1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505
|
BLASTN 2.2.1 [Apr-13-2001]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
RID: 1012577175-3730-28291
Query=
(60 letters)
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
1,083,200 sequences; 4,677,375,331 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY052359.1| Arabidopsis thaliana At2g17400 mRNA, complete cds 96 3e-18
gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II sectio... 96 3e-18
gb|AF132318.1|AF132318 Buchnera aphidicola phosphoribosyl anthra... 42 0.040
gb|AC024791.1| Caenorhabditis elegans cosmid Y47G6A, complete se... 36 2.5
gb|AC017078.8| Homo sapiens BAC clone RP11-457N9 from 2, complet... 36 2.5
gb|AC005046.3|AC005046 Homo sapiens BAC clone CTB-13F3 from 7q22... 36 2.5
gb|AC006017.2|AC006017 Homo sapiens PAC clone RP5-981O7 from 7q3... 36 2.5
dbj|AP001519.1|AP001519 Bacillus halodurans genomic DNA, section... 36 2.5
gb|AC095064.3| Homo sapiens chromosome 4 clone RP11-620C21, comp... 34 9.7
gb|AC003029.3| Homo sapiens Chromosome 12q24 PAC RP3-462E2 (Rosw... 34 9.7
gb|AC079248.5| Homo sapiens BAC clone RP11-24J11 from 2, complet... 34 9.7
gb|AC093865.2| Homo sapiens chromosome 2 clone RP11-560C24, comp... 34 9.7
gb|AC010202.6|AC010202 Homo sapiens 12q BAC RP11-210L7 (Roswell ... 34 9.7
gb|AC017118.3|AC017118 Genomic sequence for Arabidopsis thaliana... 34 9.7
emb|AL355520.8|AL355520 Human DNA sequence from clone RP4-595C2 ... 34 9.7
emb|AL137879.15|AL137879 Human DNA sequence from clone RP11-153O... 34 9.7
gb|AC006395.1|AC006395 Homo sapiens PAC clone RP3-394H4 from Xq2... 34 9.7
gb|AE000650.1|AE000650 Helicobacter pylori 26695 section 128 of ... 34 9.7
gb|AC006924.3|AC006924 Homo sapiens, clone hRPK.32_A_1, complete... 34 9.7
gb|AC006266.1|AC006266 Arabidopsis thaliana BAC F1K3 from chromo... 34 9.7
gb|U32797.1|U32797 Haemophilus influenzae Rd section 112 of 163 ... 34 9.7
emb|AJ286341.1|HIM286341 Human immunodeficiency virus type 1 pro... 34 9.7
emb|AL161561.2|ATCHRIV61 Arabidopsis thaliana DNA chromosome 4, ... 34 9.7
emb|AL161508.2|ATCHRIV20 Arabidopsis thaliana DNA chromosome 4, ... 34 9.7
emb|AL035356.1|ATF22K18 Arabidopsis thaliana DNA chromosome 4, B... 34 9.7
emb|AJ132676.1|MMU132676 Mus musculus IgVk gh33r pseudogene 34 9.7
emb|AJ132673.1|MMU132673 Mus musculus IgVk gd33r pseudogene 34 9.7
emb|AJ132672.1|MMU132672 Mus musculus IgVk gc33r pseudogene 34 9.7
emb|Z74955.1|SCYOR047C S.cerevisiae chromosome XV reading frame ... 34 9.7
emb|Z74954.1|SCYOR046C S.cerevisiae chromosome XV reading frame ... 34 9.7
gb|U28135.1|SCU28135 Saccharomyces cerevisiae DEAD-Box Protein 5... 34 9.7
ALIGNMENTS
>gb|AY052359.1| Arabidopsis thaliana At2g17400 mRNA, complete cds
Length = 2826
Score = 95.6 bits (48), Expect = 3e-18
Identities = 58/60 (96%), Gaps = 1/60 (1%)
Strand = Plus / Plus
Query: 1 aggaatgctgtttaattggaatcgtacaatggagaatttgacggaaatagaatcaacgat 60
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 154 aggaatgctgtttaattggaatca-acaatggagaatttgacggaaatagaatcaacgat 212
>gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II section 100 of 255 of the complete
sequence. Sequence from clones T23A1, F5J6, MJB20
Length = 76170
Score = 95.6 bits (48), Expect = 3e-18
Identities = 58/60 (96%), Gaps = 1/60 (1%)
Strand = Plus / Plus
Query: 1 aggaatgctgtttaattggaatcgtacaatggagaatttgacggaaatagaatcaacgat 60
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 60659 aggaatgctgtttaattggaatca-acaatggagaatttgacggaaatagaatcaacgat 60717
>gb|AF132318.1|AF132318 Buchnera aphidicola phosphoribosyl anthranilate transferase (trpD),
phosphoribosyl anthranilate isomerase/indoleglycerol
phosphate synthetase fusion (trpC/F), beta subunit of
tryptophan synthetase (trpB), and alpha subunit of
tryptophan synthetase (trp>
Length = 5383
Score = 42.1 bits (21), Expect = 0.040
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 35 aatttgacggaaatagaatca 55
|||||||||||||||||||||
Sbjct: 536 aatttgacggaaatagaatca 556
