File: aligner_seed2.h

package info (click to toggle)
bowtie2 2.2.4-1
  • links: PTS, VCS
  • area: main
  • in suites: jessie, jessie-kfreebsd
  • size: 20,280 kB
  • ctags: 5,481
  • sloc: cpp: 58,605; perl: 1,190; sh: 1,036; makefile: 370; ansic: 122; python: 95
file content (2528 lines) | stat: -rw-r--r-- 71,070 bytes parent folder | download
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
462
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
506
507
508
509
510
511
512
513
514
515
516
517
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
634
635
636
637
638
639
640
641
642
643
644
645
646
647
648
649
650
651
652
653
654
655
656
657
658
659
660
661
662
663
664
665
666
667
668
669
670
671
672
673
674
675
676
677
678
679
680
681
682
683
684
685
686
687
688
689
690
691
692
693
694
695
696
697
698
699
700
701
702
703
704
705
706
707
708
709
710
711
712
713
714
715
716
717
718
719
720
721
722
723
724
725
726
727
728
729
730
731
732
733
734
735
736
737
738
739
740
741
742
743
744
745
746
747
748
749
750
751
752
753
754
755
756
757
758
759
760
761
762
763
764
765
766
767
768
769
770
771
772
773
774
775
776
777
778
779
780
781
782
783
784
785
786
787
788
789
790
791
792
793
794
795
796
797
798
799
800
801
802
803
804
805
806
807
808
809
810
811
812
813
814
815
816
817
818
819
820
821
822
823
824
825
826
827
828
829
830
831
832
833
834
835
836
837
838
839
840
841
842
843
844
845
846
847
848
849
850
851
852
853
854
855
856
857
858
859
860
861
862
863
864
865
866
867
868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
884
885
886
887
888
889
890
891
892
893
894
895
896
897
898
899
900
901
902
903
904
905
906
907
908
909
910
911
912
913
914
915
916
917
918
919
920
921
922
923
924
925
926
927
928
929
930
931
932
933
934
935
936
937
938
939
940
941
942
943
944
945
946
947
948
949
950
951
952
953
954
955
956
957
958
959
960
961
962
963
964
965
966
967
968
969
970
971
972
973
974
975
976
977
978
979
980
981
982
983
984
985
986
987
988
989
990
991
992
993
994
995
996
997
998
999
1000
1001
1002
1003
1004
1005
1006
1007
1008
1009
1010
1011
1012
1013
1014
1015
1016
1017
1018
1019
1020
1021
1022
1023
1024
1025
1026
1027
1028
1029
1030
1031
1032
1033
1034
1035
1036
1037
1038
1039
1040
1041
1042
1043
1044
1045
1046
1047
1048
1049
1050
1051
1052
1053
1054
1055
1056
1057
1058
1059
1060
1061
1062
1063
1064
1065
1066
1067
1068
1069
1070
1071
1072
1073
1074
1075
1076
1077
1078
1079
1080
1081
1082
1083
1084
1085
1086
1087
1088
1089
1090
1091
1092
1093
1094
1095
1096
1097
1098
1099
1100
1101
1102
1103
1104
1105
1106
1107
1108
1109
1110
1111
1112
1113
1114
1115
1116
1117
1118
1119
1120
1121
1122
1123
1124
1125
1126
1127
1128
1129
1130
1131
1132
1133
1134
1135
1136
1137
1138
1139
1140
1141
1142
1143
1144
1145
1146
1147
1148
1149
1150
1151
1152
1153
1154
1155
1156
1157
1158
1159
1160
1161
1162
1163
1164
1165
1166
1167
1168
1169
1170
1171
1172
1173
1174
1175
1176
1177
1178
1179
1180
1181
1182
1183
1184
1185
1186
1187
1188
1189
1190
1191
1192
1193
1194
1195
1196
1197
1198
1199
1200
1201
1202
1203
1204
1205
1206
1207
1208
1209
1210
1211
1212
1213
1214
1215
1216
1217
1218
1219
1220
1221
1222
1223
1224
1225
1226
1227
1228
1229
1230
1231
1232
1233
1234
1235
1236
1237
1238
1239
1240
1241
1242
1243
1244
1245
1246
1247
1248
1249
1250
1251
1252
1253
1254
1255
1256
1257
1258
1259
1260
1261
1262
1263
1264
1265
1266
1267
1268
1269
1270
1271
1272
1273
1274
1275
1276
1277
1278
1279
1280
1281
1282
1283
1284
1285
1286
1287
1288
1289
1290
1291
1292
1293
1294
1295
1296
1297
1298
1299
1300
1301
1302
1303
1304
1305
1306
1307
1308
1309
1310
1311
1312
1313
1314
1315
1316
1317
1318
1319
1320
1321
1322
1323
1324
1325
1326
1327
1328
1329
1330
1331
1332
1333
1334
1335
1336
1337
1338
1339
1340
1341
1342
1343
1344
1345
1346
1347
1348
1349
1350
1351
1352
1353
1354
1355
1356
1357
1358
1359
1360
1361
1362
1363
1364
1365
1366
1367
1368
1369
1370
1371
1372
1373
1374
1375
1376
1377
1378
1379
1380
1381
1382
1383
1384
1385
1386
1387
1388
1389
1390
1391
1392
1393
1394
1395
1396
1397
1398
1399
1400
1401
1402
1403
1404
1405
1406
1407
1408
1409
1410
1411
1412
1413
1414
1415
1416
1417
1418
1419
1420
1421
1422
1423
1424
1425
1426
1427
1428
1429
1430
1431
1432
1433
1434
1435
1436
1437
1438
1439
1440
1441
1442
1443
1444
1445
1446
1447
1448
1449
1450
1451
1452
1453
1454
1455
1456
1457
1458
1459
1460
1461
1462
1463
1464
1465
1466
1467
1468
1469
1470
1471
1472
1473
1474
1475
1476
1477
1478
1479
1480
1481
1482
1483
1484
1485
1486
1487
1488
1489
1490
1491
1492
1493
1494
1495
1496
1497
1498
1499
1500
1501
1502
1503
1504
1505
1506
1507
1508
1509
1510
1511
1512
1513
1514
1515
1516
1517
1518
1519
1520
1521
1522
1523
1524
1525
1526
1527
1528
1529
1530
1531
1532
1533
1534
1535
1536
1537
1538
1539
1540
1541
1542
1543
1544
1545
1546
1547
1548
1549
1550
1551
1552
1553
1554
1555
1556
1557
1558
1559
1560
1561
1562
1563
1564
1565
1566
1567
1568
1569
1570
1571
1572
1573
1574
1575
1576
1577
1578
1579
1580
1581
1582
1583
1584
1585
1586
1587
1588
1589
1590
1591
1592
1593
1594
1595
1596
1597
1598
1599
1600
1601
1602
1603
1604
1605
1606
1607
1608
1609
1610
1611
1612
1613
1614
1615
1616
1617
1618
1619
1620
1621
1622
1623
1624
1625
1626
1627
1628
1629
1630
1631
1632
1633
1634
1635
1636
1637
1638
1639
1640
1641
1642
1643
1644
1645
1646
1647
1648
1649
1650
1651
1652
1653
1654
1655
1656
1657
1658
1659
1660
1661
1662
1663
1664
1665
1666
1667
1668
1669
1670
1671
1672
1673
1674
1675
1676
1677
1678
1679
1680
1681
1682
1683
1684
1685
1686
1687
1688
1689
1690
1691
1692
1693
1694
1695
1696
1697
1698
1699
1700
1701
1702
1703
1704
1705
1706
1707
1708
1709
1710
1711
1712
1713
1714
1715
1716
1717
1718
1719
1720
1721
1722
1723
1724
1725
1726
1727
1728
1729
1730
1731
1732
1733
1734
1735
1736
1737
1738
1739
1740
1741
1742
1743
1744
1745
1746
1747
1748
1749
1750
1751
1752
1753
1754
1755
1756
1757
1758
1759
1760
1761
1762
1763
1764
1765
1766
1767
1768
1769
1770
1771
1772
1773
1774
1775
1776
1777
1778
1779
1780
1781
1782
1783
1784
1785
1786
1787
1788
1789
1790
1791
1792
1793
1794
1795
1796
1797
1798
1799
1800
1801
1802
1803
1804
1805
1806
1807
1808
1809
1810
1811
1812
1813
1814
1815
1816
1817
1818
1819
1820
1821
1822
1823
1824
1825
1826
1827
1828
1829
1830
1831
1832
1833
1834
1835
1836
1837
1838
1839
1840
1841
1842
1843
1844
1845
1846
1847
1848
1849
1850
1851
1852
1853
1854
1855
1856
1857
1858
1859
1860
1861
1862
1863
1864
1865
1866
1867
1868
1869
1870
1871
1872
1873
1874
1875
1876
1877
1878
1879
1880
1881
1882
1883
1884
1885
1886
1887
1888
1889
1890
1891
1892
1893
1894
1895
1896
1897
1898
1899
1900
1901
1902
1903
1904
1905
1906
1907
1908
1909
1910
1911
1912
1913
1914
1915
1916
1917
1918
1919
1920
1921
1922
1923
1924
1925
1926
1927
1928
1929
1930
1931
1932
1933
1934
1935
1936
1937
1938
1939
1940
1941
1942
1943
1944
1945
1946
1947
1948
1949
1950
1951
1952
1953
1954
1955
1956
1957
1958
1959
1960
1961
1962
1963
1964
1965
1966
1967
1968
1969
1970
1971
1972
1973
1974
1975
1976
1977
1978
1979
1980
1981
1982
1983
1984
1985
1986
1987
1988
1989
1990
1991
1992
1993
1994
1995
1996
1997
1998
1999
2000
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
2014
2015
2016
2017
2018
2019
2020
2021
2022
2023
2024
2025
2026
2027
2028
2029
2030
2031
2032
2033
2034
2035
2036
2037
2038
2039
2040
2041
2042
2043
2044
2045
2046
2047
2048
2049
2050
2051
2052
2053
2054
2055
2056
2057
2058
2059
2060
2061
2062
2063
2064
2065
2066
2067
2068
2069
2070
2071
2072
2073
2074
2075
2076
2077
2078
2079
2080
2081
2082
2083
2084
2085
2086
2087
2088
2089
2090
2091
2092
2093
2094
2095
2096
2097
2098
2099
2100
2101
2102
2103
2104
2105
2106
2107
2108
2109
2110
2111
2112
2113
2114
2115
2116
2117
2118
2119
2120
2121
2122
2123
2124
2125
2126
2127
2128
2129
2130
2131
2132
2133
2134
2135
2136
2137
2138
2139
2140
2141
2142
2143
2144
2145
2146
2147
2148
2149
2150
2151
2152
2153
2154
2155
2156
2157
2158
2159
2160
2161
2162
2163
2164
2165
2166
2167
2168
2169
2170
2171
2172
2173
2174
2175
2176
2177
2178
2179
2180
2181
2182
2183
2184
2185
2186
2187
2188
2189
2190
2191
2192
2193
2194
2195
2196
2197
2198
2199
2200
2201
2202
2203
2204
2205
2206
2207
2208
2209
2210
2211
2212
2213
2214
2215
2216
2217
2218
2219
2220
2221
2222
2223
2224
2225
2226
2227
2228
2229
2230
2231
2232
2233
2234
2235
2236
2237
2238
2239
2240
2241
2242
2243
2244
2245
2246
2247
2248
2249
2250
2251
2252
2253
2254
2255
2256
2257
2258
2259
2260
2261
2262
2263
2264
2265
2266
2267
2268
2269
2270
2271
2272
2273
2274
2275
2276
2277
2278
2279
2280
2281
2282
2283
2284
2285
2286
2287
2288
2289
2290
2291
2292
2293
2294
2295
2296
2297
2298
2299
2300
2301
2302
2303
2304
2305
2306
2307
2308
2309
2310
2311
2312
2313
2314
2315
2316
2317
2318
2319
2320
2321
2322
2323
2324
2325
2326
2327
2328
2329
2330
2331
2332
2333
2334
2335
2336
2337
2338
2339
2340
2341
2342
2343
2344
2345
2346
2347
2348
2349
2350
2351
2352
2353
2354
2355
2356
2357
2358
2359
2360
2361
2362
2363
2364
2365
2366
2367
2368
2369
2370
2371
2372
2373
2374
2375
2376
2377
2378
2379
2380
2381
2382
2383
2384
2385
2386
2387
2388
2389
2390
2391
2392
2393
2394
2395
2396
2397
2398
2399
2400
2401
2402
2403
2404
2405
2406
2407
2408
2409
2410
2411
2412
2413
2414
2415
2416
2417
2418
2419
2420
2421
2422
2423
2424
2425
2426
2427
2428
2429
2430
2431
2432
2433
2434
2435
2436
2437
2438
2439
2440
2441
2442
2443
2444
2445
2446
2447
2448
2449
2450
2451
2452
2453
2454
2455
2456
2457
2458
2459
2460
2461
2462
2463
2464
2465
2466
2467
2468
2469
2470
2471
2472
2473
2474
2475
2476
2477
2478
2479
2480
2481
2482
2483
2484
2485
2486
2487
2488
2489
2490
2491
2492
2493
2494
2495
2496
2497
2498
2499
2500
2501
2502
2503
2504
2505
2506
2507
2508
2509
2510
2511
2512
2513
2514
2515
2516
2517
2518
2519
2520
2521
2522
2523
2524
2525
2526
2527
2528
/*
 * Copyright 2011, Ben Langmead <langmea@cs.jhu.edu>
 *
 * This file is part of Bowtie 2.
 *
 * Bowtie 2 is free software: you can redistribute it and/or modify
 * it under the terms of the GNU General Public License as published by
 * the Free Software Foundation, either version 3 of the License, or
 * (at your option) any later version.
 *
 * Bowtie 2 is distributed in the hope that it will be useful,
 * but WITHOUT ANY WARRANTY; without even the implied warranty of
 * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
 * GNU General Public License for more details.
 *
 * You should have received a copy of the GNU General Public License
 * along with Bowtie 2.  If not, see <http://www.gnu.org/licenses/>.
 */

