File: aligner_seed2.cpp

package info (click to toggle)
bowtie2 2.4.2-2
  • links: PTS, VCS
  • area: main
  • in suites: bullseye, sid
  • size: 27,104 kB
  • sloc: cpp: 60,331; perl: 7,540; sh: 1,111; python: 949; makefile: 520; ansic: 122
file content (3187 lines) | stat: -rw-r--r-- 104,089 bytes parent folder | download | duplicates (5)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
462
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
506
507
508
509
510
511
512
513
514
515
516
517
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
634
635
636
637
638
639
640
641
642
643
644
645
646
647
648
649
650
651
652
653
654
655
656
657
658
659
660
661
662
663
664
665
666
667
668
669
670
671
672
673
674
675
676
677
678
679
680
681
682
683
684
685
686
687
688
689
690
691
692
693
694
695
696
697
698
699
700
701
702
703
704
705
706
707
708
709
710
711
712
713
714
715
716
717
718
719
720
721
722
723
724
725
726
727
728
729
730
731
732
733
734
735
736
737
738
739
740
741
742
743
744
745
746
747
748
749
750
751
752
753
754
755
756
757
758
759
760
761
762
763
764
765
766
767
768
769
770
771
772
773
774
775
776
777
778
779
780
781
782
783
784
785
786
787
788
789
790
791
792
793
794
795
796
797
798
799
800
801
802
803
804
805
806
807
808
809
810
811
812
813
814
815
816
817
818
819
820
821
822
823
824
825
826
827
828
829
830
831
832
833
834
835
836
837
838
839
840
841
842
843
844
845
846
847
848
849
850
851
852
853
854
855
856
857
858
859
860
861
862
863
864
865
866
867
868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
884
885
886
887
888
889
890
891
892
893
894
895
896
897
898
899
900
901
902
903
904
905
906
907
908
909
910
911
912
913
914
915
916
917
918
919
920
921
922
923
924
925
926
927
928
929
930
931
932
933
934
935
936
937
938
939
940
941
942
943
944
945
946
947
948
949
950
951
952
953
954
955
956
957
958
959
960
961
962
963
964
965
966
967
968
969
970
971
972
973
974
975
976
977
978
979
980
981
982
983
984
985
986
987
988
989
990
991
992
993
994
995
996
997
998
999
1000
1001
1002
1003
1004
1005
1006
1007
1008
1009
1010
1011
1012
1013
1014
1015
1016
1017
1018
1019
1020
1021
1022
1023
1024
1025
1026
1027
1028
1029
1030
1031
1032
1033
1034
1035
1036
1037
1038
1039
1040
1041
1042
1043
1044
1045
1046
1047
1048
1049
1050
1051
1052
1053
1054
1055
1056
1057
1058
1059
1060
1061
1062
1063
1064
1065
1066
1067
1068
1069
1070
1071
1072
1073
1074
1075
1076
1077
1078
1079
1080
1081
1082
1083
1084
1085
1086
1087
1088
1089
1090
1091
1092
1093
1094
1095
1096
1097
1098
1099
1100
1101
1102
1103
1104
1105
1106
1107
1108
1109
1110
1111
1112
1113
1114
1115
1116
1117
1118
1119
1120
1121
1122
1123
1124
1125
1126
1127
1128
1129
1130
1131
1132
1133
1134
1135
1136
1137
1138
1139
1140
1141
1142
1143
1144
1145
1146
1147
1148
1149
1150
1151
1152
1153
1154
1155
1156
1157
1158
1159
1160
1161
1162
1163
1164
1165
1166
1167
1168
1169
1170
1171
1172
1173
1174
1175
1176
1177
1178
1179
1180
1181
1182
1183
1184
1185
1186
1187
1188
1189
1190
1191
1192
1193
1194
1195
1196
1197
1198
1199
1200
1201
1202
1203
1204
1205
1206
1207
1208
1209
1210
1211
1212
1213
1214
1215
1216
1217
1218
1219
1220
1221
1222
1223
1224
1225
1226
1227
1228
1229
1230
1231
1232
1233
1234
1235
1236
1237
1238
1239
1240
1241
1242
1243
1244
1245
1246
1247
1248
1249
1250
1251
1252
1253
1254
1255
1256
1257
1258
1259
1260
1261
1262
1263
1264
1265
1266
1267
1268
1269
1270
1271
1272
1273
1274
1275
1276
1277
1278
1279
1280
1281
1282
1283
1284
1285
1286
1287
1288
1289
1290
1291
1292
1293
1294
1295
1296
1297
1298
1299
1300
1301
1302
1303
1304
1305
1306
1307
1308
1309
1310
1311
1312
1313
1314
1315
1316
1317
1318
1319
1320
1321
1322
1323
1324
1325
1326
1327
1328
1329
1330
1331
1332
1333
1334
1335
1336
1337
1338
1339
1340
1341
1342
1343
1344
1345
1346
1347
1348
1349
1350
1351
1352
1353
1354
1355
1356
1357
1358
1359
1360
1361
1362
1363
1364
1365
1366
1367
1368
1369
1370
1371
1372
1373
1374
1375
1376
1377
1378
1379
1380
1381
1382
1383
1384
1385
1386
1387
1388
1389
1390
1391
1392
1393
1394
1395
1396
1397
1398
1399
1400
1401
1402
1403
1404
1405
1406
1407
1408
1409
1410
1411
1412
1413
1414
1415
1416
1417
1418
1419
1420
1421
1422
1423
1424
1425
1426
1427
1428
1429
1430
1431
1432
1433
1434
1435
1436
1437
1438
1439
1440
1441
1442
1443
1444
1445
1446
1447
1448
1449
1450
1451
1452
1453
1454
1455
1456
1457
1458
1459
1460
1461
1462
1463
1464
1465
1466
1467
1468
1469
1470
1471
1472
1473
1474
1475
1476
1477
1478
1479
1480
1481
1482
1483
1484
1485
1486
1487
1488
1489
1490
1491
1492
1493
1494
1495
1496
1497
1498
1499
1500
1501
1502
1503
1504
1505
1506
1507
1508
1509
1510
1511
1512
1513
1514
1515
1516
1517
1518
1519
