1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968
|
#
# bioperl module for Bio::PrimarySeq
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Ewan Birney <birney@ebi.ac.uk>
#
# Copyright Ewan Birney
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
=head1 NAME
Bio::PrimarySeq - Bioperl lightweight sequence object
=head1 SYNOPSIS
# Bio::SeqIO for file reading, Bio::DB::GenBank for
# database reading
use Bio::Seq;
use Bio::SeqIO;
use Bio::DB::GenBank;
# make from memory
$seqobj = Bio::PrimarySeq->new (
-seq => 'ATGGGGTGGGCGGTGGGTGGTTTG',
-id => 'GeneFragment-12',
-accession_number => 'X78121',
-alphabet => 'dna',
-is_circular => 1,
);
print "Sequence ", $seqobj->id(), " with accession ",
$seqobj->accession_number, "\n";
# read from file
$inputstream = Bio::SeqIO->new(
-file => "myseq.fa",
-format => 'Fasta',
);
$seqobj = $inputstream->next_seq();
print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n";
# to get out parts of the sequence.
print "Sequence ", $seqobj->id(), " with accession ",
$seqobj->accession_number, " and desc ", $seqobj->desc, "\n";
$string = $seqobj->seq();
$string2 = $seqobj->subseq(1,40);
=head1 DESCRIPTION
PrimarySeq is a lightweight sequence object, storing the sequence, its
name, a computer-useful unique name, and other fundamental attributes.
It does not contain sequence features or other information. To have a
sequence with sequence features you should use the Seq object which uses
this object.
Although new users will use Bio::PrimarySeq a lot, in general you will
be using it from the Bio::Seq object. For more information on Bio::Seq
see L<Bio::Seq>. For interest you might like to know that
Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls
to do with sequence to it (the has-a relationship lets us get out of a
otherwise nasty cyclical reference in Perl which would leak memory).
Sequence objects are defined by the Bio::PrimarySeqI interface, and this
object is a pure Perl implementation of the interface. If that's
gibberish to you, don't worry. The take home message is that this
object is the bioperl default sequence object, but other people can
use their own objects as sequences if they so wish. If you are
interested in wrapping your own objects as compliant Bioperl sequence
objects, then you should read the Bio::PrimarySeqI documentation
The documentation of this object is a merge of the Bio::PrimarySeq and
Bio::PrimarySeqI documentation. This allows all the methods which you can
call on sequence objects here.
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
web:
https://github.com/bioperl/bioperl-live/issues
=head1 AUTHOR - Ewan Birney
Email birney@ebi.ac.uk
=head1 APPENDIX
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
=cut
package Bio::PrimarySeq;
$Bio::PrimarySeq::VERSION = '1.7.8';
use strict;
our $MATCHPATTERN = 'A-Za-z\-\.\*\?=~';
our $GAP_SYMBOLS = '-~';
use base qw(Bio::Root::Root Bio::PrimarySeqI
Bio::IdentifiableI Bio::DescribableI);
# Setup the allowed values for alphabet()
my %valid_type = map {$_, 1} qw( dna rna protein );
=head2 new
Title : new
Usage : $seqobj = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT',
-id => 'human_id',
-accession_number => 'AL000012',
);
Function: Returns a new primary seq object from
basic constructors, being a string for the sequence
and strings for id and accession_number.
Note that you can provide an empty sequence string. However, in
this case you MUST specify the type of sequence you wish to
initialize by the parameter -alphabet. See alphabet() for possible
values.
Returns : a new Bio::PrimarySeq object
Args : -seq => sequence string
-ref_to_seq => ... or reference to a sequence string
-display_id => display id of the sequence (locus name)
-accession_number => accession number
-primary_id => primary id (Genbank id)
-version => version number
-namespace => the namespace for the accession
-authority => the authority for the namespace
-description => description text
-desc => alias for description
-alphabet => skip alphabet guess and set it to dna, rna or protein
-id => alias for display id
-is_circular => boolean to indicate that sequence is circular
-direct => boolean to directly set sequences. The next time -seq,
seq() or -ref_to_seq is use, the sequence will not be
validated. Be careful with this...