#ifndef ALIGNER_SEED2_H_
#define ALIGNER_SEED2_H_

/**
 * The user of the DescentDriver class specifies a collection of search roots.
 * Logic for picking these search roots is located elsewhere, not in this
 * module.  The search roots are annotated with a priority score, which 
 *
 * The heap is a min-heap over pairs, where the first element of each pair is
 * the score associated with a descent and the second element of each pair is
 * the descent ID.
 *
 * Weeding out redundant descents is key; otherwise we end up reporting slight
 * variations on the same alignment repeatedly, including variations with poor
 * scores.  What criteria do we use to determine whether two paths are
 * redundant?
 *
 * Here's an example where the same set of read characters have been aligned in
 * all three cases:
 *
 * Alignment 1 (sc = 0):
 * Rd: GCTATATAGCGCGCTCGCATCATTTTGTGT
 *     ||||||||||||||||||||||||||||||
 * Rf: GCTATATAGCGCGCTCGCATCATTTTGTGT
 *
 * Alignment 2 (sc = -22):
 * Rd: GCTATATAGCGCGCTCGCATCATTTTGTGT
 *     |||||||||||||||||||||||  | |||
 * Rf: GCTATATAGCGCGCTCGCATCAT--TTTGT
 *
 * Alignment 3 (sc = -22):
 * Rd: GCTATATAGCGCGCTCGCATCATT--TTGTGT
 *     ||||||||||||||||||||||||   |||||
 * Rf: GCTATATAGCGCGCTCGCATCATTTTGTGTGT
 *
 * Rf from aln 1: GCTATATAGCGCGCTCGCATCATTTTGTGT
 * Rf from aln 2: GCTATATAGCGCGCTCGCATCATTTTGT
 * Rf from aln 3: GCTATATAGCGCGCTCGCATCATTTTGTGTGT
 *
 * Are alignments 2 and 3 redundant with alignment 1?  We can't totally say
 * without knowing the associated SA ranges.  Take alignments 1 and 2.  Either
 * the SA ranges are the same or the SA range for 2 contains the SA range for
 * 1.  If they're the same, then alignment 2 is redundant with alignment 1.
 * Otherwise, *some* of the elements in the SA range for alignment 2 are not
 * redundant.
 *
 * In that example, the same read characters are aligned in all three
 * alignments.  Is it possible and profitable to consider scenarios where an
 * alignment might be redundant with another alignment 
 *
 * Another question is *when* do we try to detect the redundancy?  Before we
 * try to extend through the matches, or after.  After is easier, but less work
 * has been avoided.
 *
 * What data structure do we query to determine whether there's redundancy?
 * The situation is harder when we try to detect overlaps between SA ranges
 * rather than identical SA ranges.  Maybe: read intervals -> intersection tree -> penalties.
 *
 * 1. If we're introducing a gap and we could have introduced it deeper in the
 *    descent with the same effect w/r/t homopolymer length.
 * 2. If we have Descent A with penalty B and Descent a with penalty b, and A
 *    aligns read characters [X, Y] to SA range [Z, W], and B aligns read
 *    characters [x, y] to SA range [z, w], then A is redundant with B if
 *    [x, y] is within [X, Y].
 *
 * Found an alignment with total penalty = 3
 * GCAATATAGCGCGCTCGCATCATTTTGTGT
 * || |||||||||||||||||||||||||||
 * GCTATATAGCGCGCTCGCATCATTTTGTGT
 *
 * Found an alignment with total penalty = 27
 * gCAATATAGCGCGCTCGCATCATTTTGTGT
 *   |   ||||||||||||||||||||||||
 *  TATA-TAGCGCGCTCGCATCATTTTGTGT
 */

#include <stdint.h>
#include <math.h>
#include <utility>
#include <limits>
#include "assert_helpers.h"
#include "random_util.h"
#include "aligner_result.h"
#include "bt2_idx.h"
#include "simple_func.h"
#include "scoring.h"
#include "edit.h"
#include "read.h"
#include "ds.h"
#include "group_walk.h"
#include "btypes.h"

typedef size_t   TReadOff;
typedef int64_t  TScore;
typedef float    TRootPri;
typedef size_t   TDescentId;
typedef size_t   TRootId;

/**
 * enum encapsulating a few different policies for how we might extend descents
 * in the direction opposite from their primary direction.  
 */
enum {
	// Never extened in the direction opposite from the primary.  Just go in
	// the primary direction until the bounce.
	DESC_EX_NONE = 1,
	
	// When we're finished extending out the matches for a descent, try to
	// extend in the opposite direction in a way that extends all branches
	// simultaneously.  The Descent.nex_ field contains the number of positions
	// we were able to extend through in this way.
	DESC_EX_FROM_1ST_BRANCH = 2,
	
	// Each time we add an edge to the summary, extend it in the opposite
	// direction.  The DescentEdge.nex field contains the number of positions
	// we were able to extend through, and this in turn gets propagated to
	// Descent.nex_ if and when we branch from the DescentEdge.
	DESC_EX_EACH_EDGE = 3
};

/**
 * Counters to keep track of how much work is being done.
 */
struct DescentMetrics {

	DescentMetrics() { reset(); }

	void reset() {
		bwops = bwops_1 = bwops_bi = recalc = branch = branch_mm =
		branch_del = branch_ins = heap_max = descent_max = descentpos_max = 
		nex = 0;
	}

	uint64_t bwops;          // # FM Index opbs
	uint64_t bwops_1;        // # LF1 FM Index opbs
	uint64_t bwops_bi;       // # BiEx FM Index opbs
	uint64_t recalc;         // # times outgoing edge summary was recalculated
	uint64_t branch;         // # times we descended from another descent
	uint64_t branch_mm;      // # times branch was on a mismatch
	uint64_t branch_del;     // # times branch was on a deletion
	uint64_t branch_ins;     // # times branch was on a insertion
	uint64_t heap_max;       // maximum size of Descent heap
	uint64_t descent_max;    // maximum size of Descent factory
	uint64_t descentpos_max; // maximum size of DescentPos factory
	uint64_t nex;            // # extensions
};

/**
 * Priority used to rank which descent we should branch from next.  Right now,
 * priority is governed by a 4-tuple.  From higher to lower priority:
 *
 *  1. Penalty accumulated so far
 *  2. Depth into the search space, including extensions
 *  3. Width of the SA range (i.e. uniqueness)
 *  4. Root priority
 */
struct DescentPriority {

	DescentPriority() { reset(); }

	DescentPriority(
		TScore pen_,
		size_t depth_,
		TIndexOffU width_,
		float rootpri_)
	{
		pen = pen_;
		depth = depth_;
		width = width_;
		rootpri = rootpri_;
	}
	
	/**
	 * Initialize new DescentPriority.
	 */
	void init(TScore pen_, size_t depth_, TIndexOffU width_, float rootpri_) {
		pen = pen_;
		depth = depth_;
		width = width_;
		rootpri = rootpri_;
	}
	
	/**
	 * Reset to uninitialized state.
	 */
	void reset() {
		width = 0;
	}
	
	/**
	 * Return true iff DescentPriority is initialized.
	 */
	bool inited() const {
		return width > 0;
	}
	
	/**
	 * Return true iff this priority is prior to given priority.
	 */
	bool operator<(const DescentPriority& o) const {
		assert(inited());
		assert(o.inited());
		// 1st priority: penalty accumulated so far
		if(pen < o.pen) return true;
		if(pen > o.pen) return false;
		// 2nd priority: depth into the search space, including extensions
		if(depth > o.depth) return true;
		if(depth < o.depth) return false;
		// 3rd priority: width of the SA range (i.e. uniqueness)
		if(width < o.width) return true;
		if(width > o.width) return false;
		// 4th priority: root priority
		if(rootpri > o.rootpri) return true;
		return false;
	}

	/**
	 * Return true iff this priority is prior to or equal to given priority.
	 */
	bool operator<=(const DescentPriority& o) const {
		assert(inited());
		assert(o.inited());
		// 1st priority: penalty accumulated so far
		if(pen < o.pen) return true;
		if(pen > o.pen) return false;
		// 2nd priority: depth into the search space, including extensions
		if(depth > o.depth) return true;
		if(depth < o.depth) return false;
		// 3rd priority: width of the SA range (i.e. uniqueness)
		if(width < o.depth) return true;
		if(width > o.width) return false;
		// 4th priority: root priority
		if(rootpri > o.rootpri) return true;
		return true;
	}

	/**
	 * Return true iff this priority is prior to or equal to given priority.
	 */
	bool operator==(const DescentPriority& o) const {
		assert(inited());
		assert(o.inited());
		return pen == o.pen && depth == o.depth && width == o.width && rootpri == o.rootpri;
	}