>gb|AC024791.1| Caenorhabditis elegans cosmid Y47G6A, complete sequence
Length = 194322
Score = 36.2 bits (18), Expect = 2.5
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 34 gaatttgacggaaataga 51
||||||||||||||||||
Sbjct: 193876 gaatttgacggaaataga 193859
>gb|AC017078.8| Homo sapiens BAC clone RP11-457N9 from 2, complete sequence
Length = 193979
Score = 36.2 bits (18), Expect = 2.5
Identities = 24/26 (92%)
Strand = Plus / Plus
Query: 3 gaatgctgtttaattggaatcgtaca 28
||||| ||||||| ||||||||||||
Sbjct: 142900 gaatgttgtttaaatggaatcgtaca 142925
>gb|AC005046.3|AC005046 Homo sapiens BAC clone CTB-13F3 from 7q22, complete sequence
Length = 219436
Score = 36.2 bits (18), Expect = 2.5
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 13 taattggaatcgtacaat 30
||||||||||||||||||
Sbjct: 46649 taattggaatcgtacaat 46666
>gb|AC006017.2|AC006017 Homo sapiens PAC clone RP5-981O7 from 7q34-q36, complete sequence
Length = 162556
Score = 36.2 bits (18), Expect = 2.5
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 13 taattggaatcgtacaat 30
||||||||||||||||||
Sbjct: 114940 taattggaatcgtacaat 114923
>dbj|AP001519.1|AP001519 Bacillus halodurans genomic DNA, section 13/14
Length = 303650
Score = 36.2 bits (18), Expect = 2.5
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 30 tggagaatttgacggaaa 47
||||||||||||||||||
Sbjct: 28875 tggagaatttgacggaaa 28858
>gb|AC095064.3| Homo sapiens chromosome 4 clone RP11-620C21, complete sequence
Length = 87943
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 12 ttaattggaatcgtaca 28
|||||||||||||||||
Sbjct: 42346 ttaattggaatcgtaca 42362
>gb|AC003029.3| Homo sapiens Chromosome 12q24 PAC RP3-462E2 (Roswell Park Cancer
Institute Human PAC library) complete sequence
Length = 137830
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 24 gtacaatggagaatttg 40
|||||||||||||||||
Sbjct: 71491 gtacaatggagaatttg 71507
>gb|AC079248.5| Homo sapiens BAC clone RP11-24J11 from 2, complete sequence
Length = 128535
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 6 tgctgtttaattggaat 22
|||||||||||||||||
Sbjct: 111999 tgctgtttaattggaat 111983
>gb|AC093865.2| Homo sapiens chromosome 2 clone RP11-560C24, complete sequence
Length = 186218
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 5 atgctgtttaattggaa 21
|||||||||||||||||
Sbjct: 113514 atgctgtttaattggaa 113530
>gb|AC010202.6|AC010202 Homo sapiens 12q BAC RP11-210L7 (Roswell Park Cancer Institute Human
BAC Library) complete sequence
Length = 170004
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 4 aatgctgtttaattgga 20
|||||||||||||||||
Sbjct: 95294 aatgctgtttaattgga 95310
>gb|AC017118.3|AC017118 Genomic sequence for Arabidopsis thaliana BAC F6N18 from chromosome I,
complete sequence
Length = 92219
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 14 aattggaatcgtacaat 30
|||||||||||||||||
Sbjct: 84400 aattggaatcgtacaat 84416
>emb|AL355520.8|AL355520 Human DNA sequence from clone RP4-595C2 on chromosome 1q24.1-25.3
Contains ESTs, STSs and GSSs. Contains the 3' part of the
gene for two isoforms of the KIAA0351 protein and the gene
for angiopoietin Y1, complete sequence [Homo sapiens]
Length = 157575
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 5 atgctgtttaattggaa 21
|||||||||||||||||
Sbjct: 80465 atgctgtttaattggaa 80481
>emb|AL137879.15|AL137879 Human DNA sequence from clone RP11-153O23 on chromosome 13, complete
sequence [Homo sapiens]
Length = 85149
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 25 tacaatggagaatttga 41
|||||||||||||||||
Sbjct: 41783 tacaatggagaatttga 41799
>gb|AC006395.1|AC006395 Homo sapiens PAC clone RP3-394H4 from Xq23, complete sequence
Length = 72291
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 1 aggaatgctgtttaatt 17
|||||||||||||||||
Sbjct: 40047 aggaatgctgtttaatt 40063
>gb|AE000650.1|AE000650 Helicobacter pylori 26695 section 128 of 134 of the complete genome
Length = 11043
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 36 atttgacggaaatagaa 52