-nowarnonempty => boolean to avoid warning when sequence is empty
=cut
sub new {
my ($class, @args) = @_;
my $self = $class->SUPER::new(@args);
my ($seq, $id, $acc, $pid, $ns, $auth, $v, $oid, $desc, $description,
$alphabet, $given_id, $is_circular, $direct, $ref_to_seq, $len,
$nowarnonempty) =
$self->_rearrange([qw(SEQ
DISPLAY_ID
ACCESSION_NUMBER
PRIMARY_ID
NAMESPACE
AUTHORITY
VERSION
OBJECT_ID
DESC
DESCRIPTION
ALPHABET
ID
IS_CIRCULAR
DIRECT
REF_TO_SEQ
LENGTH
NOWARNONEMPTY
)],
@args);
# Private var _nowarnonempty, needs to be set before calling _guess_alphabet
$self->{'_nowarnonempty'} = $nowarnonempty;
$self->{'_direct'} = $direct;
if( defined $id && defined $given_id ) {
if( $id ne $given_id ) {
$self->throw("Provided both id and display_id constructors: [$id] [$given_id]");
}
}
if( defined $given_id ) { $id = $given_id; }
# Bernd's idea: set ids now for more informative invalid sequence messages
defined $id && $self->display_id($id);
$acc && $self->accession_number($acc);
defined $pid && $self->primary_id($pid);
# Set alphabet now to avoid guessing it later, when sequence is set
$alphabet && $self->alphabet($alphabet);
# Set the length before the seq. If there is a seq, length will be updated later
$self->{'length'} = $len || 0;
# Set the sequence (but also alphabet and length)
if ($ref_to_seq) {
$self->_set_seq_by_ref($ref_to_seq, $alphabet);
} else {
if (defined $seq) {
# Note: the sequence string may be empty
$self->seq($seq);
}
}
$desc && $self->desc($desc);
$description && $self->description($description);
$ns && $self->namespace($ns);
$auth && $self->authority($auth);
# Any variable that can have a value "0" must be tested with defined
# or it will fail to be added to the new object
defined($v) && $self->version($v);
defined($oid) && $self->object_id($oid);
defined($is_circular) && $self->is_circular($is_circular);
return $self;
}
=head2 seq
Title : seq
Usage : $string = $seqobj->seq();
Function: Get or set the sequence as a string of letters. The case of
the letters is left up to the implementer. Suggested cases are
upper case for proteins and lower case for DNA sequence (IUPAC
standard), but you should not rely on this. An error is thrown if
the sequence contains invalid characters: see validate_seq().
Returns : A scalar
Args : - Optional new sequence value (a string) to set
- Optional alphabet (it is guessed by default)
=cut
sub seq {
my ($self, @args) = @_;
if( scalar @args == 0 ) {
return $self->{'seq'};
}
my ($seq_str, $alphabet) = @args;
if (@args) {
$self->_set_seq_by_ref(\$seq_str, $alphabet);
}
return $self->{'seq'};
}
sub _set_seq_by_ref {
# Set a sequence by reference. A reference is used to avoid the cost of
# copying the sequence (which can be very large) between functions.
my ($self, $seq_str_ref, $alphabet) = @_;
# Validate sequence if sequence is not empty and we are not in direct mode
if ( (! $self->{'_direct'}) && (defined $$seq_str_ref) ) {
$self->validate_seq($$seq_str_ref, 1);
}
delete $self->{'_direct'}; # next sequence will have to be validated
# Record sequence length
my $len = CORE::length($$seq_str_ref || '');
my $is_changed_seq = (exists $self->{'seq'}) && ($len > 0);
# Note: if the new seq is empty or undef, this is not considered a change
delete $self->{'_freeze_length'} if $is_changed_seq;
$self->{'length'} = $len if not exists $self->{'_freeze_length'};
# Set sequence
$self->{'seq'} = $$seq_str_ref;
# Set or guess alphabet
if ($alphabet) {
# Alphabet specified, set it no matter what
$self->alphabet($alphabet);
} elsif ($is_changed_seq || (! defined($self->alphabet()))) {
# If we changed a previous sequence to a new one or if there is no
# alphabet yet at all, we need to guess the (possibly new) alphabet
$self->_guess_alphabet();
} # else (seq not changed and alphabet was defined) do nothing
return 1;
}
=head2 validate_seq
Title : validate_seq
Usage : if(! $seqobj->validate_seq($seq_str) ) {
print "sequence $seq_str is not valid for an object of
alphabet ",$seqobj->alphabet, "\n";
}
Function: Test that the given sequence is valid, i.e. contains only valid
characters. The allowed characters are all letters (A-Z) and '-','.',
'*','?','=' and '~'. Spaces are not valid. Note that this
implementation does not take alphabet() into account and that empty
sequences are considered valid.
