# -*-Perl-*- Test Harness script for Bioperl
# $Id$

use strict;

BEGIN { 
    use lib '.';
    use Bio::Root::Test;

    test_begin(-tests => 71);

    use_ok('Bio::Tools::CodonTable');
    use_ok('Bio::CodonUsage::IO');
}

# create a table object by giving an ID
my $DEBUG = test_debug();
my $myCodonTable = Bio::Tools::CodonTable -> new ( -id => 16);
ok defined $myCodonTable;
isa_ok $myCodonTable, 'Bio::Tools::CodonTable';

# defaults to ID 1 "Standard"
$myCodonTable = Bio::Tools::CodonTable->new();
is $myCodonTable->id(), 1;

# change codon table
$myCodonTable->id(10);
is $myCodonTable->id, 10;
is $myCodonTable->name(), 'Euplotid Nuclear';

# enumerate tables as object method
my $table = $myCodonTable->tables();
cmp_ok (keys %{$table}, '>=', 17); # currently 17 known tables
is $table->{11}, q{"Bacterial"};

# enumerate tables as class method
$table = Bio::Tools::CodonTable->tables;
cmp_ok (values %{$table}, '>=', 17); # currently 17 known tables
is $table->{23}, 'Thraustochytrium Mitochondrial';

# translate codons
$myCodonTable->id(1);

eval {
    $myCodonTable->translate();
};
ok ($@ =~ /EX/) ;

# Automatically completing translation of incomplete codons is no longer default
# behavior b/c of inconsistent behavior compared with Bio::PrimarySeq::translate
# and unexpected side effects (e.g. what if the last few bases isn't supposed to
# be translated). To re-establish this, pass a second argument to the method.

is $myCodonTable->translate(''), '';

my @ii  = qw(ACT acu ATN gt ytr sar);
my @res = qw(T   T   X   V  L   Z  );
my $test = 1;
for my $i (0..$#ii) {
    if ($res[$i] ne $myCodonTable->translate($ii[$i], 1) ) {
        $test = 0;
        print $ii[$i], ": |", $res[$i], "| ne |",
        $myCodonTable->translate($ii[$i], 1), "|\n" if( $DEBUG);
        last ;
    }
}
ok ($test);
is $myCodonTable->translate('ag'), '';
is $myCodonTable->translate('ag',1), '';

is $myCodonTable->translate('jj'), '';
is $myCodonTable->translate('jj',1), '';

is $myCodonTable->translate('jjg'), 'X';
is $myCodonTable->translate('jjg',1), 'X';

is $myCodonTable->translate('gt'), ''; 
is $myCodonTable->translate('gt',1), 'V';

is $myCodonTable->translate('g'), '';
is $myCodonTable->translate('g',1), '';

# a more comprehensive test on ambiguous codes
my $seq = <<SEQ;
atgaaraayacmacracwackacyacsacvachacdacbacxagragyatmatwatyathcarcayc
cmccrccwcckccyccsccvcchccdccbccxcgmcgrcgwcgkcgycgscgvcghcgdcgbcgxctmctrct
wctkctyctsctvcthctdctbctxgargaygcmgcrgcwgckgcygcsgcvgchgcdgcbgcxggmggrggw
ggkggyggsggvgghggdggbggxgtmgtrgtwgtkgtygtsgtvgthgtdgtbgtxtartaytcmtcrtcwt
cktcytcstcvtchtcdtcbtcxtgyttrttytramgamggmgrracratrayytaytgytrsaasagsartaa;
SEQ
    $seq =~ s/\s+//g;
@ii = grep { length == 3 } split /(.{3})/, $seq; 
print join (' ', @ii), "\n" if( $DEBUG);
my $prot = <<PROT;
MKNTTTTTTTTTTTRSIIIIQHPPPPPPPPPPPRRRRRRRRRRRLLLLLLLLLLLEDAAAAAAAAAAAGGG
GGGGGGGGVVVVVVVVVVV*YSSSSSSSSSSSCLF*RRRBBBLLLZZZ*
PROT

    $prot =~ s/\s//;
@res = split //, $prot;
print join (' ', @res), "\n" if( $DEBUG );
$test = 1;
for my $i (0..$#ii) {
    if ($res[$i] ne $myCodonTable->translate($ii[$i]) ) {
        $test = 0; 
        print $ii[$i], ": |", $res[$i], "| ne |",
        $myCodonTable->translate($ii[$i]),  "| @ $i\n" if( $DEBUG);
        last ;
    }
}
ok $test;

# reverse translate amino acids 

is $myCodonTable->revtranslate('U'), 0;
is $myCodonTable->revtranslate('O'), 0;
is $myCodonTable->revtranslate('J'), 9;
is $myCodonTable->revtranslate('I'), 3;

