1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443
|
BLASTN 2.2.6 [Apr-09-2003]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= human
(179 letters)
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
1,787,533 sequences; -24,016,349 total letters
Searching... please wait.. done
Score E
Sequences producing significant alignments: (bits) Value
gb|J00265.1|HUMINS01 Human insulin gene, complete cds 355 2e-95
emb|V00565.1|HSINSU Human gene for preproinsulin, from chromosom... 355 2e-95
gb|M10039.1|HUMINSPR Human alpha-type insulin gene and 5' flanki... 355 2e-95
gb|L15440.1|HUMINSTHIG Homo sapiens tyrosine hydroxylase (TH) ge... 355 2e-95
gb|AC132217.15| Homo sapiens chromosome 11, clone RP11-889I17, c... 347 4e-93
gb|AC130303.8| Homo sapiens chromosome 11, clone RP4-539G11, com... 347 4e-93
gb|AY138590.1|AY138589S2 Homo sapiens insulin (INS) gene, exons ... 347 4e-93
emb|AJ009655.1|HSA9655 Homo sapiens ins gene, partial 347 4e-93
gb|AY137497.1|AY137496S2 Pan troglodytes insulin precursor (INS)... 339 9e-91
emb|X61089.1|PTPPINS P.troglodytes gene for preproinsulin 315 1e-83
gb|AY137500.1|AY137498S3 Gorilla gorilla insulin precursor (INS)... 262 2e-67
gb|AY137503.1|AY137501S3 Pongo pygmaeus insulin precursor (INS) ... 222 1e-55
emb|X61092.1|CEPPINS C.aethiops gene for preproinsulin 129 2e-27
>gb|J00265.1|HUMINS01 Human insulin gene, complete cds
Length = 4044
Score = 355 bits (179), Expect = 2e-95
Identities = 179/179 (100%)
Strand = Plus / Plus
Query: 1 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2228 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 2287
Query: 61 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2288 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 2347
Query: 121 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 179
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2348 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 2406
>emb|V00565.1|HSINSU Human gene for preproinsulin, from chromosome 11. Includes a highly
polymorphic region upstream from the insulin gene
containing tandemly repeated sequences
Length = 4992
Score = 355 bits (179), Expect = 2e-95
Identities = 179/179 (100%)
Strand = Plus / Plus
Query: 1 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2228 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 2287
Query: 61 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2288 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 2347
Query: 121 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 179
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2348 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 2406
>gb|M10039.1|HUMINSPR Human alpha-type insulin gene and 5' flanking polymorphic region
Length = 3943
Score = 355 bits (179), Expect = 2e-95
Identities = 179/179 (100%)
Strand = Plus / Plus
Query: 1 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2503 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 2562
Query: 61 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2563 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 2622
Query: 121 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 179
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2623 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 2681
>gb|L15440.1|HUMINSTHIG Homo sapiens tyrosine hydroxylase (TH) gene, 3' end; insulin (INS)
gene, complete cds; insulin-like growth factor 2 (IGF2)
gene, 5' end
Length = 12565
Score = 355 bits (179), Expect = 2e-95
Identities = 179/179 (100%)
Strand = Plus / Plus
Query: 1 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4289 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 4348
Query: 61 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4349 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 4408
Query: 121 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 179
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4409 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 4467
>gb|AC132217.15| Homo sapiens chromosome 11, clone RP11-889I17, complete sequence
Length = 170027
Score = 347 bits (175), Expect = 4e-93
Identities = 178/179 (99%)
Strand = Plus / Plus
Query: 1 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 60
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 86461 gtctgttccaagggcctttgcgtcaggtgggctcaggattccagggtggctggaccccag 86520
Query: 61 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86521 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 86580
Query: 121 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 179
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86581 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 86639
>gb|AC130303.8| Homo sapiens chromosome 11, clone RP4-539G11, complete sequence
Length = 171366
Score = 347 bits (175), Expect = 4e-93
Identities = 178/179 (99%)
Strand = Plus / Plus
Query: 1 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 127800 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 127859
Query: 61 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 127860 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 127919
Query: 121 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 179
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 127920 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtcacccag 127978
>gb|AY138590.1|AY138589S2 Homo sapiens insulin (INS) gene, exons 1, 2, 3, and complete cds;
and insulin-like growth factor (IGF2) gene, exon 1
Length = 4233
Score = 347 bits (175), Expect = 4e-93
Identities = 178/179 (99%)
Strand = Plus / Plus
Query: 1 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 378 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 437
Query: 61 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 438 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 497
Query: 121 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 179
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 498 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtcacccag 556
>emb|AJ009655.1|HSA9655 Homo sapiens ins gene, partial
Length = 1393
Score = 347 bits (175), Expect = 4e-93
Identities = 178/179 (99%)
Strand = Plus / Plus
Query: 1 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 65
Query: 61 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 120