Returns : 1 if the supplied sequence string is valid, 0 otherwise.
Args : - Sequence string to be validated
- Boolean to optionally throw an error if the sequence is invalid
=cut
sub validate_seq {
my ($self, $seqstr, $throw) = @_;
if ( (defined $seqstr ) &&
($seqstr !~ /^[$MATCHPATTERN]*$/) ) {
if ($throw) {
$self->throw("Failed validation of sequence '".(defined($self->id) ||
'[unidentified sequence]')."'. Invalid characters were: " .
join('',($seqstr =~ /[^$MATCHPATTERN]/g)));
}
return 0;
}
return 1;
}
=head2 subseq
Title : subseq
Usage : $substring = $seqobj->subseq(10,40);
$substring = $seqobj->subseq(10,40,'nogap');
$substring = $seqobj->subseq(-start=>10, -end=>40, -replace_with=>'tga');
$substring = $seqobj->subseq($location_obj);
$substring = $seqobj->subseq($location_obj, -nogap => 1);
Function: Return the subseq from start to end, where the first sequence
character has coordinate 1 number is inclusive, ie 1-2 are the
first two characters of the sequence. The given start coordinate
has to be larger than the end, even if the sequence is circular.
Returns : a string
Args : integer for start position
integer for end position
OR
Bio::LocationI location for subseq (strand honored)
Specify -NOGAP=>1 to return subseq with gap characters removed
Specify -REPLACE_WITH=>$new_subseq to replace the subseq returned
with $new_subseq in the sequence object
=cut
sub subseq {
my $self = shift;
my @args = @_;
my ($start, $end, $nogap, $replace) = $self->_rearrange([qw(START
END
NOGAP
REPLACE_WITH)], @args);
# If -replace_with is specified, validate the replacement sequence
if (defined $replace) {
$self->validate_seq( $replace ) ||
$self->throw("Replacement sequence does not look valid");
}
if( ref($start) && $start->isa('Bio::LocationI') ) {
my $loc = $start;
my $seq = '';
# For Split objects if Guide Strand is negative,
# pass the sublocations in reverse
my $order = 0;
if ($loc->isa('Bio::Location::SplitLocationI')) {
# guide_strand can return undef, so don't compare directly
# to avoid 'uninitialized value' warning
my $guide_strand = defined ($loc->guide_strand) ? ($loc->guide_strand) : 0;
$order = ($guide_strand == -1) ? -1 : 0;
}
# Reversing order using ->each_Location(-1) does not work well for
# cut by origin-splits (like "complement(join(1900..END,START..50))"),
# so use "reverse" instead
my @sublocs = ($order == -1) ? reverse $loc->each_Location(): $loc->each_Location;
foreach my $subloc (@sublocs) {
my $piece = $self->subseq(-start => $subloc->start(),
-end => $subloc->end(),
-replace_with => $replace,
-nogap => $nogap);
$piece =~ s/[$GAP_SYMBOLS]//g if $nogap;
# strand can return undef, so don't compare directly
# to avoid 'uninitialized value' warning
my $strand = defined ($subloc->strand) ? ($subloc->strand) : 0;
if ($strand < 0) {
$piece = $self->_revcom_from_string($piece, $self->alphabet);
}
$seq .= $piece;
}
return $seq;
} elsif( defined $start && defined $end ) {
if( $start > $end ){
$self->throw("Bad start,end parameters. Start [$start] has to be ".
