1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285
|
/*
Copyright (c) Marshall Clow 2010-2012.
Distributed under the Boost Software License, Version 1.0. (See accompanying
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
For more information, see http://www.boost.org
*/
#include <boost/algorithm/searching/boyer_moore.hpp>
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
#define BOOST_TEST_MAIN
#include <boost/test/unit_test.hpp>
#include <iostream>
#include <string>
#include <vector>
namespace ba = boost::algorithm;
template <typename Iter>
std::string make_str ( Iter first, std::size_t len ) {
std::string retVal ( len + 2, '\'' );
std::copy ( first, first+len, retVal.begin () + 1);
return retVal;
}
namespace {
// Check using iterators
template<typename Container>
void check_one_iter ( const Container &haystack, const std::string &needle, std::ptrdiff_t expected ) {
typedef typename Container::const_iterator iter_type;
typedef typename std::pair<iter_type, iter_type> ret_type;
typedef std::string::const_iterator pattern_type;
iter_type hBeg = haystack.begin ();
iter_type hEnd = haystack.end ();
pattern_type nBeg = needle.begin ();
pattern_type nEnd = needle.end ();
// iter_type ret0 = std::search (hBeg, hEnd, nBeg, nEnd);
ret_type ret1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
ret_type ret1r = ba::boyer_moore_search (haystack, nBeg, nEnd);
ret_type ret2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
ret_type ret3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
// iter_type it1 = ret1.first;
// iter_type it1r = ret1r.first;
// iter_type it2 = ret2.first;
// iter_type it3 = ret3.first;
const std::ptrdiff_t dist = ret1.first == hEnd ? -1 : std::distance ( hBeg, ret1.first );
std::cout << "(Iterators) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
try {
if ( it0 != ret1.first ) {
throw std::runtime_error (
std::string ( "results mismatch between std::search and boyer-moore search" ));
}
if ( ret1.first != ret1r.first || ret1.second != ret1r.second ) {
throw std::runtime_error (
std::string ( "results mismatch between iterator and range boyer_moore search" ));
}
if ( ret1.first != ret2.first || ret1.second != ret2.second ) {
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
}
if ( ret1.first != ret3.first || ret1.second != ret3.second ) {
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
}
}
catch ( ... ) {
std::cout << "Searching for: " << needle << std::endl;
std::cout << "Expected: " << expected << "\n";
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
std::cout << " bm: " << std::distance ( hBeg, ret1.first ) << "\n";
std::cout << " bm(r): " << std::distance ( hBeg, ret1r.first ) << "\n";
std::cout << " bmh: " << std::distance ( hBeg, ret2.first ) << "\n";
std::cout << " kpm: " << std::distance ( hBeg, ret3.first )<< "\n";
std::cout << std::flush;
throw ;
}
BOOST_CHECK_EQUAL ( dist, expected );
}
// Check using pointers
// We're assuming that the container implements contiguous storage here.
template<typename Container>
void check_one_pointer ( const Container &haystack, const std::string &needle, std::ptrdiff_t expected ) {
typedef const typename Container::value_type *ptr_type;
typedef typename std::pair<ptr_type, ptr_type> ret_type;
ptr_type hBeg = haystack.size () == 0 ? NULL : &*haystack.begin ();
ptr_type hEnd = hBeg + haystack.size ();
ptr_type nBeg = needle.size () == 0 ? NULL : &*needle.begin ();
ptr_type nEnd = nBeg + needle.size ();
ptr_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
ret_type ret1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
ret_type ret2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
ret_type ret3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
const std::ptrdiff_t dist = ret1.first == hEnd ? -1 : std::distance ( hBeg, ret1.first );
std::cout << "(Pointers) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
try {
if ( it0 != ret1.first ) {
throw std::runtime_error (
std::string ( "results mismatch between std::search and boyer-moore search" ));
}
if ( ret1.first != ret2.first || ret1.second != ret2.second ) {
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
}
if ( ret1.first != ret3.first || ret1.second != ret3.second ) {
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
}
}
catch ( ... ) {
std::cout << "Searching for: " << needle << std::endl;
std::cout << "Expected: " << expected << "\n";
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
std::cout << " bm: " << std::distance ( hBeg, ret1.first ) << "\n";
std::cout << " bmh: " << std::distance ( hBeg, ret2.first ) << "\n";
std::cout << " kpm: " << std::distance ( hBeg, ret3.first )<< "\n";
std::cout << std::flush;
throw ;
}
BOOST_CHECK_EQUAL ( dist, expected );
}
// Check using objects
template<typename Container>
void check_one_object ( const Container &haystack, const std::string &needle, std::ptrdiff_t expected ) {