1520
1521
1522
1523
1524
1525
1526
1527
1528
1529
1530
1531
1532
1533
1534
1535
1536
1537
1538
1539
1540
1541
1542
1543
1544
1545
1546
1547
1548
1549
1550
1551
1552
1553
1554
1555
1556
1557
1558
1559
1560
1561
1562
1563
1564
1565
1566
1567
1568
1569
1570
1571
1572
1573
1574
1575
1576
1577
1578
1579
1580
1581
1582
1583
1584
1585
1586
1587
1588
1589
1590
1591
1592
1593
1594
1595
1596
1597
1598
1599
1600
1601
1602
1603
1604
1605
1606
1607
1608
1609
1610
1611
1612
1613
1614
1615
1616
1617
1618
1619
1620
1621
1622
1623
1624
1625
1626
1627
1628
1629
1630
1631
1632
1633
1634
1635
1636
1637
1638
1639
1640
1641
1642
1643
1644
1645
1646
1647
1648
1649
1650
1651
1652
1653
1654
1655
1656
1657
1658
1659
1660
1661
1662
1663
1664
1665
1666
1667
1668
1669
1670
1671
1672
1673
1674
1675
1676
1677
1678
1679
1680
1681
1682
1683
1684
1685
1686
1687
1688
1689
1690
1691
1692
1693
1694
1695
1696
1697
1698
1699
1700
1701
1702
1703
1704
1705
1706
1707
1708
1709
1710
1711
1712
1713
1714
1715
1716
1717
1718
1719
1720
1721
1722
1723
1724
1725
1726
1727
1728
1729
1730
1731
1732
1733
1734
1735
1736
1737
1738
1739
1740
1741
1742
1743
1744
1745
1746
1747
1748
1749
1750
1751
1752
1753
1754
1755
1756
1757
1758
1759
1760
1761
1762
1763
1764
1765
1766
1767
1768
1769
1770
1771
1772
1773
1774
1775
1776
1777
1778
1779
1780
1781
1782
1783
1784
1785
1786
1787
1788
1789
1790
1791
1792
1793
1794
1795
1796
1797
1798
1799
1800
1801
1802
1803
1804
1805
1806
1807
1808
1809
1810
1811
1812
1813
1814
1815
1816
1817
1818
1819
1820
1821
1822
1823
1824
1825
1826
1827
1828
1829
1830
1831
1832
1833
1834
1835
1836
1837
1838
1839
1840
1841
1842
1843
1844
1845
1846
1847
1848
1849
1850
1851
1852
1853
1854
1855
1856
1857
1858
1859
1860
1861
1862
1863
1864
1865
1866
1867
1868
1869
1870
1871
1872
1873
1874
1875
1876
1877
1878
1879
1880
1881
1882
1883
1884
1885
1886
1887
1888
1889
1890
1891
1892
1893
1894
1895
1896
1897
1898
1899
1900
1901
1902
1903
1904
1905
1906
1907
1908
1909
1910
1911
1912
1913
1914
1915
1916
1917
1918
1919
1920
1921
1922
1923
1924
1925
1926
1927
1928
1929
1930
1931
1932
1933
1934
1935
1936
1937
1938
1939
1940
1941
1942
1943
1944
1945
1946
1947
1948
1949
1950
1951
1952
1953
1954
1955
1956
1957
1958
1959
1960
1961
1962
1963
1964
1965
1966
1967
1968
1969
1970
1971
1972
1973
1974
1975
1976
1977
1978
1979
1980
1981
1982
1983
1984
1985
1986
1987
1988
1989
1990
1991
1992
1993
1994
1995
1996
1997
1998
1999
2000
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
2014
2015
2016
2017
2018
2019
2020
2021
2022
2023
2024
2025
2026
2027
2028
2029
2030
2031
2032
2033
2034
2035
2036
2037
2038
2039
2040
2041
2042
2043
2044
2045
2046
2047
2048
2049
2050
2051
2052
2053
2054
2055
2056
2057
2058
2059
2060
2061
2062
2063
2064
2065
2066
2067
2068
2069
2070
2071
2072
2073
2074
2075
2076
2077
2078
2079
2080
2081
2082
2083
2084
2085
2086
2087
2088
2089
2090
2091
2092
2093
2094
2095
2096
2097
2098
2099
2100
2101
2102
2103
2104
2105
2106
2107
2108
2109
2110
2111
2112
2113
2114
2115
2116
2117
2118
2119
2120
2121
2122
2123
2124
2125
2126
2127
2128
2129
2130
2131
2132
2133
2134
2135
2136
2137
2138
2139
2140
2141
2142
2143
2144
2145
2146
2147
2148
2149
2150
2151
2152
2153
2154
2155
2156
2157
2158
2159
2160
2161
2162
2163
2164
2165
2166
2167
2168
2169
2170
2171
2172
2173
2174
2175
2176
2177
2178
2179
2180
2181
2182
2183
2184
2185
2186
2187
2188
2189
2190
2191
2192
2193
2194
2195
2196
2197
2198
2199
2200
2201
2202
2203
2204
2205
2206
2207
2208
2209
2210
2211
2212
2213
2214
2215
2216
2217
2218
2219
2220
2221
2222
2223
2224
2225
2226
2227
2228
2229
2230
2231
2232
2233
2234
2235
2236
2237
2238
2239
2240
2241
2242
2243
2244
2245
2246
2247
2248
2249
2250
2251
2252
2253
2254
2255
2256
2257
2258
2259
2260
2261
2262
2263
2264
2265
2266
2267
2268
2269
2270
2271
2272
2273
2274
2275
2276
2277
2278
2279
2280
2281
2282
2283
2284
2285
2286
2287
2288
2289
2290
2291
2292
2293
2294
2295
2296
2297
2298
2299
2300
2301
2302
2303
2304
2305
2306
2307
2308
2309
2310
2311
2312
2313
2314
2315
2316
2317
2318
2319
2320
2321
2322
2323
2324
2325
2326
2327
2328
2329
2330
2331
2332
2333
2334
2335
2336
2337
2338
2339
2340
2341
2342
2343
2344
2345
2346
2347
2348
2349
2350
2351
2352
2353
2354
2355
2356
2357
2358
2359
2360
2361
2362
2363
2364
2365
2366
2367
2368
2369
2370
2371
2372
2373
2374
2375
2376
2377
2378
2379
2380
2381
2382
2383
2384
2385
2386
2387
2388
2389
2390
2391
2392
2393
2394
2395
2396
2397
2398
2399
2400
2401
2402
2403
2404
2405
2406
2407
2408
2409
2410
2411
2412
2413
2414
2415
2416
2417
2418
2419
2420
2421
2422
2423
2424
2425
2426
2427
2428
2429
2430
2431
2432
2433
2434
2435
2436
2437
2438
2439
2440
2441
2442
2443
2444