	TScore pen;      // total penalty accumulated so far
	size_t depth;    // depth from root of descent
	TIndexOffU width; // width of the SA range
	float  rootpri;  // priority of the root
};

static inline std::ostream& operator<<(
	std::ostream& os,
	const DescentPriority& o)
{
	os << "[" << o.pen << ", " << o.depth << ", " << o.width << ", " << o.rootpri << "]";
	return os;
}

static inline std::ostream& operator<<(
	std::ostream& os,
	const std::pair<DescentPriority, TDescentId>& o)
{
	os << "{[" << o.first.pen << ", " << o.first.depth << ", "
	   << o.first.width << ", " << o.first.rootpri << "], " << o.second << "}";
	return os;
}

typedef std::pair<DescentPriority, TDescentId> TDescentPair;

/**
 * Encapsulates the constraints limiting which outgoing edges are permitted.
 * Specifically, we constrain the total penalty accumulated so far so that some
 * outgoing edges will exceed the limit and be pruned.  The limit is set
 * according to our "depth" into the search, as measured by the number of read
 * characters aligned so far.  We divide the depth domain into two pieces, a
 * piece close to the root, where the penty is constrained to be 0, and the
 * remainder, where the maximum penalty is an interpolation between 0 and the
 * maximum penalty
 */
struct DescentConstraints {

	DescentConstraints() { reset(); }
	
	/**
	 * Initialize with new constraint function.
	 */
	DescentConstraints(size_t nzero, double exp) {
        init(nzero, exp);
	}
    
    /**
     * Initialize with given function.
     */
    void init(size_t nzero_, double exp_) {
		nzero = nzero_ > 0 ? nzero_ : 1;
		exp = exp_;
#ifndef NDEBUG
		for(size_t i = 1; i < nzero_ + 5; i++) {
			assert_geq(get(i, nzero_ + 10, 100), get(i-1, nzero_ + 10, 100));
		}
#endif
    }
    
    /**
     * Reset to uninitialized state.
     */
    void reset() {
        nzero = 0;
		exp = -1.0f;
    }
    
    /**
     * Return true iff the DescentConstraints has been initialized.
     */
    bool inited() const {
        return exp >= 0.0f;
    }
	
	/**
	 * Get the maximum penalty total for depth 'off'.
	 */
	inline TScore get(TReadOff off, TReadOff rdlen, TAlScore maxpen) const {
		if(off < nzero || nzero >= rdlen) {
			return 0;
		}
		double frac = (double)(off - nzero) / (rdlen - nzero);
		if(fabs(exp - 1.0f) > 0.00001) {
			if(fabs(exp - 2.0f) < 0.00001) {
				frac *= frac;
			} else {
				frac = pow(frac, exp);
			}
		}
		return (TAlScore)(frac * maxpen + 0.5f);
	}

	size_t nzero;
	double exp;
};

/**
 * Encapsulates settings governing how we descent.
 */
struct DescentConfig {

    DescentConfig() { reset(); }
    
    /**
     * Reset the DescentConfig to an uninitialized state.
     */
    void reset() { expol = 0; }
    
    /**
     * Return true iff this DescentConfig is initialized.
     */
    bool inited() const { return expol != 0; }

    DescentConstraints cons; // constraints
    int expol; // extend policy
};

/**
 * Encapsulates the state of a Descent that allows us to determine whether it
 * is redundant with another Descent.  Two Descents are redundant if:
 *
 * 1. Both are aligning the same read orientation (fw or rc)
 * 2. Both are growing the alignment in the same direction (left-to-right or
 *    right-to-left)
 * 3. They have aligned exactly the same read characters (which are always
 *    consecutive in the read)
 * 4. The corresponding reference strings are identical
 */
struct DescentRedundancyKey {

	DescentRedundancyKey() { reset(); }
	
	DescentRedundancyKey(
		TReadOff  al5pf_,
		size_t    rflen_,
		TIndexOffU topf_,
		TIndexOffU botf_)
	{
		init(al5pf_, rflen_, topf_, botf_);
	}

	void reset() {
		al5pf = 0;
		rflen = 0;
		topf = botf = 0;
	}
	
	bool inited() const { return rflen > 0; }

	void init(
		TReadOff  al5pf_,
		size_t    rflen_,
		TIndexOffU topf_,
		TIndexOffU botf_)
	{
		al5pf = al5pf_;
		rflen = rflen_;
		topf = topf_;
		botf = botf_;
	}
	
	bool operator==(const DescentRedundancyKey& o) const {
		return al5pf == o.al5pf && rflen == o.rflen && topf == o.topf && botf == o.botf;
	}

	bool operator<(const DescentRedundancyKey& o) const {
		if(al5pf < o.al5pf) return true;
		if(al5pf > o.al5pf) return false;
		if(rflen < o.rflen) return true;
		if(rflen > o.rflen) return false;
		if(topf < o.topf) return true;
		if(topf > o.topf) return false;
		return botf < o.botf;
	}

	TReadOff al5pf; // 3'-most aligned char, as offset from 5' end
	size_t rflen;   // number of reference characters involved in alignment
	TIndexOffU topf; // top w/r/t forward index
	TIndexOffU botf; // bot w/r/t forward index
};

/**
 * Map from pairs to top, bot, penalty triples.
 */
class DescentRedundancyChecker {

public:

	DescentRedundancyChecker() { reset(); }

	void clear() { reset(); }
	
	/**
	 * Reset to uninitialized state.
	 */
	void reset() {
		bits_.reset();
		inited_ = false;
		totsz_ = 0;  // total size
		totcap_ = 0; // total capacity
	}
	
	const static int NPARTS = 8;
	const static int PART_MASK = 7;
	const static int NBITS = (1 << 16);

	/**
	 * Initialize using given read length.
	 */
	void init(TReadOff rdlen) {
		reset();
		bits_.resize(NBITS);
		maplist_fl_.resize(NPARTS);
		maplist_fr_.resize(NPARTS);
		maplist_rl_.resize(NPARTS);
		maplist_rr_.resize(NPARTS);
		for(int i = 0; i < NPARTS; i++) {
			maplist_fl_[i].resize(rdlen);
			maplist_fr_[i].resize(rdlen);
			maplist_rl_[i].resize(rdlen);
			maplist_rr_[i].resize(rdlen);
			totcap_ += maplist_fl_[i].totalCapacityBytes();
			totcap_ += maplist_fr_[i].totalCapacityBytes();
			totcap_ += maplist_rl_[i].totalCapacityBytes();
			totcap_ += maplist_rr_[i].totalCapacityBytes();
			for(size_t j = 0; j < rdlen; j++) {
				maplist_fl_[i][j].clear();
				maplist_fr_[i][j].clear();
				maplist_rl_[i][j].clear();
				maplist_rr_[i][j].clear();
				totcap_ += maplist_fl_[i][j].totalCapacityBytes();
				totcap_ += maplist_fr_[i][j].totalCapacityBytes();
				totcap_ += maplist_rl_[i][j].totalCapacityBytes();
				totcap_ += maplist_rr_[i][j].totalCapacityBytes();
			}
		}
		inited_ = true;
	}
	
	/**
	 * Return true iff the checker is initialized.
	 */
	bool inited() const {
		return inited_;
	}

	/**
	 * Check if this partial alignment is redundant with one that we've already
	 * explored.
	 */
	bool check(
		bool fw,
		bool l2r,
		TReadOff al5pi,
		TReadOff al5pf,
		size_t rflen,
		TIndexOffU topf,
		TIndexOffU botf,
		TScore pen)
	{
		assert(inited_);
		assert(topf > 0 || botf > 0);
		DescentRedundancyKey k(al5pf, rflen, topf, botf);
		size_t i = std::numeric_limits<size_t>::max();
		size_t mask = topf & PART_MASK;
		EMap<DescentRedundancyKey, TScore>& map =
			(fw ? (l2r ? maplist_fl_[mask][al5pi] : maplist_fr_[mask][al5pi]) :
			      (l2r ? maplist_rl_[mask][al5pi] : maplist_rr_[mask][al5pi]));
		size_t key = (topf & 255) | ((botf & 255) << 8);
		if(bits_.test(key) && map.containsEx(k, i)) {
			// Already contains the key
			assert_lt(i, map.size());
			assert_geq(pen, map[i].second);
			return false;
		}
		assert(!map.containsEx(k, i));
		size_t oldsz = map.totalSizeBytes();
		size_t oldcap = map.totalCapacityBytes();
		map.insert(make_pair(k, pen));
		bits_.set(key);
		totsz_ += (map.totalSizeBytes() - oldsz);
		totcap_ += (map.totalCapacityBytes() - oldcap);
		return true;
	}

	/**
	 * Check if this partial alignment is redundant with one that we've already
	 * explored using the Bw index SA range.
	 */
	bool contains(
		bool fw,
		bool l2r,
		TReadOff al5pi,
		TReadOff al5pf,
		size_t rflen,
		TIndexOffU topf,
		TIndexOffU botf,
		TScore pen)
	{
		assert(inited_);
		size_t key = (topf & 255) | ((botf & 255) << 8);
		if(!bits_.test(key)) {
			return false;
		}
		DescentRedundancyKey k(al5pf, rflen, topf, botf);
		size_t mask = topf & PART_MASK;
		EMap<DescentRedundancyKey, TScore>& map =
			(fw ? (l2r ? maplist_fl_[mask][al5pi] : maplist_fr_[mask][al5pi]) :
			      (l2r ? maplist_rl_[mask][al5pi] : maplist_rr_[mask][al5pi]));
		return map.contains(k);
	}
	
	/**
	 * Return the total size of the redundancy map.
	 */
	size_t totalSizeBytes() const {
		return totsz_;
	}

	/**
	 * Return the total capacity of the redundancy map.
	 */
	size_t totalCapacityBytes() const {
		return totcap_;
	}

protected:

	bool inited_;   // initialized?
	size_t totsz_;  // total size
	size_t totcap_; // total capacity
	
	// List of maps.  Each entry is a map for all the DescentRedundancyKeys
	// with al5pi equal to the offset into the list.
	ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_fl_; //  fw,  l2r
	ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_rl_; // !fw,  l2r
	ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_fr_; //  fw, !l2r
	ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_rr_; // !fw, !l2r
		
	EBitList<128> bits_;
};

/**
 * A search root.  Consists of an offset from the 5' end read and flags
 * indicating (a) whether we're initially heading left-to-right or
 * right-to-left, and (b) whether we're examining the read or its reverse
 * complement.
 *
 * A root also comes with a priority ("pri") score indicating how promising it
 * is as a root.  Promising roots have long stretches of high-quality,
 * non-repetitive nucleotides in the first several ply of the search tree.
 * Also, roots beginning at the 5' end of the read may receive a higher
 * priority.
 */
struct DescentRoot {

	DescentRoot() { reset(); }

	DescentRoot(
		size_t off5p_,
		bool l2r_,
		bool fw_,
		size_t landing_,
		size_t len,
		float pri_)
	{
		init(off5p_, l2r_, fw_, landing_, len, pri_);
	}
	
	/**
	 * Initialize a new descent root.
	 */
	void init(
		size_t off5p_,
		bool l2r_,
		bool fw_,
		size_t landing_,
		size_t len,
		float pri_)
	{
		off5p = off5p_;
		l2r = l2r_;
		fw = fw_;
		landing = landing_;
		pri = pri_;
		assert_lt(off5p, len);
	}
	
	/**
	 * Reset this DescentRoot to uninitialized state.
	 */
	void reset() {
		off5p = std::numeric_limits<size_t>::max();
	}
	
	/**
	 * Return true iff this DescentRoot is uninitialized.
	 */
	bool inited() const {
		return off5p == std::numeric_limits<size_t>::max();
	}
	
	/**
	 * Determine if two DescentRoots are equal.
	 */
	bool operator==(const DescentRoot& o) const {
		return pri == o.pri && off5p == o.off5p && l2r == o.l2r &&
		       fw == o.fw && landing == o.landing;
	}
	
	/**
	 * Determine the relative order of two DescentRoots.
	 */
	bool operator<(const DescentRoot& o) const {
		if(pri > o.pri)         return true;
		if(pri < o.pri)         return false;
		if(off5p < o.off5p)     return true;
		if(off5p > o.off5p)     return false;
		if(fw != o.fw)          return fw;
		if(l2r != o.l2r)        return l2r;
		if(landing < o.landing) return true;
		if(landing > o.landing) return false;
		return false; // they're equal
	}

	/**
	 * Return true iff this DescentRoot is either less than or equal to o.
	 */
	bool operator<=(const DescentRoot& o) const {
		return (*this) < o || (*this) == o;
	}

	// Maybe add an array of bools indicating how the landing area of this
	// root overlaps landing areas of already-chosen roots?