typedef typename Container::const_iterator iter_type;
typedef typename std::pair<iter_type, iter_type> ret_type;
typedef std::string::const_iterator pattern_type;
iter_type hBeg = haystack.begin ();
iter_type hEnd = haystack.end ();
pattern_type nBeg = needle.begin ();
pattern_type nEnd = needle.end ();
ba::boyer_moore<pattern_type> bm_r = ba::make_boyer_moore ( needle );
ba::boyer_moore<pattern_type> bm ( nBeg, nEnd );
ba::boyer_moore_horspool<pattern_type> bmh ( nBeg, nEnd );
ba::knuth_morris_pratt<pattern_type> kmp ( nBeg, nEnd );
iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
ret_type ret1 = bm (hBeg, hEnd);
ret_type ret1r = bm (haystack);
ret_type retr1 = bm_r (hBeg, hEnd);
ret_type retr1r = bm_r (haystack);
ret_type ret2 = bmh (hBeg, hEnd);
ret_type ret3 = kmp (hBeg, hEnd);
const std::ptrdiff_t dist = ret1.first == hEnd ? -1 : std::distance ( hBeg, ret1.first );
std::cout << "(Objects) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
try {
if ( it0 != ret1.first ) {
throw std::runtime_error (
std::string ( "results mismatch between std::search and boyer-moore search" ));
}
if ( ret1.first != ret1r.first || ret1.second != ret1r.second ) {
throw std::runtime_error (
std::string ( "results mismatch between iterator and range boyer_moore search(1)" ));
}
if ( ret1.first != retr1.first || ret1.second != retr1.second ) {
throw std::runtime_error (
std::string ( "results mismatch between iterator and range boyer_moore search(2)" ));
}
if ( ret1.first != retr1r.first || ret1.second != retr1r.second ) {
throw std::runtime_error (
std::string ( "results mismatch between iterator and range boyer_moore search(3)" ));
}
if ( ret1.first != ret2.first || ret1.second != ret2.second ) {
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
}
if ( ret1.first != ret3.first || ret1.second != ret3.second ) {
throw std::runtime_error (
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
}
}
catch ( ... ) {
std::cout << "Searching for: " << needle << std::endl;
std::cout << "Expected: " << expected << "\n";
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
std::cout << " bm: " << std::distance ( hBeg, ret1.first ) << "\n";
std::cout << " bm(r1): " << std::distance ( hBeg, ret1r.first ) << "\n";
std::cout << " bm(r2): " << std::distance ( hBeg, retr1.first ) << "\n";
std::cout << " bm(r3): " << std::distance ( hBeg, retr1r.first ) << "\n";
std::cout << " bmh: " << std::distance ( hBeg, ret2.first ) << "\n";
std::cout << " kpm: " << std::distance ( hBeg, ret3.first )<< "\n";
std::cout << std::flush;
throw ;
}
BOOST_CHECK_EQUAL ( dist, expected );
}
template<typename Container>
void check_one ( const Container &haystack, const std::string &needle, std::ptrdiff_t expected ) {
check_one_iter ( haystack, needle, expected );
check_one_pointer ( haystack, needle, expected );
check_one_object ( haystack, needle, expected );
}
}
BOOST_AUTO_TEST_CASE( test_main )
{
std::string haystack1 ( "NOW AN FOWE\220ER ANNMAN THE ANPANMANEND" );
std::string needle1 ( "ANPANMAN" );
std::string needle2 ( "MAN THE" );
std::string needle3 ( "WE\220ER" );
std::string needle4 ( "NOW " ); // At the beginning
std::string needle5 ( "NEND" ); // At the end
std::string needle6 ( "NOT FOUND" ); // Nowhere
std::string needle7 ( "NOT FO\340ND" ); // Nowhere
std::string haystack2 ( "ABC ABCDAB ABCDABCDABDE" );
std::string needle11 ( "ABCDABD" );
std::string haystack3 ( "abra abracad abracadabra" );
std::string needle12 ( "abracadabra" );
std::string needle13 ( "" );
std::string haystack4 ( "" );
check_one ( haystack1, needle1, 26 );
check_one ( haystack1, needle2, 18 );
check_one ( haystack1, needle3, 9 );
check_one ( haystack1, needle4, 0 );
check_one ( haystack1, needle5, 33 );
check_one ( haystack1, needle6, -1 );
check_one ( haystack1, needle7, -1 );
check_one ( needle1, haystack1, -1 ); // cant find long pattern in short corpus
check_one ( haystack1, haystack1, 0 ); // find something in itself
check_one ( haystack2, haystack2, 0 ); // find something in itself
check_one ( haystack2, needle11, 15 );
check_one ( haystack3, needle12, 13 );
check_one ( haystack1, needle13, 0 ); // find the empty string
check_one ( haystack4, needle1, -1 ); // can't find in an empty haystack
// Mikhail Levin <svarneticist@gmail.com> found a problem, and this was the test
// that triggered it.
const std::string mikhail_pattern =
"GATACACCTACCTTCACCAGTTACTCTATGCACTAGGTGCGCCAGGCCCATGCACAAGGGCTTGAGTGGATGGGAAGGA"
"TGTGCCCTAGTGATGGCAGCATAAGCTACGCAGAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACATCCACGAG"
"CACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCCATGTATTACTGTGGGAGAGATGTCTGGAGTGGT"
"TATTATTGCCCCGGTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACG"
;
const std::string mikhail_corpus = std::string (8, 'a') + mikhail_pattern;
check_one ( mikhail_corpus, mikhail_pattern, 8 );
}
|