@ii = qw(A l ACN Thr sER ter Glx);
@res = (
    [qw(gct gcc gca gcg)],
    [qw(ggc gga ggg act acc aca acg)],
    [qw(tct tcc tca tcg agt agc)],
    [qw(act acc aca acg)],
    [qw(tct tcc tca tcg agt agc)],
    [qw(taa tag tga)],
    [qw(gaa gag caa cag)]
    );

$test = 1;
 TESTING: {
     for my $i (0..$#ii) {
         my @codonres = $myCodonTable->revtranslate($ii[$i]);
         for my $j (0..$#codonres) {
             if ($codonres[$j] ne $res[$i][$j]) {
                 $test = 0;
                 print $ii[$i], ': ', $codonres[$j], " ne ",
                 $res[$i][$j], "\n" if( $DEBUG);
                 last TESTING;
             }
         }
     }
 }
ok $test;

#  boolean tests
$myCodonTable->id(1);

ok $myCodonTable->is_start_codon('ATG');  
is $myCodonTable->is_start_codon('GGH'), 0;
ok $myCodonTable->is_start_codon('HTG');
is $myCodonTable->is_start_codon('CCC'), 0;

ok $myCodonTable->is_ter_codon('UAG');
ok $myCodonTable->is_ter_codon('TaG');
ok $myCodonTable->is_ter_codon('TaR');
ok $myCodonTable->is_ter_codon('tRa');
is $myCodonTable->is_ter_codon('ttA'), 0;

ok $myCodonTable->is_unknown_codon('jAG');
ok $myCodonTable->is_unknown_codon('jg');
is $myCodonTable->is_unknown_codon('UAG'), 0;

is $myCodonTable->translate_strict('ATG'), 'M';



#
# adding a custom codon table
#


my @custom_table =
    ( 'test1',
      'FFLLSSSSYY**CC*WLLLL**PPHHQQR*RRIIIMT*TT*NKKSSRRV*VVAA*ADDEE*GGG'
    );

ok my $custct = $myCodonTable->add_table(@custom_table);
is $custct, 25;
is $myCodonTable->translate('atgaaraayacmacracwacka'), 'MKNTTTT';
ok $myCodonTable->id($custct);
is $myCodonTable->translate('atgaaraayacmacracwacka'), 'MKXXTTT';

# test doing this via Bio::PrimarySeq object

use Bio::PrimarySeq;
ok $seq = Bio::PrimarySeq->new(-seq=>'atgaaraayacmacracwacka', -alphabet=>'dna');
is $seq->translate()->seq, 'MKNTTTT';
is $seq->translate(undef, undef, undef, undef, undef, undef, $myCodonTable)->seq, 'MKXXTTT';

# test gapped translated

ok $seq = Bio::PrimarySeq->new(-seq      => 'atg---aar------aay',
                               -alphabet => 'dna');
is $seq->translate->seq, 'M-K--N';

ok $seq = Bio::PrimarySeq->new(-seq =>'ASDFGHKL');
is $myCodonTable->reverse_translate_all($seq), 'GCBWSNGAYTTYGGVCAYAARYTN';
ok $seq = Bio::PrimarySeq->new(-seq => 'ASXFHKL');
is $myCodonTable->reverse_translate_all($seq), 'GCBWSNNNNTTYCAYAARYTN';

#
# test reverse_translate_best(), requires a Bio::CodonUsage::Table object
# 

ok $seq = Bio::PrimarySeq->new(-seq =>'ACDEFGHIKLMNPQRSTVWY');
ok my $io = Bio::CodonUsage::IO->new(-file => test_input_file('MmCT'));
ok my $cut = $io->next_data();
is $myCodonTable->reverse_translate_best($seq,$cut), 'GCCTGCGACGAGTTCGGCCACATCAAGCTGATGAACCCCCAGCGCTCCACCGTGTGGTAC';

#
# test 'Strict' table, requires a Bio::CodonUsage::Table object
#

$myCodonTable = Bio::Tools::CodonTable->new();

#  boolean tests
is $myCodonTable->is_start_codon('ATG'), 1;
is $myCodonTable->is_start_codon('GTG'), 0;
is $myCodonTable->is_start_codon('TTG'), 1;
is $myCodonTable->is_start_codon('CTG'), 1;
is $myCodonTable->is_start_codon('CCC'), 0;

$myCodonTable->id(24);

is $myCodonTable->is_start_codon('ATG'), 1;
is $myCodonTable->is_start_codon('GTG'), 0;
is $myCodonTable->is_start_codon('TTG'), 0;
is $myCodonTable->is_start_codon('CTG'), 0;
is $myCodonTable->is_start_codon('CCC'), 0;