	TReadOff off5p;   // root origin offset, expressed as offset from 5' end
	bool     l2r;     // true -> move in left-to-right direction
	bool     fw;      // true -> work with forward read, false -> revcomp
	size_t   landing; // length of the "landing" in front of the root
	float    pri;     // priority of seed
};

/**
 * Set of flags indicating outgoing edges we've tried from a DescentPos.
 */
struct DescentPosFlags {

	DescentPosFlags() { reset(); }
	
	/**
	 * Set all flags to 1, indicating all outgoing edges are yet to be
	 * explored.
	 */
	void reset() {
		mm_a = mm_c = mm_g = mm_t = rdg_a = rdg_c = rdg_g = rdg_t = rfg = 1;
		reserved = 0;
	}
	
	/**
	 * Return true iff all outgoing edges have already been explored.
	 */
	bool exhausted() const {
		return ((uint16_t*)this)[0] == 0;
	}
	
	/**
	 * Return false iff the specified mismatch has already been explored.
	 */
	bool mmExplore(int c) {
		assert_range(0, 3, c);
		if(c == 0) {
			return mm_a;
		} else if(c == 1) {
			return mm_c;
		} else if(c == 2) {
			return mm_g;
		} else {
			return mm_t;
		}
	}

	/**
	 * Try to explore a mismatch.  Return false iff it has already been
	 * explored.
	 */
	bool mmSet(int c) {
		assert_range(0, 3, c);
		if(c == 0) {
			bool ret = mm_a; mm_a = 0; return ret;
		} else if(c == 1) {
			bool ret = mm_c; mm_c = 0; return ret;
		} else if(c == 2) {
			bool ret = mm_g; mm_g = 0; return ret;
		} else {
			bool ret = mm_t; mm_t = 0; return ret;
		}
	}

	/**
	 * Return false iff specified read gap has already been explored.
	 */
	bool rdgExplore(int c) {
		assert_range(0, 3, c);
		if(c == 0) {
			return rdg_a;
		} else if(c == 1) {
			return rdg_c;
		} else if(c == 2) {
			return rdg_g;
		} else {
			return rdg_t;
		}
	}

	/**
	 * Try to explore a read gap.  Return false iff it has already been
	 * explored.
	 */
	bool rdgSet(int c) {
		assert_range(0, 3, c);
		if(c == 0) {
			bool ret = rdg_a; rdg_a = 0; return ret;
		} else if(c == 1) {
			bool ret = rdg_c; rdg_c = 0; return ret;
		} else if(c == 2) {
			bool ret = rdg_g; rdg_g = 0; return ret;
		} else {
			bool ret = rdg_t; rdg_t = 0; return ret;
		}
	}

	/**
	 * Return false iff the reference gap has already been explored.
	 */
	bool rfgExplore() {
		return rfg;
	}

	/**
	 * Try to explore a reference gap.  Return false iff it has already been
	 * explored.
	 */
	bool rfgSet() {
		bool ret = rfg; rfg = 0; return ret;
	}

	uint16_t mm_a     : 1;
	uint16_t mm_c     : 1;
	uint16_t mm_g     : 1;
	uint16_t mm_t     : 1;

	uint16_t rdg_a    : 1;
	uint16_t rdg_c    : 1;
	uint16_t rdg_g    : 1;
	uint16_t rdg_t    : 1;

	uint16_t rfg      : 1;
	
	uint16_t reserved : 7;
};

/**
 * FM Index state associated with a single position in a descent.  For both the
 * forward and backward indexes, it stores the four SA ranges corresponding to
 * the four nucleotides.
 */
struct DescentPos {

	/**
	 * Reset all tops and bots to 0.
	 */
	void reset() {
		topf[0] = topf[1] = topf[2] = topf[3] = 0;
		botf[0] = botf[1] = botf[2] = botf[3] = 0;
		topb[0] = topb[1] = topb[2] = topb[3] = 0;
		botb[0] = botb[1] = botb[2] = botb[3] = 0;
        c = -1;
		flags.reset();
	}
    
    /**
     * Return true iff DescentPos has been initialized.
     */
    bool inited() const {
        return c >= 0;
    }
	
#ifndef NDEBUG
	/**
	 * Check that DescentPos is internally consistent.
	 */
	bool repOk() const {
		assert_range(0, 3, (int)c);
		return true;
	}
#endif
	
	TIndexOffU       topf[4]; // SA range top indexes in fw index
	TIndexOffU       botf[4]; // SA range bottom indexes (exclusive) in fw index
	TIndexOffU       topb[4]; // SA range top indexes in bw index
	TIndexOffU       botb[4]; // SA range bottom indexes (exclusive) in bw index
    char            c;       // read char that would yield match
	DescentPosFlags flags;   // flags 
};

/**
 * Encapsulates an edge outgoing from a descent.
 */
struct DescentEdge {

	DescentEdge() { reset(); }

	DescentEdge(
		Edit e_,
		TReadOff off5p_,
		DescentPriority pri_,
        size_t posFlag_,
		TReadOff nex_
#ifndef NDEBUG
        ,
        size_t d_,
		TIndexOffU topf_,
		TIndexOffU botf_,
		TIndexOffU topb_,
		TIndexOffU botb_
#endif
        )
	{
		init(e_, off5p_, pri_, posFlag_
#ifndef NDEBUG
        , d_, topf_, botf_, topb_, botb_
#endif
        );
	}

	/**
	 * Return true iff edge is initialized.
	 */
	bool inited() const { return e.inited(); }

	/**
	 * Reset to uninitialized state.
	 */
	void reset() { e.reset(); }
	
	/**
	 * Initialize DescentEdge given 5' offset, nucleotide, and priority.
	 */
	void init(
		Edit e_,
		TReadOff off5p_,
		DescentPriority pri_,
        size_t posFlag_
#ifndef NDEBUG
        ,
        size_t d_,
		TIndexOffU topf_,
		TIndexOffU botf_,
		TIndexOffU topb_,
		TIndexOffU botb_
#endif
        )
	{
		e = e_;
		off5p = off5p_;
		pri = pri_;
        posFlag = posFlag_;
#ifndef NDEBUG
        d = d_;
		topf = topf_;
		botf = botf_;
		topb = topb_;
		botb = botb_;
#endif
	}

    /**
     * Update flags to show this edge as visited.
     */
    void updateFlags(EFactory<DescentPos>& pf) {
        if(inited()) {
            if(e.isReadGap()) {
                assert_neq('-', e.chr);
                pf[posFlag].flags.rdgSet(asc2dna[e.chr]);
            } else if(e.isRefGap()) {
                pf[posFlag].flags.rfgSet();
            } else {
                assert_neq('-', e.chr);
                pf[posFlag].flags.mmSet(asc2dna[e.chr]);
            }
        }
    }
	
	/**
	 * Return true iff this edge has higher priority than the given edge.
	 */
	bool operator<(const DescentEdge& o) const {
        if(inited() && !o.inited()) {
            return true;
        } else if(!inited()) {
            return false;
        }
		return pri < o.pri;
	}

	DescentPriority pri; // priority of the edge
	TReadOff nex;        // # extends possible from this edge
    size_t posFlag;      // depth of DescentPos where flag should be set


#ifndef NDEBUG
    // This can be recreated by looking at the edit, the paren't descent's
    // len_, al5pi_, al5pf_.  I have it here so we can sanity check.
    size_t d;
	TIndexOffU topf, botf, topb, botb;
#endif

	Edit e;
	TReadOff off5p;
};

/**
 * Encapsulates an incomplete summary of the outgoing edges from a descent.  We
 * don't try to store information about all outgoing edges, because doing so
 * will generally be wasteful.  We'll typically only try a handful of them per
 * descent.
 */
class DescentOutgoing {

public:

	/**
	 * Return the best edge and rotate in preparation for next call.
	 */
	DescentEdge rotate() {
		DescentEdge tmp = best1;
        assert(!(best2 < tmp));
		best1 = best2;
        assert(!(best3 < best2));
		best2 = best3;
        assert(!(best4 < best3));
		best3 = best4;
        assert(!(best5 < best4));
		best4 = best5;
		best5.reset();
		return tmp;
	}
	
	/**
	 * Given a potental outgoing edge, place it where it belongs in the running
	 * list of best 5 outgoing edges from this descent.
	 */
	void update(DescentEdge e) {
		if(!best1.inited()) {
			best1 = e;
		} else if(e < best1) {
			best5 = best4;
			best4 = best3;
			best3 = best2;
			best2 = best1;
			best1 = e;
		} else if(!best2.inited()) {
			best2 = e;
		} else if(e < best2) {
			best5 = best4;
			best4 = best3;
			best3 = best2;
			best2 = e;
		} else if(!best3.inited()) {
			best3 = e;
		} else if(e < best3) {
			best5 = best4;
			best4 = best3;
			best3 = e;
		} else if(!best4.inited()) {
			best4 = e;
		} else if(e < best4) {
			best5 = best4;
			best4 = e;
		}  else if(!best5.inited() || e < best5) {
			best5 = e;
		}
	}
	
	/**
	 * Clear all the outgoing edges stored here.
	 */
	void clear() {
		best1.reset();
		best2.reset();
		best3.reset();
		best4.reset();
		best5.reset();
	}
	
	/**
	 * Return true iff there are no outgoing edges currently represented in
	 * this summary.  There may still be outgoing edges, they just haven't
	 * been added to the summary.
	 */
	bool empty() const {
		return !best1.inited();
	}
	
	/**
	 * Return the DescentPriority of the best outgoing edge.
	 */
	DescentPriority bestPri() const {
		assert(!empty());
		return best1.pri;
	}

	DescentEdge best1; // best
	DescentEdge best2; // 2nd-best
	DescentEdge best3; // 3rd-best
	DescentEdge best4; // 4th-best
	DescentEdge best5; // 5th-best
};

class DescentAlignmentSink;

/**
 * Encapsulates a descent through a search tree, along a path of matches.
 * Descents that are part of the same alignment form a chain.  Two aligments
 * adjacent in the chain are connected either by an edit, or by a switch in
 * direction.  Because a descent might have a different direction from the
 * DescentRoot it ultimately came from, it has its own 'l2r' field, which might
 * differ from the root's.
 */
class Descent {

public:

	Descent() { reset(); }

	/**
	 * Initialize a new descent branching from the given descent via the given
	 * edit.  Return false if the Descent has no outgoing edges (and can
     * therefore have its memory freed), true otherwise.
	 */
	bool init(
		const Read& q,                  // query
		TRootId rid,                    // root id
		const Scoring& sc,              // scoring scheme
		TAlScore minsc,                 // minimum score
		TAlScore maxpen,                // maximum penalty
		TReadOff al5pi,                 // offset from 5' of 1st aligned char
		TReadOff al5pf,                 // offset from 5' of last aligned char
		TIndexOffU topf,                 // SA range top in FW index
		TIndexOffU botf,                 // SA range bottom in FW index
		TIndexOffU topb,                 // SA range top in BW index
		TIndexOffU botb,                 // SA range bottom in BW index
		bool l2r,                       // direction this descent will go in
		size_t descid,                  // my ID
		TDescentId parent,              // parent ID
		TScore pen,                     // total penalties so far
		const Edit& e,                  // edit for incoming edge
		const Ebwt& ebwtFw,             // forward index
		const Ebwt& ebwtBw,             // mirror index
		DescentRedundancyChecker& re,   // redundancy checker
		EFactory<Descent>& df,          // Descent factory
		EFactory<DescentPos>& pf,       // DescentPos factory
        const EList<DescentRoot>& rs,   // roots
        const EList<DescentConfig>& cs, // configs
		EHeap<TDescentPair>& heap,      // heap
        DescentAlignmentSink& alsink,   // alignment sink
		DescentMetrics& met,            // metrics
		PerReadMetrics& prm);           // per-read metrics

	/**
	 * Initialize a new descent beginning at the given root.  Return false if
     * the Descent has no outgoing edges (and can therefore have its memory
     * freed), true otherwise.
	 */
	bool init(
        const Read& q,                  // query
        TRootId rid,                    // root id
        const Scoring& sc,              // scoring scheme
		TAlScore minsc,                 // minimum score
		TAlScore maxpen,                // maximum penalty
        size_t descid,                  // id of this Descent
        const Ebwt& ebwtFw,             // forward index
        const Ebwt& ebwtBw,             // mirror index
		DescentRedundancyChecker& re,   // redundancy checker
        EFactory<Descent>& df,          // Descent factory
        EFactory<DescentPos>& pf,       // DescentPos factory
        const EList<DescentRoot>& rs,   // roots
        const EList<DescentConfig>& cs, // configs
        EHeap<TDescentPair>& heap,      // heap
        DescentAlignmentSink& alsink,   // alignment sink
        DescentMetrics& met,            // metrics
		PerReadMetrics& prm);           // per-read metrics
	
	/**
	 * Return true iff this Descent has been initialized.
	 */
	bool inited() const {
		return descid_ != std::numeric_limits<size_t>::max();
	}
	
	/**
	 * Reset to uninitialized state.
	 */
	void reset() {
        lastRecalc_ = true;
		descid_ = std::numeric_limits<size_t>::max();
	}
	
	/**
	 * Return true iff this Descent is a search root.
	 */
	bool root() const {
		return parent_ == std::numeric_limits<TDescentId>::max();
	}
	
	/**
	 * Return the edit.
	 */
	const Edit& edit() const {
		return edit_;
	}
	
	/**
	 * Return id of parent.
	 */
	TDescentId parent() const {
		return parent_;
	}
	
	/**
	 * Take the best outgoing edge and follow it.
	 */
	void followBestOutgoing(
        const Read& q,                  // read
        const Ebwt& ebwtFw,             // forward index
        const Ebwt& ebwtBw,             // mirror index
        const Scoring& sc,              // scoring scheme
		TAlScore minsc,                 // minimum score
		TAlScore maxpen,                // maximum penalty
		DescentRedundancyChecker& re,   // redundancy checker
		EFactory<Descent>& df,          // factory with Descent
		EFactory<DescentPos>& pf,       // factory with DescentPoss
        const EList<DescentRoot>& rs,   // roots
        const EList<DescentConfig>& cs, // configs
        EHeap<TDescentPair>& heap,      // heap of descents
        DescentAlignmentSink& alsink,   // alignment sink
        DescentMetrics& met,            // metrics
		PerReadMetrics& prm);           // per-read metrics
	
	/**
	 * Return true iff no outgoing edges from this descent remain unexplored.
	 */
	bool empty() const { return lastRecalc_ && out_.empty(); }
	
#ifndef NDEBUG
	/**
	 * Return true iff the Descent is internally consistent.
	 */
	bool repOk(const Read *q) const {
		// A non-root can have an uninitialized edit_ if it is from a bounce
		//assert( root() ||  edit_.inited());
		assert(!root() || !edit_.inited());
		assert_eq(botf_ - topf_, botb_ - topb_);
		if(q != NULL) {
			assert_leq(len_, q->length());
		}
		return true;
	}
#endif
	
	size_t al5pi() const { return al5pi_; }
	size_t al5pf() const { return al5pf_; }
	bool l2r() const { return l2r_; }

	/**
	 * Print a stacked representation of this descent and all its parents.  Assumes that
	 */
	void print(
		std::ostream* os,
		const char *prefix,
        const Read& q,
		size_t trimLf,
		size_t trimRg,
		bool fw,
		const EList<Edit>& edits,
		size_t ei,
		size_t en,
		BTDnaString& rf) const;
	
	/**
	 * Collect all the edits
	 */
	void collectEdits(
		EList<Edit>& edits,
		const Edit *e,
		EFactory<Descent>& df)
	{
		// Take just the portion of the read that has aligned up until this
		// point
		size_t nuninited = 0;
		size_t ei = edits.size();
		size_t en = 0;
		if(e != NULL && e->inited()) {
			edits.push_back(*e);
			en++;
		}
		size_t cur = descid_;
		while(cur != std::numeric_limits<TDescentId>::max()) {
			if(!df[cur].edit().inited()) {
				nuninited++;
				assert_leq(nuninited, 2);
			} else {
				edits.push_back(df[cur].edit());
				en++;
			}
			cur = df[cur].parent();
		}
		// Sort just the edits we just added
		edits.sortPortion(ei, en);
	}
	
	TIndexOffU topf() const { return topf_; }
	TIndexOffU botf() const { return botf_; }

protected:

	/**
	 * When the search reaches the edge of the read and needs to "bounce" and
	 * extend in the other direction.
	 */
    bool bounce(
        const Read& q,                  // query string
        TIndexOffU topf,                 // SA range top in fw index
        TIndexOffU botf,                 // SA range bottom in fw index
        TIndexOffU topb,                 // SA range top in bw index
        TIndexOffU botb,                 // SA range bottom in bw index
        const Ebwt& ebwtFw,             // forward index
        const Ebwt& ebwtBw,             // mirror index
        const Scoring& sc,              // scoring scheme
		TAlScore minsc,                 // minimum score
		TAlScore maxpen,                // maximum penalty
		DescentRedundancyChecker& re,   // redundancy checker
		EFactory<Descent>& df,          // factory with Descent
		EFactory<DescentPos>& pf,       // factory with DescentPoss
        const EList<DescentRoot>& rs,   // roots
        const EList<DescentConfig>& cs, // configs
        EHeap<TDescentPair>& heap,      // heap of descents
        DescentAlignmentSink& alsink,   // alignment sink
        DescentMetrics& met,            // metrics
		PerReadMetrics& prm);           // per-read metrics

	/**
	 * Given the forward and backward indexes, and given topf/botf/topb/botb,
	 * get tloc, bloc ready for the next step.
	 */
	void nextLocsBi(
		const Ebwt& ebwtFw, // forward index
		const Ebwt& ebwtBw, // mirror index
		SideLocus& tloc,    // top locus
		SideLocus& bloc,    // bot locus
		TIndexOffU topf,      // top in BWT
		TIndexOffU botf,      // bot in BWT
		TIndexOffU topb,      // top in BWT'
		TIndexOffU botb);     // bot in BWT'

	/**
	 * Advance this descent by following read matches as far as possible.
	 */
    bool followMatches(
        const Read& q,     // query string
		const Scoring& sc,         // scoring scheme
        const Ebwt& ebwtFw,        // forward index
        const Ebwt& ebwtBw,        // mirror index
		DescentRedundancyChecker& re, // redundancy checker
        EFactory<Descent>& df,     // Descent factory
        EFactory<DescentPos>& pf,  // DescentPos factory
        const EList<DescentRoot>& rs,   // roots
        const EList<DescentConfig>& cs, // configs
        EHeap<TDescentPair>& heap, // heap
        DescentAlignmentSink& alsink, // alignment sink
        DescentMetrics& met,       // metrics
		PerReadMetrics& prm,       // per-read metrics
        bool& branches,            // out: true -> there are > 0 ways to branch
        bool& hitEnd,              // out: true -> hit read end with non-empty range
        bool& done,                // out: true -> we made a full alignment
        TReadOff& off5p_i,         // out: initial 5' offset
        TIndexOffU& topf_bounce,    // out: top of SA range for fw idx for bounce
        TIndexOffU& botf_bounce,    // out: bot of SA range for fw idx for bounce
        TIndexOffU& topb_bounce,    // out: top of SA range for bw idx for bounce
        TIndexOffU& botb_bounce);   // out: bot of SA range for bw idx for bounce

	/**
	 * Recalculate our summary of the outgoing edges from this descent.  When
	 * deciding what outgoing edges are legal, we abide by constraints.
	 * Typically, they limit the total of the penalties accumulated so far, as
	 * a function of distance from the search root.  E.g. a constraint might
	 * disallow any gaps or mismatches within 20 ply of the search root, then
	 * allow 1 mismatch within 30 ply, then allow up to 1 mismatch or 1 gap
	 * within 40 ply, etc.
	 */
	size_t recalcOutgoing(
		const Read& q,                   // query string
		const Scoring& sc,               // scoring scheme
		TAlScore minsc,                  // minimum score
		TAlScore maxpen,                 // maximum penalty
		DescentRedundancyChecker& re,    // redundancy checker
		EFactory<DescentPos>& pf,        // factory with DescentPoss
        const EList<DescentRoot>& rs,    // roots
        const EList<DescentConfig>& cs,  // configs
		PerReadMetrics& prm);            // per-read metrics

    TRootId         rid_;         // root id

	TReadOff        al5pi_;       // lo offset from 5' end of aligned read char
	TReadOff        al5pf_;       // hi offset from 5' end of aligned read char
	bool            l2r_;         // left-to-right?
	int             gapadd_;      // net ref characters additional
    TReadOff        off5p_i_;     // offset we started out at for this descent

	TIndexOffU       topf_, botf_; // incoming SA range w/r/t forward index
	TIndexOffU       topb_, botb_; // incoming SA range w/r/t forward index

	size_t          descid_;      // ID of this descent
	TDescentId      parent_;      // ID of parent descent
	TScore          pen_;         // total penalties accumulated so far
	size_t          posid_;       // ID of 1st elt of the DescentPos factory w/
	                              // descent pos info for this descent
	size_t          len_;         // length of stretch of matches
	DescentOutgoing out_;         // summary of outgoing edges
	Edit            edit_;        // edit joining this descent with parent
	bool            lastRecalc_;  // set by recalcOutgoing if out edges empty
};

/**
 * An alignment result from a Descent.
 */
struct DescentAlignment {

	DescentAlignment() { reset(); }

	/**
	 * Reset DescentAlignment to be uninitialized.
	 */
	void reset() {
		topf = botf = 0;
		pen = 0;
		fw = false;
		ei = en = 0;
	}

	/**
	 * Initialize this DescentAlignment.
	 */
	void init(
		TScore pen_,
		bool fw_,
		TIndexOffU topf_,
		TIndexOffU botf_,
		size_t ei_,
		size_t en_)
	{
		assert_gt(botf_, topf_);
		pen = pen_;
		fw = fw_;
		topf = topf_;
		botf = botf_;
		ei = ei_;
		en = en_;
	}
	
	/**
	 * Return true iff DescentAlignment is initialized.
	 */
	bool inited() const {
		return botf > topf;
	}
	
	/**
	 * Return true iff the alignment is perfect (has no edits)
	 */
	bool perfect() const {
		return pen == 0;
	}
	
	/**
	 * Return the number of elements in this range.
	 */
	size_t size() const {
		return botf - topf;
	}

	TScore pen; // penalty
	
	bool fw; // forward or revcomp aligned?

