1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260
|
BLASTN 2.1.2 [Oct-19-2000]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= AE003528 Drosophila melanogaster genomic scaffold
142000013386050 section 40 of 54, complete sequence.
(283,821 letters)
Database: ecoli.nt
400 sequences; 4,662,239 total letters
Searching.................................................done
Score E
Sequences producing significant alignments: (bits) Value
gb|AE000450.1|AE000450 Escherichia coli K-12 MG1655 section 340 ... 60 1e-06
gb|AE000359.1|AE000359 Escherichia coli K-12 MG1655 section 249 ... 48 0.004
gb|AE000281.1|AE000281 Escherichia coli K-12 MG1655 section 171 ... 40 1.1
gb|AE000274.1|AE000274 Escherichia coli K-12 MG1655 section 164 ... 40 1.1
gb|AE000117.1|AE000117 Escherichia coli K-12 MG1655 section 7 of... 40 1.1
gb|AE000502.1|AE000502 Escherichia coli K-12 MG1655 section 392 ... 38 4.3
gb|AE000454.1|AE000454 Escherichia coli K-12 MG1655 section 344 ... 38 4.3
gb|AE000443.1|AE000443 Escherichia coli K-12 MG1655 section 333 ... 38 4.3
gb|AE000404.1|AE000404 Escherichia coli K-12 MG1655 section 294 ... 38 4.3
gb|AE000369.1|AE000369 Escherichia coli K-12 MG1655 section 259 ... 38 4.3
gb|AE000287.1|AE000287 Escherichia coli K-12 MG1655 section 177 ... 38 4.3
gb|AE000283.1|AE000283 Escherichia coli K-12 MG1655 section 173 ... 38 4.3
gb|AE000253.1|AE000253 Escherichia coli K-12 MG1655 section 143 ... 38 4.3
gb|AE000201.1|AE000201 Escherichia coli K-12 MG1655 section 91 o... 38 4.3
>gb|AE000450.1|AE000450 Escherichia coli K-12 MG1655 section 340 of 400 of the complete genome
Length = 11414
Score = 60.0 bits (30), Expect = 1e-06
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 79116 gacatcatcgccattctgggaatggatgaactgtctga 79153
|||||||||||||| ||||| |||||||||||||||||
Sbjct: 4712 gacatcatcgccatcctgggtatggatgaactgtctga 4675
Score = 40.1 bits (20), Expect = 1.1
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 78617 tggccagatgaacgagcccccggg 78640
|||||||||||||||||| |||||
Sbjct: 5208 tggccagatgaacgagccgccggg 5185
>gb|AE000359.1|AE000359 Escherichia coli K-12 MG1655 section 249 of 400 of the complete genome
Length = 11001
Score = 48.1 bits (24), Expect = 0.004
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 193000 tgttgctgctgttgcagattgctg 193023
||||||||||||||||||||||||
Sbjct: 10696 tgttgctgctgttgcagattgctg 10673
>gb|AE000281.1|AE000281 Escherichia coli K-12 MG1655 section 171 of 400 of the complete genome
Length = 11855
Score = 40.1 bits (20), Expect = 1.1
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 211974 ataaatatgtgcaccattagtaac 211997
|||||||||||| |||||||||||
Sbjct: 3068 ataaatatgtgcgccattagtaac 3091
>gb|AE000274.1|AE000274 Escherichia coli K-12 MG1655 section 164 of 400 of the complete genome
Length = 13793
Score = 40.1 bits (20), Expect = 1.1
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 227803 ctggagatgctggaaatgctcact 227826
|||||||||||||||||| |||||
Sbjct: 3532 ctggagatgctggaaatggtcact 3555
>gb|AE000117.1|AE000117 Escherichia coli K-12 MG1655 section 7 of 400 of the complete genome
Length = 13416
Score = 40.1 bits (20), Expect = 1.1
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 2754 gctgctgctgttgctgccac 2773
||||||||||||||||||||
Sbjct: 3441 gctgctgctgttgctgccac 3422
>gb|AE000502.1|AE000502 Escherichia coli K-12 MG1655 section 392 of 400 of the complete genome
Length = 11313
Score = 38.2 bits (19), Expect = 4.3
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 171913 ttttatgtagattttacttgtta 171935
|||||||| ||||||||||||||
Sbjct: 428 ttttatgttgattttacttgtta 450
>gb|AE000454.1|AE000454 Escherichia coli K-12 MG1655 section 344 of 400 of the complete genome
Length = 12175
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 176663 agacaaatttatgagcgtt 176681
|||||||||||||||||||
Sbjct: 9769 agacaaatttatgagcgtt 9751
>gb|AE000443.1|AE000443 Escherichia coli K-12 MG1655 section 333 of 400 of the complete genome
Length = 11577
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 160348 gcatttgttgtttgcggac 160366
|||||||||||||||||||
Sbjct: 8826 gcatttgttgtttgcggac 8844
>gb|AE000404.1|AE000404 Escherichia coli K-12 MG1655 section 294 of 400 of the complete genome
Length = 14000
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 193629 ttagcgaccaccacgtcgg 193647
|||||||||||||||||||
Sbjct: 13496 ttagcgaccaccacgtcgg 13478
>gb|AE000369.1|AE000369 Escherichia coli K-12 MG1655 section 259 of 400 of the complete genome
Length = 9720
Score = 38.2 bits (19), Expect = 4.3
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 50797 catcaatattattgaatatttca 50819
||||| |||||||||||||||||
Sbjct: 869 catcactattattgaatatttca 847
>gb|AE000287.1|AE000287 Escherichia coli K-12 MG1655 section 177 of 400 of the complete genome
Length = 10876
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 94068 tcaccagccagccgctgcc 94086
|||||||||||||||||||
Sbjct: 443 tcaccagccagccgctgcc 461
>gb|AE000283.1|AE000283 Escherichia coli K-12 MG1655 section 173 of 400 of the complete genome
Length = 10857
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 104663 acgttagcggcactgactc 104681
|||||||||||||||||||
Sbjct: 893 acgttagcggcactgactc 875
>gb|AE000253.1|AE000253 Escherichia coli K-12 MG1655 section 143 of 400 of the complete genome
Length = 10582
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 191578 cgttgaaaatggaaatctt 191596
|||||||||||||||||||
Sbjct: 2595 cgttgaaaatggaaatctt 2577
>gb|AE000201.1|AE000201 Escherichia coli K-12 MG1655 section 91 of 400 of the complete genome
Length = 11275
Score = 38.2 bits (19), Expect = 4.3
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 249230 tggctgctgctccagttgt 249248
|||||||||||||||||||
Sbjct: 2297 tggctgctgctccagttgt 2315
Database: ecoli.nt
Posted date: Jun 14, 2001 3:27 PM
Number of letters in database: 4,662,239
Number of sequences in database: 400
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 592338
Number of Sequences: 400
Number of extensions: 592338
Number of successful extensions: 42599
Number of sequences better than 10.0: 14
length of query: 283821
length of database: 4,662,239
effective HSP length: 20
effective length of query: 283801
effective length of database: 4,654,239
effective search space: 1320877682439
effective search space used: 1320877682439
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 10 (19.8 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
|