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 66 gccccagctgtgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 125
Query: 121 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 179
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 126 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 184
>gb|AY137497.1|AY137496S2 Pan troglodytes insulin precursor (INS) gene, complete cds
Length = 4124
Score = 339 bits (171), Expect = 9e-91
Identities = 177/179 (98%)
Strand = Plus / Plus
Query: 1 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 338 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 397
Query: 61 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 120
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 398 gccccagctctgcagcagggaggacgtggctgggctcttgaagcatgtgggggtgagccc 457
Query: 121 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 179
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 458 aggggccccaaggcagggcacctggccttcagccggcctcagccctgcctgtctcccag 516
>emb|X61089.1|PTPPINS P.troglodytes gene for preproinsulin
Length = 2483
Score = 315 bits (159), Expect = 1e-83
Identities = 175/179 (97%), Gaps = 1/179 (0%)
Strand = Plus / Plus
Query: 1 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1028 gtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccag 1087
Query: 61 gccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtgggggtgagccc 120
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1088 gccccagctctgcagcagggaggacgtggctgggctcttgaagcatgtgggggtgagccc 1147
Query: 121 aggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccag 179
|||||||||||||||||||| || |||||||||| ||||||||||||||||||||||||
Sbjct: 1148 aggggccccaaggcagggcagct-gccttcagccggcctcagccctgcctgtctcccag 1205
>gb|AY137500.1|AY137498S3 Gorilla gorilla insulin precursor (INS) gene, complete cds
Length = 4146
Score = 262 bits (132), Expect = 2e-67
Identities = 141/144 (97%)
Strand = Plus / Plus
Query: 36 gggttccagggtggctggaccccaggccccagctctgcagcagggaggacgtggctgggc 95
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 389 gggttccagggtggctggaccccaggccccagctctgcagcagggaggacgtggctgggc 448
Query: 96 tcgtgaagcatgtgggggtgagcccaggggccccaaggcagggcacctggccttcagcct 155
|| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 449 tcttgaagcatgtgggggtgagcccaggggccccaaggcagggcaactggccttcagccg 508
Query: 156 gcctcagccctgcctgtctcccag 179
||||||||||||||||||||||||
Sbjct: 509 gcctcagccctgcctgtctcccag 532
>gb|AY137503.1|AY137501S3 Pongo pygmaeus insulin precursor (INS) gene, complete cds
Length = 4126
Score = 222 bits (112), Expect = 1e-55
Identities = 136/144 (94%)
Strand = Plus / Plus
Query: 36 gggttccagggtggctggaccccaggccccagctctgcagcagggaggacgtggctgggc 95
||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||
Sbjct: 384 gggttccagggtggctggaccccaggctccagctctgcagctgggaggacgtggctgggc 443
Query: 96 tcgtgaagcatgtgggggtgagcccaggggccccaaggcagggcacctggccttcagcct 155
|| |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 444 tcttgaagcatttgggggtgagcccaggggccccagggcagggcacctggccttcagccg 503
Query: 156 gcctcagccctgcctgtctcccag 179
||||||| |||||||||||||||
Sbjct: 504 acctcagctctgcctgtctcccag 527
>emb|X61092.1|CEPPINS C.aethiops gene for preproinsulin
Length = 1909
Score = 129 bits (65), Expect = 2e-27
Identities = 86/93 (92%)
Strand = Plus / Plus
Query: 36 gggttccagggtggctggaccccaggccccagctctgcagcagggaggacgtggctgggc 95
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||
Sbjct: 514 gggttccagggtggctggaccccaggccccagctctgcaacagggaggacatggctgggc 573
Query: 96 tcgtgaagcatgtgggggtgagcccaggggccc 128
|| |||||| | || |||||| |||||||||||
Sbjct: 574 tcttgaagcgtttgagggtgaacccaggggccc 606
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
Posted date: Jul 31, 2003 1:26 AM
Number of letters in database: 192,913,178
Number of sequences in database: 1,867,771
Lambda K H
1.37 0.711 0.00
Gapped
Lambda K H
1.37 0.711 7.29e-304
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,670,626
Number of Sequences: 1867771
Number of extensions: 1670626
Number of successful extensions: 118444
Number of sequences better than 1.0e-20: 13
Number of HSP's better than 0.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 118410
Number of HSP's gapped (non-prelim): 33
length of query: 179
length of database: 8,782,847,770
effective HSP length: 20
effective length of query: 159
effective length of database: 8,745,492,350
effective search space: 1390533283650
effective search space used: 1390533283650
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 54 (107.5 bits)
Query= owlmonkey
(180 letters)
Searching... please wait.. done
Score E
Sequences producing significant alignments: (bits) Value
gb|J02989.1|ATRINS Owl monkey (A.trivirgatus) insulin gene, comp... 357 4e-96
>gb|J02989.1|ATRINS Owl monkey (A.trivirgatus) insulin gene, complete cds
Length = 2113
Score = 357 bits (180), Expect = 4e-96
Identities = 180/180 (100%)
Strand = Plus / Plus
Query: 1 gtctgttccaagggccttcgagccagtctgggccccagggctgccccactcggggttcca 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 551 gtctgttccaagggccttcgagccagtctgggccccagggctgccccactcggggttcca 610
Query: 61 gagcagttggaccccaggtctcagcgggagggtgtggctgggctctgaagcatttgggtg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 611 gagcagttggaccccaggtctcagcgggagggtgtggctgggctctgaagcatttgggtg 670
Query: 121 agcccaggggctcagggcagggcacctgccttcagcggcctcagcctgcctgtctcccag 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 671 agcccaggggctcagggcagggcacctgccttcagcggcctcagcctgcctgtctcccag 730
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
or phase 0, 1 or 2 HTGS sequences)
Posted date: Jul 31, 2003 1:26 AM
Number of letters in database: 192,913,178
Number of sequences in database: 1,867,771
Lambda K H
1.37 0.711 0.00
Gapped
Lambda K H
1.37 0.711 7.29e-304
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 910,717
Number of Sequences: 1867771
Number of extensions: 910717
Number of successful extensions: 72147
Number of sequences better than 1.0e-20: 1
Number of HSP's better than 0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72146
Number of HSP's gapped (non-prelim): 1
length of query: 180
length of database: 8,782,847,770
effective HSP length: 20
effective length of query: 160
effective length of database: 8,745,492,350
effective search space: 1399278776000
effective search space used: 1399278776000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 54 (107.5 bits)
|