	TIndexOffU topf; // top in forward index
	TIndexOffU botf; // bot in forward index

	size_t ei; // First edit in DescentAlignmentSink::edits_ involved in aln
	size_t en; // # edits in DescentAlignmentSink::edits_ involved in aln
};

/**
 * A partial alignment result from a Descent where the reference offset has
 * been resolved.
 */
struct DescentPartialResolvedAlignment {

	DescentPartialResolvedAlignment() { reset(); }

	/**
	 * Reset DescentAlignment to be uninitialized.
	 */
	void reset() {
		topf = botf = 0;
		pen = 0;
		fw = false;
		ei = en = 0;
		refcoord.reset();
	}

	/**
	 * Initialize this DescentAlignment.
	 */
	void init(
		TScore pen_,
		bool fw_,
		TIndexOffU topf_,
		TIndexOffU botf_,
		size_t ei_,
		size_t en_,
		const Coord& refcoord_)
	{
		assert_gt(botf_, topf_);
		pen = pen_;
		fw = fw_;
		topf = topf_;
		botf = botf_;
		ei = ei_;
		en = en_;
		refcoord = refcoord_;
	}
	
	/**
	 * Return true iff DescentAlignment is initialized.
	 */
	bool inited() const {
		return botf > topf;
	}
	
	/**
	 * Return the number of elements in this range.
	 */
	size_t size() const {
		return botf - topf;
	}

	TScore pen;     // score
	
	bool fw;        // forward or revcomp aligned?

	TIndexOffU topf; // top in forward index
	TIndexOffU botf; // bot in forward index

	size_t ei;      // First edit in DescentPartialResolvedAlignmentSink::edits_ involved in aln
	size_t en;      // # edits in DescentPartialResolvedAlignmentSink::edits_ involved in aln
	
	Coord refcoord; // reference coord of leftmost ref char involved
};

/**
 * Class that accepts alignments found during descent and maintains the state
 * required to dispense them to consumers in an appropriate order.
 *
 * As for order in which they are dispensed, in order to maintain uniform
 * distribution over equal-scoring alignments, a good policy may be not to
 * dispense alignments at a given score stratum until *all* alignments at that
 * stratum have been accumulated (i.e. until our best-first search has moved on
 * to a worse stratum).  This also has the advantage that, for each alignment,
 * we can also report the number of other alignments in that cost stratum.
 *
 * A lazier alternative is to assume that the order in which alignments in a
 * given stratum arrive is already pseudo-random, which frees us from having to
 * wait until the entire stratum has been explored.  But there is reason to
 * think that this order is not truly pseudo-random, since our root placement
 * and root priorities will tend to first lead us to alignments with certain
 * patterns of edits.
 */
class DescentAlignmentSink {

public:

    /**
     * If this is the final descent in a complete end-to-end alignment, report
     * the alignment.
     */
    bool reportAlignment(
        const Read& q,           // query string
		const Ebwt& ebwtFw,              // forward index
		const Ebwt& ebwtBw,              // mirror index
		TIndexOffU topf,                  // SA range top in forward index
		TIndexOffU botf,                  // SA range bottom in forward index
		TIndexOffU topb,                  // SA range top in backward index
		TIndexOffU botb,                  // SA range bottom in backward index
        TDescentId id,                   // id of leaf Descent
		TRootId rid,                     // id of search root
        const Edit& e,                   // final edit, if needed
        TScore pen,                      // total penalty
        EFactory<Descent>& df,           // factory with Descent
        EFactory<DescentPos>& pf,        // factory with DescentPoss
        const EList<DescentRoot>& rs,    // roots
        const EList<DescentConfig>& cs); // configs
    
    /**
     * Reset to uninitialized state.
     */
    void reset() {
		edits_.clear();
		als_.clear();
		lhs_.clear();
		rhs_.clear();
		nelt_ = 0;
		bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
    }

	/**
	 * Return the total size occupued by the Descent driver and all its
	 * constituent parts.
	 */
	size_t totalSizeBytes() const {
		return edits_.totalSizeBytes() +
		       als_.totalSizeBytes() +
			   lhs_.totalSizeBytes() +
			   rhs_.totalSizeBytes() +
			   sizeof(size_t);
	}

	/**
	 * Return the total capacity of the Descent driver and all its constituent
	 * parts.
	 */
	size_t totalCapacityBytes() const {
		return edits_.totalCapacityBytes() +
		       als_.totalCapacityBytes() +
			   lhs_.totalCapacityBytes() +
			   rhs_.totalCapacityBytes() +
			   sizeof(size_t);
	}
	
	/**
	 * Return the number of SA ranges involved in hits.
	 */
	size_t nrange() const {
		return als_.size();
	}

	/**
	 * Return the number of SA elements involved in hits.
	 */
	size_t nelt() const {
		return nelt_;
	}
	
	/**
	 * The caller provides 'i', which is an offset of a particular element in
	 * one of the SA ranges in the current stratum.  This function returns, in
	 * 'al' and 'off', information about the element in terms of the range it's
	 * part of and its offset into that range.
	 */
	void elt(size_t i, DescentAlignment& al, size_t& ri, size_t& off) const {
		assert_lt(i, nelt());
		for(size_t j = 0; j < als_.size(); j++) {
			if(i < als_[j].size()) {
				al = als_[j];
				ri = j;
				off = i;
				return;
			}
			i -= als_[j].size();
		}
		assert(false);
	}
	
	/**
	 * Get a particular alignment.
	 */
	const DescentAlignment& operator[](size_t i) const {
		return als_[i];
	}

	/**
	 * Return true iff (a) we found an alignment since the sink was initialized
	 * or since the last time advanceStratum() was called, and (b) the penalty
	 * associated with the current-best task on the heap ('best') is worse
	 * (higher) than the penalty associated with the alignments found most
	 * recently (worstPen_).
	 */
	bool stratumDone(TAlScore bestPen) const {
		if(nelt_ > 0 && bestPen > worstPen_) {
			return true;
		}
		return false;
	}
	
	/**
	 * The alignment consumer calls this to indicate that they are done with
	 * all the alignments in the current best non-empty stratum.  We can
	 * therefore mark all those alignments as "reported" and start collecting
	 * results for the next stratum.
	 */
	void advanceStratum() {
		assert_gt(nelt_, 0);
		edits_.clear();
		als_.clear();
		// Don't reset lhs_ or rhs_
		nelt_ = 0;
		bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
	}
	
#ifndef NDEBUG
	/**
	 * Check that alignment sink is internally consistent.
	 */
	bool repOk() const {
		assert_geq(nelt_, als_.size());
		for(size_t i = 1; i < als_.size(); i++) {
			assert_geq(als_[i].pen, als_[i-1].pen);
		}
		assert(bestPen_ == std::numeric_limits<TAlScore>::max() || worstPen_ >= bestPen_);
		return true;
	}
#endif
	
	TAlScore bestPenalty() const { return bestPen_; }
	TAlScore worstPenalty() const { return worstPen_; }

	size_t editsSize() const { return edits_.size(); }
	size_t alsSize() const { return als_.size(); }
	size_t lhsSize() const { return lhs_.size(); }
	size_t rhsSize() const { return rhs_.size(); }
	
	const EList<Edit>& edits() const { return edits_; }

protected:

	EList<Edit> edits_;
	EList<DescentAlignment> als_;
	ESet<Triple<TIndexOffU, TIndexOffU, size_t> > lhs_;
	ESet<Triple<TIndexOffU, TIndexOffU, size_t> > rhs_;
	size_t nelt_;
	TAlScore bestPen_;  // best (smallest) penalty among as-yet-unreported alns
	TAlScore worstPen_; // worst (greatest) penalty among as-yet-unreported alns
#ifndef NDEBUG
	BTDnaString tmprfdnastr_;
#endif

};

/**
 * Class that aggregates partial alignments taken from a snapshot of the
 * DescentDriver heap.
 */
class DescentPartialResolvedAlignmentSink {

public:
   
    /**
     * Reset to uninitialized state.
     */
    void reset() {
		edits_.clear();
		als_.clear();
    }

	/**
	 * Return the total size occupued by the Descent driver and all its
	 * constituent parts.
	 */
	size_t totalSizeBytes() const {
		return edits_.totalSizeBytes() +
		       als_.totalSizeBytes() +
			   sizeof(size_t);
	}

	/**
	 * Return the total capacity of the Descent driver and all its constituent
	 * parts.
	 */
	size_t totalCapacityBytes() const {
		return edits_.totalCapacityBytes() +
		       als_.totalCapacityBytes() +
			   sizeof(size_t);
	}
	
	/**
	 * Get a particular alignment.
	 */
	const DescentPartialResolvedAlignment& operator[](size_t i) const {
		return als_[i];
	}
	
	size_t editsSize() const { return edits_.size(); }
	size_t alsSize() const { return als_.size(); }
	
	const EList<Edit>& edits() const { return edits_; }

protected:

	EList<Edit> edits_;
	EList<DescentPartialResolvedAlignment> als_;
};

/**
 * Abstract parent for classes that select descent roots and descent
 * configurations given information about the read.
 */
class DescentRootSelector {

public:

	virtual ~DescentRootSelector() { }

	virtual void select(
		const Read& q,          // read that we're selecting roots for
		const Read* qo,         // opposite mate, if applicable
		bool nofw,              // don't add roots for fw read
		bool norc,              // don't add roots for rc read
		EList<DescentConfig>& confs,    // put DescentConfigs here
		EList<DescentRoot>& roots) = 0; // put DescentRoot here
};

/**
 * Encapsulates a set of conditions governing when the DescentDriver should
 * stop.
 */
struct DescentStoppingConditions {

	DescentStoppingConditions() { reset(); }

	DescentStoppingConditions(
		size_t totsz_,
		size_t nfound_,
		bool stra_,
		size_t nbwop_)
	{
		init(totsz_, nfound_, stra_, nbwop_);
	}
	
	/**
	 * Reset to uninitialized state.
	 */
	void reset() {
		totsz = nfound = nbwop = std::numeric_limits<size_t>::max();
		stra = false;
		assert(!inited());
	}

	/**
	 * Initialize this DescentStoppingConditions.
	 */
	void init(
		size_t totsz_,
		size_t nfound_,
		bool stra_,
		size_t nbwop_)
	{
		totsz = totsz_;
		nfound = nfound_;
		stra = stra_;
		nbwop = nbwop_;
		assert(inited());
	}
	