"less than end [$end]");
}
if( $start <= 0 ) {
$self->throw("Bad start parameter ($start). Start must be positive.");
}
# Remove one from start, and then length is end-start
$start--;
my $seqstr;
if (defined $replace) {
$seqstr = substr $self->{seq}, $start, $end-$start, $replace;
} else {
$seqstr = substr $self->{seq}, $start, $end-$start;
}
if ($end > $self->length) {
if ($self->is_circular) {
my $start = 0;
my $end = $end - $self->length;
my $appendstr;
if (defined $replace) {
$appendstr = substr $self->{seq}, $start, $end-$start, $replace;
} else {
$appendstr = substr $self->{seq}, $start, $end-$start;
}
$seqstr .= $appendstr;
} else {
$self->throw("Bad end parameter ($end). End must be less than ".
"the total length of sequence (total=".$self->length.")")
}
}
$seqstr =~ s/[$GAP_SYMBOLS]//g if ($nogap);
return $seqstr;
} else {
$self->warn("Incorrect parameters to subseq - must be two integers or ".
"a Bio::LocationI object. Got:", $self,$start,$end,$replace,$nogap);
return;
}
}
=head2 length
Title : length
Usage : $len = $seqobj->length();
Function: Get the stored length of the sequence in number of symbols (bases
or amino acids). In some circumstances, you can also set this attribute:
1. For empty sequences, you can set the length to anything you want:
my $seqobj = Bio::PrimarySeq->new( -length => 123 );
my $len = $seqobj->len; # 123
2. To save memory when using very long sequences, you can set the
length of the sequence to the length of the sequence (and nothing
else):
my $seqobj = Bio::PrimarySeq->new( -seq => 'ACGT...' ); # 1 Mbp sequence
# process $seqobj... then after you're done with it
$seqobj->length($seqobj->length);
$seqobj->seq(undef); # free memory!
my $len = $seqobj->len; # 1 Mbp
Note that if you set seq() to a value other than undef at any time,
the length attribute will be reset.
Returns : integer representing the length of the sequence.
Args : Optionally, the value on set
=cut
sub length {
my ($self, $val) = @_;
if (defined $val) {
my $len = $self->{'length'};
if ($len && ($len != $val)) {
$self->throw("Can not set the length to $val, current length value is $len");
}
$self->{'length'} = $val;
$self->{'_freeze_length'} = undef;
}
return $self->{'length'};
}
=head2 display_id
Title : display_id or display_name
Usage : $id_string = $seqobj->display_id();
Function: Get or set the display id, aka the common name of the sequence object.
The semantics of this is that it is the most likely string to
be used as an identifier of the sequence, and likely to have
"human" readability. The id is equivalent to the ID field of
the GenBank/EMBL databanks and the id field of the
Swissprot/sptrembl database. In fasta format, the >(\S+) is
presumed to be the id, though some people overload the id to
embed other information. Bioperl does not use any embedded
information in the ID field, and people are encouraged to use
other mechanisms (accession field for example, or extending
the sequence object) to solve this.
With the new Bio::DescribeableI interface, display_name aliases
to this method.
Returns : A string for the display ID
Args : Optional string for the display ID to set
=cut
sub display_id {
my ($self, $value) = @_;
if( defined $value) {
$self->{'display_id'} = $value;
}
return $self->{'display_id'};
}
=head2 accession_number
Title : accession_number or object_id
Usage : $unique_key = $seqobj->accession_number;
Function: Returns the unique biological id for a sequence, commonly
called the accession_number. For sequences from established
databases, the implementors should try to use the correct
accession number. Notice that primary_id() provides the
unique id for the implementation, allowing multiple objects
to have the same accession number in a particular implementation.
For sequences with no accession number, this method should
return "unknown".
[Note this method name is likely to change in 1.3]
With the new Bio::IdentifiableI interface, this is aliased
to object_id
Returns : A string
Args : A string (optional) for setting
=cut
sub accession_number {
my( $self, $acc ) = @_;
if (defined $acc) {
$self->{'accession_number'} = $acc;
} else {
$acc = $self->{'accession_number'};
$acc = 'unknown' unless defined $acc;
}
return $acc;
}
=head2 primary_id
Title : primary_id
Usage : $unique_key = $seqobj->primary_id;
Function: Returns the unique id for this object in this
implementation. This allows implementations to manage their
own object ids in a way the implementation can control
clients can expect one id to map to one object.
For sequences with no natural primary id, this method
should return a stringified memory location.