2445
2446
2447
2448
2449
2450
2451
2452
2453
2454
2455
2456
2457
2458
2459
2460
2461
2462
2463
2464
2465
2466
2467
2468
2469
2470
2471
2472
2473
2474
2475
2476
2477
2478
2479
2480
2481
2482
2483
2484
2485
2486
2487
2488
2489
2490
2491
2492
2493
2494
2495
2496
2497
2498
2499
2500
2501
2502
2503
2504
2505
2506
2507
2508
2509
2510
2511
2512
2513
2514
2515
2516
2517
2518
2519
2520
2521
2522
2523
2524
2525
2526
2527
2528
2529
2530
2531
2532
2533
2534
2535
2536
2537
2538
2539
2540
2541
2542
2543
2544
2545
2546
2547
2548
2549
2550
2551
2552
2553
2554
2555
2556
2557
2558
2559
2560
2561
2562
2563
2564
2565
2566
2567
2568
2569
2570
2571
2572
2573
2574
2575
2576
2577
2578
2579
2580
2581
2582
2583
2584
2585
2586
2587
2588
2589
2590
2591
2592
2593
2594
2595
2596
2597
2598
2599
2600
2601
2602
2603
2604
2605
2606
2607
2608
2609
2610
2611
2612
2613
2614
2615
2616
2617
2618
2619
2620
2621
2622
2623
2624
2625
2626
2627
2628
2629
2630
2631
2632
2633
2634
2635
2636
2637
2638
2639
2640
2641
2642
2643
2644
2645
2646
2647
2648
2649
2650
2651
2652
2653
2654
2655
2656
2657
2658
2659
2660
2661
2662
2663
2664
2665
2666
2667
2668
2669
2670
2671
2672
2673
2674
2675
2676
2677
2678
2679
2680
2681
2682
2683
2684
2685
2686
2687
2688
2689
2690
2691
2692
2693
2694
2695
2696
2697
2698
2699
2700
2701
2702
2703
2704
2705
2706
2707
2708
2709
2710
2711
2712
2713
2714
2715
2716
2717
2718
2719
2720
2721
2722
2723
2724
2725
2726
2727
2728
2729
2730
2731
2732
2733
2734
2735
2736
2737
2738
2739
2740
2741
2742
2743
2744
2745
2746
2747
2748
2749
2750
2751
2752
2753
2754
2755
2756
2757
2758
2759
2760
2761
2762
2763
2764
2765
2766
2767
2768
2769
2770
2771
2772
2773
2774
2775
2776
2777
2778
2779
2780
2781
2782
2783
2784
2785
2786
2787
2788
2789
2790
2791
2792
2793
2794
2795
2796
2797
2798
2799
2800
2801
2802
2803
2804
2805
2806
2807
2808
2809
2810
2811
2812
2813
2814
2815
2816
2817
2818
2819
2820
2821
2822
2823
2824
2825
2826
2827
2828
2829
2830
2831
2832
2833
2834
2835
2836
2837
2838
2839
2840
2841
2842
2843
2844
2845
2846
2847
2848
2849
2850
2851
2852
2853
2854
2855
2856
2857
2858
2859
2860
2861
2862
2863
2864
2865
2866
2867
2868
2869
2870
2871
2872
2873
2874
2875
2876
2877
2878
2879
2880
2881
2882
2883
2884
2885
2886
2887
2888
2889
2890
2891
2892
2893
2894
2895
2896
2897
2898
2899
2900
2901
2902
2903
2904
2905
2906
2907
2908
2909
2910
2911
2912
2913
2914
2915
2916
2917
2918
2919
2920
2921
2922
2923
2924
2925
2926
2927
2928
2929
2930
2931
2932
2933
2934
2935
2936
2937
2938
2939
2940
2941
2942
2943
2944
2945
2946
2947
2948
2949
2950
2951
2952
2953
2954
2955
2956
2957
2958
2959
2960
2961
2962
2963
2964
2965
2966
2967
2968
2969
2970
2971
2972
2973
2974
2975
2976
2977
2978
2979
2980
2981
2982
2983
2984
2985
2986
2987
2988
2989
2990
2991
2992
2993
2994
2995
2996
2997
2998
2999
3000
3001
3002
3003
3004
3005
3006
3007
3008
3009
3010
3011
3012
3013
3014
3015
3016
3017
3018
3019
3020
3021
3022
3023
3024
3025
3026
3027
3028
3029
3030
3031
3032
3033
3034
3035
3036
3037
3038
3039
3040
3041
3042
3043
3044
3045
3046
3047
3048
3049
3050
3051
3052
3053
3054
3055
3056
3057
3058
3059
3060
3061
3062
3063
3064
3065
3066
3067
3068
3069
3070
3071
3072
3073
3074
3075
3076
3077
3078
3079
3080
3081
3082
3083
3084
3085
3086
3087
3088
3089
3090
3091
3092
3093
3094
3095
3096
3097
3098
3099
3100
3101
3102
3103
3104
3105
3106
3107
3108
3109
3110
3111
3112
3113
3114
3115
3116
3117
3118
3119
3120
3121
3122
3123
3124
3125
3126
3127
3128
3129
3130
3131
3132
3133
3134
3135
3136
3137
3138
3139
3140
3141
3142
3143
3144
3145
3146
3147
3148
3149
3150
3151
3152
3153
3154
3155
3156
3157
3158
3159
3160
3161
3162
3163
3164
3165
3166
3167
3168
3169
3170
3171
3172
3173
3174
3175
3176
3177
3178
3179
3180
3181
3182
3183
3184
3185
3186
3187
/*
 * Copyright 2011, Ben Langmead <langmea@cs.jhu.edu>
 *
 * This file is part of Bowtie 2.
 *
 * Bowtie 2 is free software: you can redistribute it and/or modify
 * it under the terms of the GNU General Public License as published by
 * the Free Software Foundation, either version 3 of the License, or
 * (at your option) any later version.
 *
 * Bowtie 2 is distributed in the hope that it will be useful,
 * but WITHOUT ANY WARRANTY; without even the implied warranty of
 * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
 * GNU General Public License for more details.
 *
 * You should have received a copy of the GNU General Public License
 * along with Bowtie 2.  If not, see <http://www.gnu.org/licenses/>.
 */

#include <limits>
#include <ctype.h>
#include "aligner_seed2.h"
#include "assert_helpers.h"
#include "bt2_idx.h"

/**
 * Drive the process of descending from all search roots.
