('simple',$simple1);
$ac2->add_Annotation('simple',$simple2);
$seq2->annotation($ac2);
my $ac3 = Bio::Annotation::Collection->new();
my $simple3 = Bio::Annotation::SimpleValue->new(
-tagname => 'colour',
-value => 'red'
), ;
$ac3->add_Annotation('simple',$simple3);
$seq3->annotation($ac3);
ok (Bio::SeqUtils->cat($seq1, $seq2, $seq3));
is $seq1->seq, 'aaaattttcccc';
is scalar $seq1->annotation->get_Annotations, 3;
# seq features
my $ft2 = Bio::SeqFeature::Generic->new( -start => 1,
-end => 4,
-strand => 1,
-primary => 'source',
-tag => {note => 'note2'},
);
my $ft3 = Bio::SeqFeature::Generic->new( -start => 3,
-end => 3,
-strand => 1,
-primary => 'hotspot',
-tag => {note => ['note3a','note3b'],
comment => 'c1'},
);
$seq2->add_SeqFeature($ft2);
$seq2->add_SeqFeature($ft3);
ok (Bio::SeqUtils->cat($seq1, $seq2));
is $seq1->seq, 'aaaattttcccctttt';
is scalar $seq1->annotation->get_Annotations, 5;
is_deeply([uniq_sort(map{$_->get_all_tags}$seq1->get_SeqFeatures)], [sort qw(note comment)], 'cat - has expected tags');
is_deeply([sort map{$_->get_tagset_values('note')}$seq1->get_SeqFeatures], [sort qw(note2 note3a note3b)], 'cat - has expected tag values');
my @tags;
lives_ok {
@tags = map{$_->get_tag_values(q(note))}$seq1->get_SeqFeatures ;
} 'cat - note tag transfered (no throw)';
cmp_ok(scalar(@tags),'==',3, 'cat - note tag values transfered (correct count)') ;
my $protseq = Bio::PrimarySeq->new(-id => 2, -seq => 'MVTF'); # protein seq
throws_ok {
Bio::SeqUtils->cat($seq1, $protseq);
} qr/different alphabets:/, 'different alphabets' ;
#
# evolve()
#
$seq = Bio::PrimarySeq->new('-seq'=> 'aaaaaaaaaa',
'-id'=>'test');
$util = Bio::SeqUtils->new(-verbose => 0);
ok my $newseq = $util->evolve($seq, 60, 4);
# annotations
$seq2 = Bio::Seq->new(-id => 2, -seq => 'ggttaaaa', -description => 'second');
$ac3 = Bio::Annotation::Collection->new();
$simple3 = Bio::Annotation::SimpleValue->new(
-tagname => 'colour',
-value => 'red'
), ;
$ac3->add_Annotation('simple',$simple3);
$seq2->annotation($ac3);
$ft2 = Bio::SeqFeature::Generic->new( -start => 1,
-end => 4,
-strand => 1,
-primary => 'source',
-tag => {note => 'note2'},
);
$ft3 = Bio::SeqFeature::Generic->new( -start => 5,
-end => 8,
-strand => -1,
-primary => 'hotspot',
-tag => {note => ['note3a','note3b'],
comment => 'c1'},
);
$seq2->add_SeqFeature($ft2);
$seq2->add_SeqFeature($ft3);
my $trunc=Bio::SeqUtils->trunc_with_features($seq2, 2, 7);
is $trunc->seq, 'gttaaa';
my @feat=$trunc->get_SeqFeatures;
is $feat[0]->location->to_FTstring, '<1..3';
is $feat[1]->location->to_FTstring, 'complement(4..>6)';
is_deeply([uniq_sort(map{$_->get_all_tags}$trunc->get_SeqFeatures)], [sort qw(note comment)], 'trunc_with_features - has expected tags');
is_deeply([sort map{$_->get_tagset_values('note')}$trunc->get_SeqFeatures], [sort qw(note2 note3a note3b)], 'trunc_with_features - has expected tag values');
my $revcom=Bio::SeqUtils->revcom_with_features($seq2);
is $revcom->seq, 'ttttaacc';
my @revfeat=$revcom->get_SeqFeatures;
is $revfeat[0]->location->to_FTstring, 'complement(5..8)';
is $revfeat[1]->location->to_FTstring, '1..4';
is_deeply([uniq_sort(map{$_->get_all_tags}$revcom->get_SeqFeatures)], [sort qw(note comment)], 'revcom_with_features - has expected tags');
is_deeply([sort map{$_->get_tagset_values('note')}$revcom->get_SeqFeatures], [sort qw(note2 note3a note3b)], 'revcom_with_features - has expected tag values');
# check circularity
isnt($revcom->is_circular, 1, 'still not circular');
$seq3 = Bio::Seq->new(-id => 3, -seq => 'ggttaaaa', -description => 'third', -is_circular => 1);
is(Bio::SeqUtils->revcom_with_features($seq3)->is_circular, 1, 'still circular');
sub uniq_sort {
my @args = @_;
my %uniq;
@args = sort @args;
@uniq{@args} = (0..$#args);
return sort {$uniq{$a} <=> $uniq{$b}} keys %uniq;
}
|