Returns : A string
Args : A string (optional, for setting)
=cut
sub primary_id {
my $self = shift;
if(@_) {
$self->{'primary_id'} = shift;
}
if( ! defined($self->{'primary_id'}) ) {
return "$self";
}
return $self->{'primary_id'};
}
=head2 alphabet
Title : alphabet
Usage : if( $seqobj->alphabet eq 'dna' ) { # Do something }
Function: Get/set the alphabet of sequence, one of
'dna', 'rna' or 'protein'. This is case sensitive.
This is not called <type> because this would cause
upgrade problems from the 0.5 and earlier Seq objects.
Returns : a string either 'dna','rna','protein'. NB - the object must
make a call of the type - if there is no alphabet specified it
has to guess.
Args : optional string to set : 'dna' | 'rna' | 'protein'
=cut
sub alphabet {
my ($self,$value) = @_;
if (defined $value) {
$value = lc $value;
unless ( $valid_type{$value} ) {
$self->throw("Alphabet '$value' is not a valid alphabet (".
join(',', map "'$_'", sort keys %valid_type) .") lowercase");
}
$self->{'alphabet'} = $value;
}
return $self->{'alphabet'};
}
=head2 desc
Title : desc or description
Usage : $seqobj->desc($newval);
Function: Get/set description of the sequence.
'description' is an alias for this for compliance with the
Bio::DescribeableI interface.
Returns : value of desc (a string)
Args : newvalue (a string or undef, optional)
=cut
sub desc{
my $self = shift;
return $self->{'desc'} = shift if @_;
return $self->{'desc'};
}
=head2 can_call_new
Title : can_call_new
Usage :
Function:
Example :
Returns : true
Args :
=cut
sub can_call_new {
my ($self) = @_;
return 1;
}
=head2 id
Title : id
Usage : $id = $seqobj->id();
Function: This is mapped on display_id
Example :
Returns :
Args :
=cut
sub id {
return shift->display_id(@_);
}
=head2 is_circular
Title : is_circular
Usage : if( $seqobj->is_circular) { # Do something }
Function: Returns true if the molecule is circular
Returns : Boolean value
Args : none
=cut
sub is_circular{
my $self = shift;
return $self->{'is_circular'} = shift if @_;
return $self->{'is_circular'};
}
=head1 Methods for Bio::IdentifiableI compliance
=head2 object_id
Title : object_id
Usage : $string = $seqobj->object_id();
Function: Get or set a string which represents the stable primary identifier
in this namespace of this object. For DNA sequences this
is its accession_number, similarly for protein sequences.
This is aliased to accession_number().
Returns : A scalar
Args : Optional object ID to set.
=cut
sub object_id {
return shift->accession_number(@_);
}
=head2 version
Title : version
Usage : $version = $seqobj->version();
Function: Get or set a number which differentiates between versions of
the same object. Higher numbers are considered to be
later and more relevant, but a single object described
the same identifier should represent the same concept.
Returns : A number
Args : Optional version to set.
=cut
sub version{
my ($self,$value) = @_;
if( defined $value) {
$self->{'_version'} = $value;
}
return $self->{'_version'};
}
=head2 authority
Title : authority
Usage : $authority = $seqobj->authority();
Function: Get or set a string which represents the organisation which
granted the namespace, written as the DNS name of the
organisation (eg, wormbase.org).
Returns : A scalar
Args : Optional authority to set.
=cut
sub authority {
my ($self, $value) = @_;
if( defined $value) {
$self->{'authority'} = $value;
}
return $self->{'authority'};
}
=head2 namespace
Title : namespace
Usage : $string = $seqobj->namespace();
Function: Get or set a string representing the name space this identifier
is valid in, often the database name or the name describing the
collection.
Returns : A scalar
Args : Optional namespace to set.
=cut
sub namespace{
my ($self,$value) = @_;
if( defined $value) {
$self->{'namespace'} = $value;
}
return $self->{'namespace'} || "";
}
=head1 Methods for Bio::DescribableI compliance
This comprises of display_name and description.
=head2 display_name
Title : display_name
Usage : $string = $seqobj->display_name();
Function: Get or set a string which is what should be displayed to the user.
The string should have no spaces (ideally, though a cautious
user of this interface would not assume this) and should be
less than thirty characters (though again, double checking
this is a good idea).
This is aliased to display_id().
Returns : A string for the display name
Args : Optional string for the display name to set.