 */
void DescentDriver::go(
    const Scoring& sc,    // scoring scheme
    const Ebwt& ebwtFw,   // forward index
    const Ebwt& ebwtBw,   // mirror index
    DescentMetrics& met,  // metrics
	PerReadMetrics& prm)  // per-read metrics
{
	assert(q_.repOk());
    // Convert DescentRoots to the initial Descents
    for(size_t i = 0; i < roots_.size(); i++) {
        size_t dfsz = df_.size();
        size_t pfsz = pf_.size();
        TDescentId id = df_.alloc();
        Edit e_null;
        assert(!e_null.inited());
        bool succ = df_[id].init(
            q_,        // read
            i,         // root and conf id
            sc,        // scoring scheme
			minsc_,    // minimum score
			maxpen_,   // maximum penalty
            id,        // new Descent's id
            ebwtFw,    // forward index
            ebwtBw,    // mirror index
			re_,       // redundancy checker
            df_,       // Descent factory
            pf_,       // DescentPos factory
            roots_,    // DescentRoots
            confs_,    // DescentConfs
            heap_,     // heap
            alsink_,   // alignment sink
            met,       // metrics
			prm);      // per-read metrics
		if(veryVerbose_) {
			bool fw = roots_[i].fw;
			tmpedit_.clear();
			df_[id].print(
				&cerr,
				"",
				q_,
				0,
				0,
				fw,
				tmpedit_,
				0,
				tmpedit_.size(),
				tmprfdnastr_);
		}
        if(!succ) {
            // Reclaim memory we had used for this descent and its DescentPos info
            df_.resize(dfsz);
            pf_.resize(pfsz);
        }
    }
    // Advance until some stopping condition
    bool stop = heap_.empty();
    while(!stop) {
		// Pop off the highest-priority descent.  Note that some outgoing edges
		// might have since been explored, which could reduce the priority of
		// the descent once we .
        TDescentPair p = heap_.pop();
		df_.alloc(); df_.pop();
        df_[p.second].followBestOutgoing(
            q_,        // read
            ebwtFw,    // index over text
            ebwtBw,    // index over reverse text
            sc,        // scoring scheme
			minsc_,    // minimum score
			maxpen_,   // maximum penalty
			re_,       // redundancy checker
            df_,       // Descent factory
            pf_,       // DescentPos factory
            roots_,    //
            confs_,    //
            heap_,     // priority queue for Descents
            alsink_,   // alignment sink
            met,       // metrics
			prm);      // per-read metrics
        stop = heap_.empty();
    }
}

/**
 * Perform seed alignment until some stopping condition is satisfied.
 */
int DescentDriver::advance(
	const DescentStoppingConditions& stopc, // stopping conditions
    const Scoring& sc,    // scoring scheme
    const Ebwt& ebwtFw,   // forward index
    const Ebwt& ebwtBw,   // mirror index
    DescentMetrics& met,  // metrics
	PerReadMetrics& prm)  // per-read metrics
{
	size_t nbwop_i = met.bwops;
	while(rootsInited_ < roots_.size()) {
		size_t dfsz = df_.size();
		size_t pfsz = pf_.size();
		TDescentId id = df_.alloc();
		Edit e_null;
		assert(!e_null.inited());
        bool succ = df_[id].init(
            q_,        // query
            rootsInited_, // root and conf id
            sc,        // scoring scheme
			minsc_,    // minimum score
			maxpen_,   // maximum penalty
            id,        // new Descent's id
            ebwtFw,    // forward index
            ebwtBw,    // mirror index
			re_,       // redundancy checker
            df_,       // Descent factory
            pf_,       // DescentPos factory
            roots_,    // DescentRoots
            confs_,    // DescentConfs
            heap_,     // heap
            alsink_,   // alignment sink
            met,       // metrics
			prm);      // per-read metrics
        if(!succ) {
            // Reclaim memory we had used for this descent and its DescentPos info
            df_.resize(dfsz);
            pf_.resize(pfsz);
        }
		rootsInited_++;
		TAlScore best = std::numeric_limits<TAlScore>::max();
		if(!heap_.empty()) {
			best = heap_.top().first.pen;
		}
		if(stopc.nfound > 0 && alsink_.nelt() > stopc.nfound) {
			return DESCENT_DRIVER_ALN;
		}
		if(alsink_.stratumDone(best)) {
			return DESCENT_DRIVER_STRATA;
		}
		if(stopc.nbwop > 0 && (met.bwops - nbwop_i) > stopc.nbwop) {
			return DESCENT_DRIVER_BWOPS;
		}
		if(stopc.totsz > 0 && totalSizeBytes() > stopc.totsz) {
			return DESCENT_DRIVER_MEM;
		}
    }
    // Advance until some stopping condition
    bool stop = heap_.empty();
    while(!stop) {
		// Pop off the highest-priority descent.
        TDescentPair p = heap_.pop();
		df_.alloc(); df_.pop(); // Create new descent
        df_[p.second].followBestOutgoing(
            q_,        // read
            ebwtFw,    // forward index
            ebwtBw,    // backward index
            sc,        // scoring scheme
			minsc_,    // minimum score
			maxpen_,   // maximum penalty
			re_,       // redundancy checker
            df_,       // Descent factory
            pf_,       // DescentPos factory
            roots_,    // search roots
            confs_,    // search root configurations
            heap_,     // descent heap
            alsink_,   // alignment sink
            met,       // metrics
			prm);      // per-read metrics
		TAlScore best = std::numeric_limits<TAlScore>::max();
		if(!heap_.empty()) {
			best = heap_.top().first.pen;
		}
		if(stopc.nfound > 0 && alsink_.nelt() > stopc.nfound) {
			return DESCENT_DRIVER_ALN;
		}
		if(alsink_.stratumDone(best)) {
			return DESCENT_DRIVER_STRATA;
		}
		if(stopc.nbwop > 0 && (met.bwops - nbwop_i) > stopc.nbwop) {
			return DESCENT_DRIVER_BWOPS;
		}
		if(stopc.totsz > 0 && totalSizeBytes() > stopc.totsz) {
			return DESCENT_DRIVER_MEM;
		}
        stop = heap_.empty();
    }
	return DESCENT_DRIVER_DONE;
}

/**
 * If this is the final descent in a complete end-to-end alignment, report
 * the alignment.