	/**
	 * Return true iff this instance is initialized.
	 */
	bool inited() const {
		return totsz != std::numeric_limits<size_t>::max();
	}

	size_t totsz;  // total size of all the expandable data structures in bytes
	size_t nfound; // # alignments found
	bool stra;     // stop after each non-empty stratum
	size_t nbwop;  // # Burrows-Wheeler (rank) operations performed
};

enum {
	DESCENT_DRIVER_ALN = 1,
	DESCENT_DRIVER_STRATA = 2,
	DESCENT_DRIVER_MEM = 4,
	DESCENT_DRIVER_BWOPS = 8,
	DESCENT_DRIVER_DONE = 16
};

/**
 * Class responsible for advancing all the descents.  The initial descents may
 * emanate from several different locations in the read.  Note that descents
 * may become redundant with each other, and should then be eliminated.
 */
class DescentDriver {
public:

	DescentDriver(bool veryVerbose = false) :
		veryVerbose_(veryVerbose)
	{
		reset();
	}
	
	/**
	 * Initialize driver with respect to a new read.  If a DescentRootSelector
	 * is specified, then it is used to obtain roots as well.
	 */
	void initRead(
		const Read& q,
		bool nofw,
		bool norc,
		TAlScore minsc,
		TAlScore maxpen,
		const Read* qmate = NULL,
		DescentRootSelector *sel = NULL)
	{
		reset();
		q_ = q;           // copy the read itself
		minsc_ = minsc;   // minimum score
		maxpen_ = maxpen; // maximum penalty
		if(sel != NULL) {
			sel->select(  // Select search roots
				q_,       // in: read
				qmate,    // in: opposite mate, if paired
				nofw,     // in: true -> don't put roots on fw read
				norc,     // in: true -> don't put roots on rc read
				confs_,   // out: search configs for each root
				roots_);  // out: roots
			//printRoots(std::cerr);
		}
		re_.init(q.length()); // initialize redundancy checker
	}
	
	/**
	 * Add a new search root, which might (a) prefer to move in a left-to-right
	 * direction, and might (b) be with respect to the read or its reverse
	 * complement.
	 */
	void addRoot(
        const DescentConfig& conf,
        TReadOff off,
        bool l2r,
        bool fw,
		size_t landing,
        float pri)
    {
        confs_.push_back(conf);
		assert_lt(off, q_.length());
		if(l2r && off == q_.length()-1) {
			l2r = !l2r;
		} else if(!l2r && off == 0) {
			l2r = !l2r;
		}
		roots_.push_back(DescentRoot(off, l2r, fw, landing, q_.length(), pri));
	}
	
	/**
	 * Clear out the DescentRoots currently configured.
	 */
	void clearRoots() {
		confs_.clear();
		roots_.clear();
	}
	
	/**
	 * Print ASCII picture of where we put the roots.
	 */
	void printRoots(std::ostream& os) {
		std::ostringstream fwstr, rcstr;
		fwstr << q_.patFw << std::endl << q_.qual << std::endl;
		rcstr << q_.patRc << std::endl << q_.qualRev << std::endl;
		for(size_t i = 0; i < roots_.size(); i++) {
			if(roots_[i].fw) {
				for(size_t j = 0; j < roots_[i].off5p; j++) {
					fwstr << " ";
				}
				fwstr << (roots_[i].l2r ? ">" : "<");
				fwstr << " " << i << ":";
				fwstr << roots_[i].pri;
				fwstr << "\n";
			} else {
				size_t off = q_.length() - roots_[i].off5p - 1;
				for(size_t j = 0; j < off; j++) {
					rcstr << " ";
				}
				rcstr << (roots_[i].l2r ? ">" : "<");
				rcstr << " " << i << ":";
				rcstr << roots_[i].pri;
				rcstr << "\n";
			}
		}
		os << fwstr.str() << rcstr.str();
	}
	
	/**
	 * Clear the Descent driver so that we're ready to re-start seed alignment
	 * for the current read.
	 */
	void resetRead() {
		df_.clear();     // clear Descents
		assert_leq(df_.totalSizeBytes(), 100);
		pf_.clear();     // clear DescentPoss
		assert_leq(pf_.totalSizeBytes(), 100);
		heap_.clear();   // clear Heap
		assert_leq(heap_.totalSizeBytes(), 100);
		roots_.clear();  // clear roots
		assert_leq(roots_.totalSizeBytes(), 100);
		confs_.clear();  // clear confs
		assert_leq(confs_.totalSizeBytes(), 100);
        alsink_.reset(); // clear alignment sink
		assert_leq(alsink_.totalSizeBytes(), 100);
		re_.reset();
		assert_leq(re_.totalSizeBytes(), 100);
		rootsInited_ = 0; // haven't yet created initial descents
		curPen_ = 0;      //
	}
	
	/**
	 * Clear the Descent driver so that we're ready to re-start seed alignment
	 * for the current read.
	 */
	void reset() {
		resetRead();
	}

	/**
	 * Perform seed alignment.
	 */
	void go(
        const Scoring& sc,    // scoring scheme
		const Ebwt& ebwtFw,   // forward index
		const Ebwt& ebwtBw,   // mirror index
        DescentMetrics& met,  // metrics
		PerReadMetrics& prm); // per-read metrics

	/**
	 * Perform seed alignment until some stopping condition is satisfied.
	 */
	int advance(
		const DescentStoppingConditions& stopc, // stopping conditions
        const Scoring& sc,    // scoring scheme
		const Ebwt& ebwtFw,   // forward index
		const Ebwt& ebwtBw,   // mirror index
        DescentMetrics& met,  // metrics
		PerReadMetrics& prm); // per-read metrics

#ifndef NDEBUG
	/**
	 * Return true iff this DescentDriver is well formed.  Throw an assertion
	 * otherwise.
	 */
	bool repOk() const {
		return true;
	}
#endif

	/**
	 * Return the number of end-to-end alignments reported.
	 */
	size_t numAlignments() const {
		return alsink_.nelt();
	}
	
	/**
	 * Return the associated DescentAlignmentSink object.
	 */
	const DescentAlignmentSink& sink() const {
		return alsink_;
	}

	/**
	 * Return the associated DescentAlignmentSink object.
	 */
	DescentAlignmentSink& sink() {
		return alsink_;
	}
	
	/**
	 * Return the total size occupued by the Descent driver and all its
	 * constituent parts.
	 */
	size_t totalSizeBytes() const {
		return df_.totalSizeBytes() +
		       pf_.totalSizeBytes() +
			   heap_.totalSizeBytes() +
			   roots_.totalSizeBytes() +
			   confs_.totalSizeBytes() +
		       alsink_.totalSizeBytes() +
			   re_.totalSizeBytes();
	}

	/**
	 * Return the total capacity of the Descent driver and all its constituent
	 * parts.
	 */
	size_t totalCapacityBytes() const {
		return df_.totalCapacityBytes() +
		       pf_.totalCapacityBytes() +
			   heap_.totalCapacityBytes() +
			   roots_.totalCapacityBytes() +
			   confs_.totalCapacityBytes() +
		       alsink_.totalCapacityBytes() +
			   re_.totalCapacityBytes();
	}
	
	/**
	 * Return a const ref to the query.
	 */
	const Read& query() const {
		return q_;
	}
	
	/**
	 * Return the minimum score that must be achieved by an alignment in order
	 * for it to be considered "valid".
	 */
	TAlScore minScore() const {
		return minsc_;
	}
	
	const EList<DescentRoot>& roots() { return roots_; }
	
	/**
	 * Called to pause the index-assisted search, and collect a set of partial
	 * alignments to try using dynamic programming.
	 *
	 * The space explored so far is represented by the prioritized collection
	 * of Descents in the heap.  Each Descent has one or more outgoing edges.
	 * Each outgoing edge is a set of >=1 partial alignments we might try.
	 */
	void nextPartial() {
	}

protected:

	Read                 q_;      // query nucleotide and quality strings
	TAlScore             minsc_;  // minimum score
	TAlScore             maxpen_; // maximum penalty
	EFactory<Descent>    df_;     // factory holding all the Descents, which
	                              // must be referred to by ID
	EFactory<DescentPos> pf_;     // factory holding all the DescentPoss, which
	                              // must be referred to by ID
	EList<DescentRoot>   roots_;  // search roots
    EList<DescentConfig> confs_;  // configuration params for each root
	size_t rootsInited_;          // # initial Descents already created
	EHeap<TDescentPair>  heap_;   // priority queue of Descents
    DescentAlignmentSink alsink_; // alignment sink
	DescentRedundancyChecker re_; // redundancy checker
	TAlScore             curPen_; // current penalty
	bool veryVerbose_;            // print lots of partial alignments
	
	EList<Edit> tmpedit_;
	BTDnaString tmprfdnastr_;
};

/**
 * Selects alignments to report from a complete non-empty stratum of
 * alignments stored in the DescentAlignmentSink.
 */
class DescentAlignmentSelector {

public:

	DescentAlignmentSelector() : gwstate_(GW_CAT) { reset(); }

	/**
	 * Initialize a new selector w/r/t a DescentAlignmentSink holding a
	 * non-empty alignment stratum.
	 */
	void init(
		const Read& q,
		const DescentAlignmentSink& sink,
		const Ebwt& ebwtFw,         // forward Bowtie index for walking left
		const BitPairReference& ref,// bitpair-encoded reference
		RandomSource& rnd,          // pseudo-random generator for sampling rows
		WalkMetrics& met)
	{
		// We're going to sample from space of *alignments*, not ranges.  So
		// when we extract a sample, we'll have to do a little extra work to
		// convert it to a <range, offset> coordinate.
		rnd_.init(
			sink.nelt(), // # elements to choose from
			true);       // without replacement
		offs_.resize(sink.nelt());
		offs_.fill(std::numeric_limits<TIndexOffU>::max());
		sas_.resize(sink.nrange());
		gws_.resize(sink.nrange());
		size_t ei = 0;
		for(size_t i = 0; i < sas_.size(); i++) {
			size_t en = sink[i].botf - sink[i].topf;
			sas_[i].init(sink[i].topf, EListSlice<TIndexOffU, 16>(offs_, ei, en));
			gws_[i].init(ebwtFw, ref, sas_[i], rnd, met);
			ei += en;
		}
	}
	
	/**
	 * Reset the selector.
	 */
	void reset() {
		rnd_.reset();
	}
	
	/**
	 * Return true iff the selector is currently initialized.
	 */
	bool inited() const {
		return rnd_.size() > 0;
	}
	