=cut
sub display_name {
return shift->display_id(@_);
}
=head2 description
Title : description
Usage : $string = $seqobj->description();
Function: Get or set a text string suitable for displaying to the user a
description. This string is likely to have spaces, but
should not have any newlines or formatting - just plain
text. The string should not be greater than 255 characters
and clients can feel justified at truncating strings at 255
characters for the purposes of display.
This is aliased to desc().
Returns : A string for the description
Args : Optional string for the description to set.
=cut
sub description {
return shift->desc(@_);
}
=head1 Methods Inherited from Bio::PrimarySeqI
These methods are available on Bio::PrimarySeq, although they are
actually implemented on Bio::PrimarySeqI
=head2 revcom
Title : revcom
Usage : $rev = $seqobj->revcom();
Function: Produces a new Bio::SeqI implementing object which
is the reversed complement of the sequence. For protein
sequences this throws an exception of
"Sequence is a protein. Cannot revcom".
The id is the same id as the original sequence, and the
accession number is also identical. If someone wants to
track that this sequence has be reversed, it needs to
define its own extensions.
To do an inplace edit of an object you can go:
$seqobj = $seqobj->revcom();
This of course, causes Perl to handle the garbage
collection of the old object, but it is roughly speaking as
efficient as an inplace edit.
Returns : A new (fresh) Bio::SeqI object
Args : none
=head2 trunc
Title : trunc
Usage : $subseq = $myseq->trunc(10,100);
Function: Provides a truncation of a sequence,
Returns : A fresh Bio::SeqI implementing object.
Args : Numbers for the start and end positions
=head1 Internal methods
These are internal methods to PrimarySeq
=head2 _guess_alphabet
Title : _guess_alphabet
Usage :
Function: Automatically guess and set the type of sequence: dna, rna, protein
or '' if the sequence was empty. This method first removes dots (.),
dashes (-) and question marks (?) before guessing the alphabet
using the IUPAC conventions for ambiguous residues. Since the DNA and
RNA characters are also valid characters for proteins, there is
no foolproof way of determining the right alphabet. This is our best
guess only!
Returns : string 'dna', 'rna', 'protein' or ''.
Args : none
=cut
sub _guess_alphabet {
my ($self) = @_;
# Guess alphabet
my $alphabet = $self->_guess_alphabet_from_string($self->seq, $self->{'_nowarnonempty'});
# Set alphabet unless it is unknown
$self->alphabet($alphabet) if $alphabet;
return $alphabet;
}
sub _guess_alphabet_from_string {
# Get the alphabet from a sequence string
my ($self, $str, $nowarnonempty) = @_;
$nowarnonempty = 0 if not defined $nowarnonempty;
# Remove chars that clearly don't denote nucleic or amino acids
$str =~ s/[-.?]//gi;
# Check for sequences without valid letters
my $alphabet;
my $total = CORE::length($str);
if( $total == 0 ) {
if (not $nowarnonempty) {
$self->warn("Got a sequence without letters. Could not guess alphabet");
}
$alphabet = '';
}
# Determine alphabet now
if (not defined $alphabet) {
if ($str =~ m/[EFIJLOPQXZ]/i) {
# Start with a safe method to find proteins.
# Unambiguous IUPAC letters for proteins are: E,F,I,J,L,O,P,Q,X,Z
$alphabet = 'protein';
} else {
# Alphabet is unsure, could still be DNA, RNA or protein
# DNA and RNA contain mostly A, T, U, G, C and N, but the other
# letters they use are also among the 15 valid letters that a
# protein sequence can contain at this stage. Make our best guess
# based on sequence composition. If it contains over 70% of ACGTUN,
# it is likely nucleic.
if( ($str =~ tr/ATUGCNWSKMatugcnwskm//) / $total > 0.7 ) {
if ( $str =~ m/U/i ) {
$alphabet = 'rna';
} else {
$alphabet = 'dna';
}
} else {
$alphabet = 'protein';
}
}
}
return $alphabet;
}
############################################################################
# aliases due to name changes or to compensate for our lack of consistency #
############################################################################
sub accession {
my $self = shift;
$self->warn(ref($self)."::accession is deprecated, ".
"use accession_number() instead");
return $self->accession_number(@_);
}
1;
|