|||||||||||||||||
Sbjct: 1772 atttgacggaaatagaa 1756
>gb|AC006924.3|AC006924 Homo sapiens, clone hRPK.32_A_1, complete sequence
Length = 165633
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 4 aatgctgtttaattgga 20
|||||||||||||||||
Sbjct: 11360 aatgctgtttaattgga 11344
>gb|AC006266.1|AC006266 Arabidopsis thaliana BAC F1K3 from chromosome IV near 21 cM, complete
sequence
Length = 105680
Score = 34.2 bits (17), Expect = 9.7
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 20 aatcgtacaatggagaatttg 40
||||||||||||||| |||||
Sbjct: 52077 aatcgtacaatggagtatttg 52057
>gb|U32797.1|U32797 Haemophilus influenzae Rd section 112 of 163 of the complete genome
Length = 10274
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 26 acaatggagaatttgac 42
|||||||||||||||||
Sbjct: 2447 acaatggagaatttgac 2431
>emb|AJ286341.1|HIM286341 Human immunodeficiency virus type 1 proviral env gene for gp160,
genomic RNA, isolate M2424/4, clone 1
Length = 2586
Score = 34.2 bits (17), Expect = 9.7
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 7 gctgtttaattggaatcgtac 27
|||||||||||||||| ||||
Sbjct: 1176 gctgtttaattggaatagtac 1196
>emb|AL161561.2|ATCHRIV61 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 61
Length = 198402
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 44 gaaatagaatcaacgat 60
|||||||||||||||||
Sbjct: 146009 gaaatagaatcaacgat 146025
>emb|AL161508.2|ATCHRIV20 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 20
Length = 196517
Score = 34.2 bits (17), Expect = 9.7
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 20 aatcgtacaatggagaatttg 40
||||||||||||||| |||||
Sbjct: 180658 aatcgtacaatggagtatttg 180638
>emb|AL035356.1|ATF22K18 Arabidopsis thaliana DNA chromosome 4, BAC clone F22K18 (ESSAII project)
Length = 125803
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 44 gaaatagaatcaacgat 60
|||||||||||||||||
Sbjct: 102901 gaaatagaatcaacgat 102885
>emb|AJ132676.1|MMU132676 Mus musculus IgVk gh33r pseudogene
Length = 737
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 13 taattggaatcgtacaa 29
|||||||||||||||||
Sbjct: 317 taattggaatcgtacaa 301
>emb|AJ132673.1|MMU132673 Mus musculus IgVk gd33r pseudogene
Length = 813
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 13 taattggaatcgtacaa 29
|||||||||||||||||
Sbjct: 318 taattggaatcgtacaa 302
>emb|AJ132672.1|MMU132672 Mus musculus IgVk gc33r pseudogene
Length = 736
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 13 taattggaatcgtacaa 29
|||||||||||||||||
Sbjct: 318 taattggaatcgtacaa 302
>emb|Z74955.1|SCYOR047C S.cerevisiae chromosome XV reading frame ORF YOR047c
Length = 3461
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 24 gtacaatggagaatttg 40
|||||||||||||||||
Sbjct: 473 gtacaatggagaatttg 489
>emb|Z74954.1|SCYOR046C S.cerevisiae chromosome XV reading frame ORF YOR046c
Length = 2310
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 24 gtacaatggagaatttg 40
|||||||||||||||||
Sbjct: 1605 gtacaatggagaatttg 1621
>gb|U28135.1|SCU28135 Saccharomyces cerevisiae DEAD-Box Protein 5 (DBP5) gene, complete cds
Length = 3696
Score = 34.2 bits (17), Expect = 9.7
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 24 gtacaatggagaatttg 40
|||||||||||||||||
Sbjct: 1212 gtacaatggagaatttg 1196
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
Posted date: Jan 31, 2002 11:56 PM
Number of letters in database: 382,408,035
Number of sequences in database: 1,083,200
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 117,267
Number of Sequences: 1083200
Number of extensions: 117267
Number of successful extensions: 7699
Number of sequences better than 10.0: 31
length of query: 60
length of database: 4,677,375,331
effective HSP length: 19
effective length of query: 41
effective length of database: 4,656,794,531
effective search space: 190928575771
effective search space used: 190928575771
T: 0
A: 30
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)
|