1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112
|
# -*-Perl-*- Test Harness script for Bioperl
# $Id$
use strict;
BEGIN {
use Bio::Root::Test;
test_begin(-tests => 47);
use_ok('Bio::SeqFeature::Primer');
use_ok('Bio::PrimarySeq');
}
my ($primer, $primer_seq, $location, $start, $end, $strand, $id, $tm, $tme, $template, $seq);
# Implied primer sequence
$template = Bio::Seq->new( -seq => 'AAAAACCCCCGGGGGTTTTT' );
ok $primer = Bio::SeqFeature::Primer->new( -start => 6, -end => 10 ), 'Implied primer sequence';
isa_ok $primer, 'Bio::SeqFeature::Primer';
isa_ok $primer, 'Bio::SeqFeature::SubSeq';
ok $template->add_SeqFeature($primer); # $primer->attach_seq($template);
ok $primer_seq = $primer->seq;
isa_ok $primer_seq, 'Bio::PrimarySeqI';
is $primer_seq->seq, 'CCCCC';
# Bio::PrimarySeq primer
$template = Bio::Seq->new( -seq => 'AAAAACCCCCGGGGGTTTTT' );
$seq = Bio::PrimarySeq->new(-seq => 'CTTTTCATTCTGACTGCAACG');
ok $primer = Bio::SeqFeature::Primer->new(-seq => $seq), 'PrimarySeq primer';
ok $template->add_SeqFeature($primer); # $primer->attach_seq($template);
ok $primer_seq = $primer->seq;
isa_ok $primer_seq, 'Bio::PrimarySeqI';
is $primer_seq->seq, 'CTTTTCATTCTGACTGCAACG';
# Initialize with a sequence string
ok $primer = Bio::SeqFeature::Primer->new(
-seq => 'CTTTTCATTCTGACTGCAACG',
-start => 3,
-id => 'myid',
);
is $primer->start, 3;
ok $primer_seq = $primer->seq;
is $primer_seq->isa('Bio::PrimarySeqI'), 1;
is $primer_seq->seq, 'CTTTTCATTCTGACTGCAACG';
is $primer_seq->id, 'myid';
is $primer->primary_tag, 'Primer';
ok $primer->display_name('test');
is $primer->display_name, 'test';
# Coordinates
ok $primer->start(2);
is $primer->start, 2;
ok $primer->end(19);
is $primer->end, 19;
ok $primer->strand(-1);
is $primer->strand, -1;
ok $location = $primer->location;
isa_ok $location, 'Bio::LocationI';
# Melting temperatures
ok $tm = $primer->Tm;
is int($tm), 52;
ok $tm = $primer->Tm(-salt => 0.05, -oligo => 0.0000001);
ok $tme = $primer->Tm_estimate;
is int($tme), 58;
ok $tm = $primer->Tm_estimate(-salt => 0.05);
# Legacy
# * initializing with -sequence
# * passing a string to location()
{
local $SIG{'__WARN__'} = sub { }; # Silence deprecation warnings
ok $primer = Bio::SeqFeature::Primer->new(
-sequence => 'CTTTTCATTCTGACTGCAACG',
);
ok $location = $primer->location('3,25');
is $location, '3,25';
}
# Chad's tests
$seq = Bio::Seq->new(
-seq => 'gcatcgatctagctagcta' ,
-id => 'chads_nifty_sequence',
);
$primer = Bio::SeqFeature::Primer->new(
-seq => $seq,
-TARGET => '5,3'
);
isa_ok $primer, 'Bio::SeqFeature::Primer';
is $primer->seq->display_id, 'chads_nifty_sequence';
is $primer->seq->seq, 'gcatcgatctagctagcta';
$primer = Bio::SeqFeature::Primer->new(
-seq => 'aaaaaacgatcgatcgtagctagct',
-id => 'chads_nifty_primer',
-TARGET => '5,3',
);
isa_ok $primer, 'Bio::SeqFeature::Primer';
isa_ok $primer->seq(), 'Bio::PrimarySeq';
is $primer->seq->id, 'chads_nifty_primer';
is $primer->seq->seq, 'aaaaaacgatcgatcgtagctagct';
|