 */
bool DescentAlignmentSink::reportAlignment(
	const Read& q,                  // query string
	const Ebwt& ebwtFw,             // forward index
	const Ebwt& ebwtBw,             // mirror index
	TIndexOffU topf,                 // SA range top in forward index
	TIndexOffU botf,                 // SA range bottom in forward index
	TIndexOffU topb,                 // SA range top in backward index
	TIndexOffU botb,                 // SA range bottom in backward index
	TDescentId id,                  // id of leaf Descent
	TRootId rid,                    // id of search root
	const Edit& e,                  // final edit, if needed
	TScore pen,                     // total penalty
	EFactory<Descent>& df,          // factory with Descent
	EFactory<DescentPos>& pf,       // factory with DescentPoss
	const EList<DescentRoot>& rs,   // roots
	const EList<DescentConfig>& cs) // configs
{
	TDescentId cur = id;
	ASSERT_ONLY(const Descent& desc = df[id]);
	const bool fw = rs[rid].fw;
	ASSERT_ONLY(size_t len = q.length());
	assert(q.repOk());
	assert_lt(desc.al5pf(), len);
	// Adjust al5pi and al5pf to take the final edit into account (if
	// there is one)
	// Check if this is redundant with a previous reported alignment
	Triple<TIndexOffU, TIndexOffU, size_t> lhs(topf, botf, 0);
	Triple<TIndexOffU, TIndexOffU, size_t> rhs(topb, botb, q.length()-1);
	if(!lhs_.insert(lhs)) {
		rhs_.insert(rhs);
		return false; // Already there
	}
	if(!rhs_.insert(rhs)) {
		return false; // Already there
	}
	size_t ei = edits_.size();
	df[cur].collectEdits(edits_, &e, df);
	size_t en = edits_.size() - ei;
#ifndef NDEBUG
	{
		for(size_t i = 1; i < en; i++) {
			assert_geq(edits_[ei+i].pos, edits_[ei+i-1].pos);
		}
		// Now figure out how much we refrained from aligning on either
		// side.
		size_t trimLf = 0;
		size_t trimRg = 0;
		BTDnaString& rf = tmprfdnastr_;
		rf.clear();
		if(!fw) {
			// Edit offsets are w/r/t 5' end, but desc.print wants them w/r/t
			// the *left* end of the read sequence that aligned
			Edit::invertPoss(edits_, len, ei, en, true);
		}
		desc.print(NULL, "", q, trimLf, trimRg, fw, edits_, ei, en, rf);
		if(!fw) {
			// Invert them back to how they were before
			Edit::invertPoss(edits_, len, ei, en, true);
		}
		ASSERT_ONLY(TIndexOffU toptmp = 0);
		ASSERT_ONLY(TIndexOffU bottmp = 0);
		// Check that the edited string occurs in the reference
		if(!ebwtFw.contains(rf, &toptmp, &bottmp)) {
			std::cerr << rf << std::endl;
			assert(false);
		}
	}
#endif
	als_.expand();
	als_.back().init(pen, fw, topf, botf, ei, en);
	nelt_ += (botf - topf);
	if(bestPen_ == std::numeric_limits<TAlScore>::max() || pen < bestPen_) {
		bestPen_ = pen;
	}
	if(worstPen_ == std::numeric_limits<TAlScore>::max() || pen > worstPen_) {
		worstPen_ = pen;
	}
	return true;
}

/**
 * Initialize a new descent branching from the given descent via the given
 * edit.  Return false if the Descent has no outgoing edges (and can
 * therefore have its memory freed), true otherwise.
 */
bool Descent::init(
    const Read& q,                  // query
    TRootId rid,                    // root id
    const Scoring& sc,              // scoring scheme
	TAlScore minsc,                 // minimum score
	TAlScore maxpen,                // maximum penalty
    TReadOff al5pi,                 // offset from 5' of 1st aligned char
    TReadOff al5pf,                 // offset from 5' of last aligned char
    TIndexOffU topf,                 // SA range top in FW index
    TIndexOffU botf,                 // SA range bottom in FW index
    TIndexOffU topb,                 // SA range top in BW index
    TIndexOffU botb,                 // SA range bottom in BW index
    bool l2r,                       // direction this descent will go in
    size_t descid,                  // my ID
    TDescentId parent,              // parent ID
    TScore pen,                     // total penalties so far
    const Edit& e,                  // edit for incoming edge
    const Ebwt& ebwtFw,             // forward index
    const Ebwt& ebwtBw,             // mirror index
	DescentRedundancyChecker& re,   // redundancy checker
    EFactory<Descent>& df,          // Descent factory
    EFactory<DescentPos>& pf,       // DescentPos factory
    const EList<DescentRoot>& rs,   // roots
    const EList<DescentConfig>& cs, // configs
    EHeap<TDescentPair>& heap,      // heap
    DescentAlignmentSink& alsink,   // alignment sink
    DescentMetrics& met,            // metrics
	PerReadMetrics& prm)            // per-read metrics
{
	assert(q.repOk());
    rid_ = rid;
    al5pi_ = al5pi;
    al5pf_ = al5pf;
    l2r_ = l2r;
    topf_ = topf;
    botf_ = botf;
    topb_ = topb;
    botb_ = botb;
    descid_ = descid;
    parent_ = parent;
    pen_ = pen;
    posid_ = std::numeric_limits<size_t>::max();
    len_ = 0;
    out_.clear();
    edit_ = e;
    lastRecalc_ = true;
	gapadd_ = df[parent].gapadd_;
	if(e.inited()) {
		if(e.isReadGap()) {
			gapadd_++;
		} else if(e.isRefGap()) {
			gapadd_--;
		}
	}
    bool branches = false, hitEnd = false, done = false;
    TIndexOffU topf_new = 0, botf_new = 0, topb_new = 0, botb_new = 0;
    off5p_i_ = 0;
#ifndef NDEBUG
    size_t depth = al5pf_ - al5pi_ + 1;
    TAlScore maxpend = cs[rid_].cons.get(depth, q.length(), maxpen);
    assert_geq(maxpend, pen_);    // can't have already exceeded max penalty
#endif
    bool matchSucc = followMatches(
        q,
		sc,
        ebwtFw,
        ebwtBw,
		re,
        df,
        pf,
        rs,
        cs,
        heap,
        alsink,
        met,
		prm,
        branches,
        hitEnd,
        done,
        off5p_i_,
        topf_new,
        botf_new,
        topb_new,
        botb_new);
    bool bounceSucc = false;
    if(matchSucc && hitEnd && !done) {
		assert(topf_new > 0 || botf_new > 0);
        bounceSucc = bounce(
            q,
            topf_new,
            botf_new,
            topb_new,
            botb_new,
            ebwtFw,
            ebwtBw,
            sc,
			minsc,    // minimum score
			maxpen,   // maximum penalty
			re,
            df,
            pf,
            rs,
            cs,
            heap,
            alsink,
            met,      // descent metrics
			prm);     // per-read metrics
    }
	if(matchSucc) {
		// Calculate info about outgoing edges
		recalcOutgoing(q, sc, minsc, maxpen, re, pf, rs, cs, prm);
		if(!empty()) {
			heap.insert(make_pair(out_.bestPri(), descid)); // Add to heap
		}
	}
    return !empty() || bounceSucc;
}

/**
 * Initialize a new descent beginning at the given root.  Return false if
 * the Descent has no outgoing edges (and can therefore have its memory
 * freed), true otherwise.