	/**
	 * Get next alignment and convert it to an AlnRes.
	 */
	bool next(
		const DescentDriver& dr,
		const Ebwt& ebwtFw,          // forward Bowtie index for walking left
		const BitPairReference& ref, // bitpair-encoded reference
		RandomSource& rnd,
		AlnRes& rs,
		WalkMetrics& met,
		PerReadMetrics& prm)
	{
		// Sample one alignment randomly from pool of remaining alignments
		size_t ri = (size_t)rnd_.next(rnd);
		size_t off = 0;
		DescentAlignment al;
		size_t rangei = 0;
		// Convert random alignment index into a <range, offset> coordinate
		dr.sink().elt(ri, al, rangei, off);
		assert_lt(off, al.size());
		Coord refcoord;
		WalkResult wr;
		TIndexOffU tidx = 0, toff = 0, tlen = 0;
		gws_[rangei].advanceElement(
			(TIndexOffU)off,
			ebwtFw,       // forward Bowtie index for walking left
			ref,          // bitpair-encoded reference
			sas_[rangei], // SA range with offsets
			gwstate_,     // GroupWalk state; scratch space
			wr,           // put the result here
			met,          // metrics
			prm);         // per-read metrics
		assert_neq(OFF_MASK, wr.toff);
		bool straddled = false;
		ebwtFw.joinedToTextOff(
			wr.elt.len,
			wr.toff,
			tidx,
			toff,
			tlen,
			true,        // reject straddlers?
			straddled);  // straddled?
		if(tidx == OFF_MASK) {
			// The seed hit straddled a reference boundary so the seed
			// hit isn't valid
			return false;
		}
		// Coordinate of the seed hit w/r/t the pasted reference string
		refcoord.init(tidx, (int64_t)toff, dr.sink()[rangei].fw);
		const EList<Edit>& edits = dr.sink().edits();
		size_t ns = 0, ngap = 0, nrefn = 0;
		for(size_t i = al.ei; i < al.ei + al.en; i++) {
			if(edits[i].qchr == 'N' || edits[i].chr == 'N') ns++;
			if(edits[i].chr == 'N') nrefn++;
			if(edits[i].isGap()) ngap++;
		}
		AlnScore asc(
			-dr.sink().bestPenalty(),  // numeric score
			ns,                        // # Ns
			ngap);                     // # gaps
		rs.init(
			dr.query().length(),       // # chars after hard trimming
			asc,                       // alignment score
			&dr.sink().edits(),        // nucleotide edits array
			al.ei,                     // nucleotide edits first pos
			al.en,                     // nucleotide edits last pos
			NULL,                      // ambig base array
			0,                         // ambig base first pos
			0,                         // ambig base last pos
			refcoord,                  // coord of leftmost aligned char in ref
			tlen,                      // length of reference aligned to
			-1,                        // # seed mms allowed
			-1,                        // seed length
			-1,                        // seed interval
			dr.minScore(),             // minimum score for valid alignment
			-1,                        // nuc5p (for colorspace)
			-1,                        // nuc3p (for colorspace)
			false,                     // soft pre-trimming?
			0,                         // 5p pre-trimming
			0,                         // 3p pre-trimming
			false,                     // soft trimming?
			0,                         // 5p trimming
			0);                        // 3p trimming
		rs.setRefNs(nrefn);
		return true;
	}
	
	/**
	 * Return true iff all elements have been reported.
	 */
	bool done() const {
		return rnd_.done();
	}

	/**
	 * Return the total size occupued by the Descent driver and all its
	 * constituent parts.
	 */
	size_t totalSizeBytes() const {
		return rnd_.totalSizeBytes() +
		       offs_.totalSizeBytes() +
			   sas_.totalSizeBytes() +
			   gws_.totalSizeBytes();
	}

	/**
	 * Return the total capacity of the Descent driver and all its constituent
	 * parts.
	 */
	size_t totalCapacityBytes() const {
		return rnd_.totalCapacityBytes() +
		       offs_.totalCapacityBytes() +
			   sas_.totalCapacityBytes() +
			   gws_.totalCapacityBytes();
	}
	
protected:

	Random1toN rnd_;
	EList<TIndexOffU, 16> offs_;
	EList<SARangeWithOffs<EListSlice<TIndexOffU, 16> > > sas_;
	EList<GroupWalk2S<EListSlice<TIndexOffU, 16>, 16> > gws_;
	GroupWalkState gwstate_;
};

/**
 * Selects and prioritizes partial alignments from the heap of the
 * DescentDriver.  We assume that the heap is no longer changing (i.e. that the
 * DescentDriver is done).  Usually, the user will then attempt to extend the
 * partial alignments into full alignments.  This can happen incrementally;
 * that is, the user might ask for the partial alignments one "batch" at a
 * time, and the selector will only do as much work is necessary to supply each
 * requesteded batch.
 *
 * The actual work done here includes: (a) scanning the heap for high-priority
 * partial alignments, (b) setting up the rnd_, offs_, sas_, gws_, and gwstate_
 * fields and resolving offsets of partial alignments, (c) packaging and
 * delivering batches of results to the caller.
 *
 * How to prioritize partial alignments?  One idea is to use the same
 * penalty-based prioritization used in the heap.  This has pros: (a) we can
 * visit the partial alignments in best-to-worst order w/r/t penalty, (b) the
 * heap is already prioritized this way, so it's easier for us to compile
 * high-priority partial alignments.  But the con is that it doesn't take depth
 * into account, which could mean that we're extending a lot of very short
 * partial alignments first.
 *
 * Some ranges will be large and others will be small.  It's a good idea to try
 * all the elements in the small ranges, but it's also good not to ignore the
 * large ranges.  One idea is to keep all the large ranges in one category and
 * all the small ranges in another and alternate between the two.
 */
class DescentPartialAlignmentSelector {

public:

	// Ranges bigger than this are considered "big" and put in their own
	// category.
	static const size_t BIG_RANGE = 5;

	// Number of ranges to pull out of the heap in one go
	static const size_t NRANGE_AT_A_TIME = 3;

	DescentPartialAlignmentSelector() : gwstate_(GW_CAT) { reset(); }

	/**
	 * Initialize a new selector w/r/t a read, index and heap of partial
	 * alignments.
	 */
	void init(
		const Read& q,                   // read
		const EHeap<TDescentPair>& heap, // the heap w/ the partial alns
        EFactory<Descent>& df,           // Descent factory
        EFactory<DescentPos>& pf,        // DescentPos factory
		TAlScore depthBonus,             // use depth when prioritizing
		size_t nbatch,                   // # of alignments in a batch
		const Ebwt& ebwtFw,              // forward Bowtie index for walk-left
		const BitPairReference& ref,     // bitpair-encoded reference
		RandomSource& rnd,               // pseudo-randoms for sampling rows
		WalkMetrics& met)                // metrics re: offset resolution
	{
		// Make our internal heap
		if(depthBonus > 0) {
			heap_.clear();
			for(size_t i = 0; i < heap.size(); i++) {
				TDescentPair p = heap[i];
				p.first.pen += depthBonus * p.first.depth;
				heap_.insert(p);
			}
		} else heap_ = heap;
		assert(!heap_.empty());
		nextRanges(df, pf, ebwtFw, ref, rnd, met);
		assert(!rangeExhausted());
	}
	
	/**
	 * Return true iff there are no more partial alignments to extend.
	 */
	bool empty() const {
		return heap_.empty();
	}
	
	/**
	 * Reset the selector.
	 */
	void reset() {
		heap_.clear();
		offs_.clear();
		sas_.clear();
		gws_.clear();
	}
	
	/**
	 * Return true iff the selector is currently initialized.
	 */
	bool inited() const {
		return !heap_.empty();
	}
	
	/**
	 * Get next partial alignment and convert it to an AlnRes.
	 */
	bool nextPartial(
		const DescentDriver& dr,
		const Ebwt& ebwtFw,          // forward Bowtie index for walking left
		const BitPairReference& ref, // bitpair-encoded reference
		RandomSource& rnd,
		AlnRes& rs,
		WalkMetrics& met,
		PerReadMetrics& prm)
	{
		// Sample one alignment randomly from pool of remaining alignments
		size_t ri = (size_t)rnd_.next(rnd);
		size_t off = 0;
		DescentAlignment al;
		size_t rangei = 0;
		// Convert random alignment index into a <range, offset> coordinate
		dr.sink().elt(ri, al, rangei, off);
		assert_lt(off, al.size());
		Coord refcoord;
		WalkResult wr;
		TIndexOffU tidx = 0, toff = 0, tlen = 0;
		gws_[rangei].advanceElement(
			(TIndexOffU)off,
			ebwtFw,       // forward Bowtie index for walking left
			ref,          // bitpair-encoded reference
			sas_[rangei], // SA range with offsets
			gwstate_,     // GroupWalk state; scratch space
			wr,           // put the result here
			met,          // metrics
			prm);         // per-read metrics
		assert_neq(OFF_MASK, wr.toff);
		bool straddled = false;
		ebwtFw.joinedToTextOff(
			wr.elt.len,
			wr.toff,
			tidx,
			toff,
			tlen,
			true,        // reject straddlers?
			straddled);  // straddled?
		if(tidx == OFF_MASK) {
			// The seed hit straddled a reference boundary so the seed
			// hit isn't valid
			return false;
		}
		refcoord.init(tidx, (int64_t)toff, dr.sink()[rangei].fw);
		const EList<Edit>& edits = dr.sink().edits();
		size_t ns = 0, ngap = 0, nrefn = 0;
		for(size_t i = al.ei; i < al.ei + al.en; i++) {
			if(edits[i].qchr == 'N' || edits[i].chr == 'N') ns++;
			if(edits[i].chr == 'N') nrefn++;
			if(edits[i].isGap()) ngap++;
		}
		return true;
	}
	
	/**
	 * Return the total size occupued by the Descent driver and all its
	 * constituent parts.
	 */
	size_t totalSizeBytes() const {
		return heap_.totalSizeBytes() +
		       rnd_.totalSizeBytes() +
		       offs_.totalSizeBytes() +
			   sas_.totalSizeBytes() +
			   gws_.totalSizeBytes();
	}
	
	/**
	 * Return the total capacity of the Descent driver and all its constituent
	 * parts.
	 */
	size_t totalCapacityBytes() const {
		return heap_.totalCapacityBytes() +
		       rnd_.totalCapacityBytes() +
		       offs_.totalCapacityBytes() +
			   sas_.totalCapacityBytes() +
			   gws_.totalCapacityBytes();
	}
	
protected:
	
	/**
	 * Return true iff all elements in the current range have been extended.
	 */
	bool rangeExhausted() const {
		return rnd_.left() == 0;
	}
	
	/**
	 *
	 */
	void nextRanges(
        EFactory<Descent>& df,           // Descent factory
        EFactory<DescentPos>& pf,        // DescentPos factory
		const Ebwt& ebwtFw,              // forward Bowtie index for walk-left
		const BitPairReference& ref,     // bitpair-encoded reference
		RandomSource& rnd,               // pseudo-randoms for sampling rows
		WalkMetrics& met)                // metrics re: offset resolution
	{
		// Pop off the topmost
		assert(!heap_.empty());
		TDescentPair p = heap_.pop();
		TIndexOffU topf = df[p.second].topf(), botf = df[p.second].botf();
		assert_gt(botf, topf);
		offs_.resize(botf - topf);
		offs_.fill(std::numeric_limits<TIndexOffU>::max());
		rnd_.init(botf - topf, true); // without replacement
		sas_.resize(1);
		gws_.resize(1);
		sas_[0].init(topf, EListSlice<TIndexOffU, 16>(offs_, 0, botf - topf));
		gws_[0].init(ebwtFw, ref, sas_[0], rnd, met);
	}
	
	DescentPartialResolvedAlignmentSink palsink_;

	// This class's working heap.  This might simply be a copy of the original
	// heap, or it might be re-prioritized in some way.
	EHeap<TDescentPair> heap_;

	Random1toN rnd_;
	EList<TIndexOffU, 16> offs_;
	EList<SARangeWithOffs<EListSlice<TIndexOffU, 16> > > sas_;
	EList<GroupWalk2S<EListSlice<TIndexOffU, 16>, 16> > gws_;
	GroupWalkState gwstate_;
};

#endif