 */
bool Descent::init(
    const Read& q,                  // query
    TRootId rid,                    // root id
    const Scoring& sc,              // scoring scheme
	TAlScore minsc,                 // minimum score
	TAlScore maxpen,                // maximum penalty
    size_t descid,                  // id of this Descent
    const Ebwt& ebwtFw,             // forward index
    const Ebwt& ebwtBw,             // mirror index
	DescentRedundancyChecker& re,   // redundancy checker
    EFactory<Descent>& df,          // Descent factory
    EFactory<DescentPos>& pf,       // DescentPos factory
    const EList<DescentRoot>& rs,   // roots
    const EList<DescentConfig>& cs, // configs
    EHeap<TDescentPair>& heap,      // heap
    DescentAlignmentSink& alsink,   // alignment sink
    DescentMetrics& met,            // metrics
	PerReadMetrics& prm)            // per-read metrics
{
    rid_ = rid;
    al5pi_ = rs[rid].off5p;
    al5pf_ = rs[rid].off5p;
	assert_lt(al5pi_, q.length());
	assert_lt(al5pf_, q.length());
    l2r_ = rs[rid].l2r;
    topf_ = botf_ = topb_ = botb_ = 0;
    descid_ = descid;
    parent_ = std::numeric_limits<size_t>::max();
    pen_ = 0;
    posid_ = std::numeric_limits<size_t>::max();
    len_ = 0;
    out_.clear();
    edit_.reset();
    lastRecalc_ = true;
	gapadd_ = 0;
    bool branches = false, hitEnd = false, done = false;
    TIndexOffU topf_new = 0, botf_new = 0, topb_new = 0, botb_new = 0;
    off5p_i_ = 0;
    bool matchSucc = followMatches(
        q,
		sc,
        ebwtFw,
        ebwtBw,
		re,
        df,
        pf,
        rs,
        cs,
        heap,
        alsink,
        met,
		prm,
        branches,
        hitEnd,
        done,
        off5p_i_,
        topf_new,
        botf_new,
        topb_new,
        botb_new);
    bool bounceSucc = false;
    if(matchSucc && hitEnd && !done) {
		assert(topf_new > 0 || botf_new > 0);
        bounceSucc = bounce(
            q,
            topf_new,
            botf_new,
            topb_new,
            botb_new,
            ebwtFw,
            ebwtBw,
            sc,
			minsc,    // minimum score
			maxpen,   // maximum penalty
			re,
            df,
            pf,
            rs,
            cs,
            heap,
            alsink,
            met,      // descent metrics
			prm);     // per-read metrics
    }
    // Calculate info about outgoing edges
    assert(empty());
	if(matchSucc) {
		recalcOutgoing(q, sc, minsc, maxpen, re, pf, rs, cs, prm);
		if(!empty()) {
			heap.insert(make_pair(out_.bestPri(), descid)); // Add to heap
		}
	}
    return !empty() || bounceSucc;
}

/**
 * Recalculate our summary of the outgoing edges from this descent.  When
 * deciding what outgoing edges are legal, we abide by constraints.
 * Typically, they limit the total of the penalties accumulated so far, as
 * a function of distance from the search root.  E.g. a constraint might
 * disallow any gaps or mismatches within 20 ply of the search root, then
 * allow 1 mismatch within 30 ply, then allow up to 1 mismatch or 1 gap
 * within 40 ply, etc.
 *
 * Return the total number of valid outgoing edges found.
 *
 * TODO: Eliminate outgoing gap edges that are redundant with others owing to
 *       the DNA sequence and the fact that we don't care to distinguish among
 *       "equivalent" homopolymer extensinos and retractions.
 */
size_t Descent::recalcOutgoing(
    const Read& q,                   // query string
    const Scoring& sc,               // scoring scheme
	TAlScore minsc,                  // minimum score
	TAlScore maxpen,                 // maximum penalty
	DescentRedundancyChecker& re,    // redundancy checker
    EFactory<DescentPos>& pf,        // factory with DescentPoss
    const EList<DescentRoot>& rs,    // roots
    const EList<DescentConfig>& cs,  // configs
	PerReadMetrics& prm)             // per-read metrics
{
    assert_eq(botf_ - topf_, botb_ - topb_);
	assert(out_.empty());
	assert(repOk(&q));
	// Get initial 5' and 3' offsets
    bool fw = rs[rid_].fw;
    float rootpri = rs[rid_].pri;
	bool toward3p = (l2r_ == fw);
	size_t off5p = off5p_i_;
	assert_geq(al5pf_, al5pi_);
	size_t off3p = q.length() - off5p - 1;
	// By "depth" we essentially mean the number of characters already aligned
	size_t depth, extrai = 0, extraf = 0;
	size_t cur5pi = al5pi_, cur5pf = al5pf_;
    if(toward3p) {
		// Toward 3'
		cur5pf = off5p;
        depth = off5p - al5pi_;
		// Failed to match out to the end?
		if(al5pf_ < q.length() - 1) {
			extraf = 1; // extra 
		}
    } else {
		// Toward 5'
		cur5pi = off5p;
        depth = al5pf_ - off5p;
		if(al5pi_ > 0) {
			extrai = 1;
		}
    }
	// Get gap penalties
	TScore pen_rdg_ex = sc.readGapExtend(), pen_rfg_ex = sc.refGapExtend();
	TScore pen_rdg_op = sc.readGapOpen(),   pen_rfg_op = sc.refGapOpen();
	// Top and bot in the direction of the descent
	TIndexOffU top  = l2r_ ? topb_ : topf_;
	TIndexOffU bot  = l2r_ ? botb_ : botf_;
	// Top and bot in the opposite direction
	TIndexOffU topp = l2r_ ? topf_ : topb_;
	TIndexOffU botp = l2r_ ? botf_ : botb_;
	assert_eq(botp - topp, bot - top);
	DescentEdge edge;
	size_t nout = 0;
	// Enumerate all outgoing edges, starting at the root and going out
    size_t d = posid_;
	// At first glance, we might think we should be bounded by al5pi_ and
	// al5pf_, but those delimit the positions that matched between reference
	// and read.  If we hit a position that failed to match as part of
	// followMatches, then we also want to evaluate ways of leaving that
	// position, which adds one more position to viist.
	while(off5p >= al5pi_ - extrai && off5p <= al5pf_ + extraf) {
        assert_lt(off5p, q.length());
        assert_lt(off3p, q.length());
		TScore maxpend = cs[rid_].cons.get(depth, q.length(), maxpen);
		assert(depth > 0 || maxpend == 0);
		assert_geq(maxpend, pen_);    // can't have already exceeded max penalty
		TScore diff = maxpend - pen_; // room we have left
		// Get pointer to SA ranges in the direction of descent
		const TIndexOffU *t  = l2r_ ? pf[d].topb : pf[d].topf;
		const TIndexOffU *b  = l2r_ ? pf[d].botb : pf[d].botf;
		const TIndexOffU *tp = l2r_ ? pf[d].topf : pf[d].topb;
		const TIndexOffU *bp = l2r_ ? pf[d].botf : pf[d].botb;
		assert_eq(pf[d].botf - pf[d].topf, pf[d].botb - pf[d].topb);
		// What are the read char / quality?
		std::pair<int, int> p = q.get(off5p, fw);
		int c = p.first;
		assert_range(0, 4, c);
		// Only entertain edits if there is at least one type of edit left and
		// there is some penalty budget left
		if(!pf[d].flags.exhausted() && diff > 0) {
			// What would the penalty be if we mismatched at this position?
			// This includes the case where the mismatch is for an N in the
			// read.
			int qq = p.second;
            assert_geq(qq, 0);
			TScore pen_mm = sc.mm(c, qq);
			if(pen_mm <= diff) {
				for(int j = 0; j < 4; j++) {
					if(j == c) continue; // Match, not mismatch
					if(b[j] <= t[j]) {
						continue; // No outgoing edge with this nucleotide
					}
					if(!pf[d].flags.mmExplore(j)) {
						continue; // Already been explored
					}
					TIndexOffU topf = pf[d].topf[j], botf = pf[d].botf[j];
					ASSERT_ONLY(TIndexOffU topb = pf[d].topb[j], botb = pf[d].botb[j]);
					if(re.contains(fw, l2r_, cur5pi, cur5pf, cur5pf - cur5pi + 1 + gapadd_, topf, botf, pen_ + pen_mm)) {
						prm.nRedSkip++;
						continue; // Redundant with a path already explored
					}
					prm.nRedFail++;
					TIndexOffU width = b[j] - t[j];
					Edit edit((uint32_t)off5p, (int)("ACGTN"[j]), (int)("ACGTN"[c]), EDIT_TYPE_MM);
					DescentPriority pri(pen_ + pen_mm, depth, width, rootpri);
                    assert(topf != 0 || botf != 0);
                    assert(topb != 0 || botb != 0);
					assert_eq(botb - topb, botf - topf);
					edge.init(edit, off5p, pri, d
#ifndef NDEBUG
                    , d, topf, botf, topb, botb
#endif
                    );
					out_.update(edge);
					nout++;
				}
			}
			bool gapsAllowed = (off5p >= (size_t)sc.gapbar && off3p >= (size_t)sc.gapbar);
			if(gapsAllowed) {
				assert_gt(depth, 0);
				// An easy redundancy check is: if all ways of proceeding are
				// matches, then there's no need to entertain gaps here.
				// Shifting the gap one position further downstream is
				// guarnteed not to be worse.
				size_t totwidth = (b[0] - t[0]) +
				                  (b[1] - t[1]) +
								  (b[2] - t[2]) +
								  (b[3] - t[3]);
				assert(c > 3 || b[c] - t[c] <= totwidth);
				bool allmatch = c < 4 && (totwidth == (b[c] - t[c]));
				bool rdex = false, rfex = false;
				size_t cur5pi_i = cur5pi, cur5pf_i = cur5pf;
				if(toward3p) {
					cur5pf_i--;
				} else {
					cur5pi_i++;
				}
				if(off5p == off5p_i_ && edit_.inited()) {
					// If we're at the root of the descent, and the descent
					// branched on a gap, then this could be scored as an
					// extension of that gap.
					if(pen_rdg_ex <= diff && edit_.isReadGap()) {
						// Extension of a read gap
						rdex = true;
						for(int j = 0; j < 4; j++) {
							if(b[j] <= t[j]) {
								continue; // No outgoing edge with this nucleotide
							}
							if(!pf[d].flags.rdgExplore(j)) {
								continue; // Already been explored
							}
							TIndexOffU topf = pf[d].topf[j], botf = pf[d].botf[j];
							ASSERT_ONLY(TIndexOffU topb = pf[d].topb[j], botb = pf[d].botb[j]);
							assert(topf != 0 || botf != 0);
							assert(topb != 0 || botb != 0);
							if(re.contains(fw, l2r_, cur5pi_i, cur5pf_i, cur5pf - cur5pi + 1 + gapadd_, topf, botf, pen_ + pen_rdg_ex)) {
								prm.nRedSkip++;
								continue; // Redundant with a path already explored
							}
							prm.nRedFail++;
							TIndexOffU width = b[j] - t[j];
							// off5p holds the offset from the 5' of the next
							// character we were trying to align when we decided to
							// introduce a read gap (before that character).  If we
							// were walking toward the 5' end, we need to increment
							// by 1.
							uint32_t off = (uint32_t)off5p + (toward3p ? 0 : 1);
							Edit edit(off, (int)("ACGTN"[j]), '-', EDIT_TYPE_READ_GAP);
							assert(edit.pos2 != std::numeric_limits<uint32_t>::max());
							edit.pos2 = edit_.pos2 + (toward3p ? 1 : -1);
							DescentPriority pri(pen_ + pen_rdg_ex, depth, width, rootpri);
                            assert(topf != 0 || botf != 0);
                            assert(topb != 0 || botb != 0);
							assert_eq(botb - topb, botf - topf);
							edge.init(edit, off5p, pri, d
#ifndef NDEBUG
                            , d,
                            topf, botf, topb, botb
#endif
                            );
							out_.update(edge);
							nout++;
						}
					}
					if(pen_rfg_ex <= diff && edit_.isRefGap()) {
						// Extension of a reference gap
						rfex = true;
						if(pf[d].flags.rfgExplore()) {
                            TIndexOffU topf = l2r_ ? topp : top;
                            TIndexOffU botf = l2r_ ? botp : bot;
							ASSERT_ONLY(TIndexOffU topb = l2r_ ? top : topp);
							ASSERT_ONLY(TIndexOffU botb = l2r_ ? bot : botp);
							assert(topf != 0 || botf != 0);
							assert(topb != 0 || botb != 0);
							size_t nrefal = cur5pf - cur5pi + gapadd_;
							if(!re.contains(fw, l2r_, cur5pi, cur5pf, nrefal, topf, botf, pen_ + pen_rfg_ex)) {
								TIndexOffU width = bot - top;
								Edit edit((uint32_t)off5p, '-', (int)("ACGTN"[c]), EDIT_TYPE_REF_GAP);
								DescentPriority pri(pen_ + pen_rfg_ex, depth, width, rootpri);
								assert(topf != 0 || botf != 0);
								assert(topb != 0 || botb != 0);
								edge.init(edit, off5p, pri, d
#ifndef NDEBUG
								// It's a little unclear what the depth ought to be.
								// Is it the depth we were at when we did the ref
								// gap?  I.e. the depth of the flags where rfgExplore()
								// returned true?  Or is it the depth where we can
								// retrieve the appropriate top/bot?  We make it the
								// latter, might wrap around, indicating we should get
								// top/bot from the descent's topf_, ... fields.
								, (d == posid_) ? std::numeric_limits<size_t>::max() : (d - 1),
								topf, botf, topb, botb
#endif
								);
								out_.update(edge);
								nout++;
								prm.nRedFail++;
							} else {
								prm.nRedSkip++;
							}
						}
					}
				}
				if(!allmatch && pen_rdg_op <= diff && !rdex) {
					// Opening a new read gap
					for(int j = 0; j < 4; j++) {
						if(b[j] <= t[j]) {
							continue; // No outgoing edge with this nucleotide
						}
						if(!pf[d].flags.rdgExplore(j)) {
							continue; // Already been explored
						}
						TIndexOffU topf = pf[d].topf[j], botf = pf[d].botf[j];
						ASSERT_ONLY(TIndexOffU topb = pf[d].topb[j], botb = pf[d].botb[j]);
						assert(topf != 0 || botf != 0);
						assert(topb != 0 || botb != 0);
						if(re.contains(fw, l2r_, cur5pi_i, cur5pf_i, cur5pf - cur5pi + 1 + gapadd_, topf, botf, pen_ + pen_rdg_op)) {
							prm.nRedSkip++;
							continue; // Redundant with a path already explored
						}
						prm.nRedFail++;
						TIndexOffU width = b[j] - t[j];
						// off5p holds the offset from the 5' of the next
						// character we were trying to align when we decided to
						// introduce a read gap (before that character).  If we
						// were walking toward the 5' end, we need to increment
						// by 1.
						uint32_t off = (uint32_t)off5p + (toward3p ? 0 : 1);
						Edit edit(off, (int)("ACGTN"[j]), '-', EDIT_TYPE_READ_GAP);
						assert(edit.pos2 != std::numeric_limits<uint32_t>::max());
						DescentPriority pri(pen_ + pen_rdg_op, depth, width, rootpri);
                        assert(topf != 0 || botf != 0);
                        assert(topb != 0 || botb != 0);
						assert_eq(botb - topb, botf - topf);
						edge.init(edit, off5p, pri, d
#ifndef NDEBUG
                        , d, topf, botf, topb, botb
#endif
                        );
						out_.update(edge);
						nout++;
					}
				}
				if(!allmatch && pen_rfg_op <= diff && !rfex) {
					// Opening a new reference gap
                    if(pf[d].flags.rfgExplore()) {
                        TIndexOffU topf = l2r_ ? topp : top;
                        TIndexOffU botf = l2r_ ? botp : bot;
						ASSERT_ONLY(TIndexOffU topb = l2r_ ? top : topp);
						ASSERT_ONLY(TIndexOffU botb = l2r_ ? bot : botp);
						assert(topf != 0 || botf != 0);
						assert(topb != 0 || botb != 0);
						size_t nrefal = cur5pf - cur5pi + gapadd_;
						if(!re.contains(fw, l2r_, cur5pi, cur5pf, nrefal, topf, botf, pen_ + pen_rfg_op)) {
							TIndexOffU width = bot - top;
							Edit edit((uint32_t)off5p, '-', (int)("ACGTN"[c]), EDIT_TYPE_REF_GAP);
							DescentPriority pri(pen_ + pen_rfg_op, depth, width, rootpri);
							assert(topf != 0 || botf != 0);
							assert(topb != 0 || botb != 0);
							edge.init(edit, off5p, pri, d
#ifndef NDEBUG
							// It's a little unclear what the depth ought to be.
							// Is it the depth we were at when we did the ref
							// gap?  I.e. the depth of the flags where rfgExplore()
							// returned true?  Or is it the depth where we can
							// retrieve the appropriate top/bot?  We make it the
							// latter, might wrap around, indicating we should get
							// top/bot from the descent's topf_, ... fields.
							, (d == posid_) ? std::numeric_limits<size_t>::max() : (d - 1),
							topf, botf, topb, botb
#endif
							);
							out_.update(edge);
							nout++;
							prm.nRedFail++;
						} else {
							prm.nRedSkip++;
						}
                    }
				}
			}
		}
		// Update off5p, off3p, depth
        d++;
		depth++;
        assert_leq(depth, al5pf_ - al5pi_ + 2);
        if(toward3p) {
            if(off3p == 0) {
                break;
            }
            off5p++;
            off3p--;
			cur5pf++;
        } else {
            if(off5p == 0) {
                break;
            }
            off3p++;
            off5p--;
			cur5pi--;
        }
		// Update top and bot
		if(off5p >= al5pi_ - extrai && off5p <= al5pf_ + extraf) {
			assert_range(0, 3, c);
			top = t[c], topp = tp[c];
			bot = b[c], botp = bp[c];
			assert_eq(bot-top, botp-topp);
		}
	}
	lastRecalc_ = (nout <= 5);
    out_.best1.updateFlags(pf);
    out_.best2.updateFlags(pf);
    out_.best3.updateFlags(pf);
    out_.best4.updateFlags(pf);
    out_.best5.updateFlags(pf);
	return nout;
}

void Descent::print(
	std::ostream *os,
	const char *prefix,
	const Read& q,
	size_t trimLf,
	size_t trimRg,
	bool fw,
	const EList<Edit>& edits,
	size_t ei,
	size_t en,
	BTDnaString& rf) const
{
	const BTDnaString& read = fw ? q.patFw : q.patRc;
	size_t eidx = ei;
	if(os != NULL) { *os << prefix; }
	// Print read
	for(size_t i = 0; i < read.length(); i++) {
		if(i < trimLf || i >= read.length() - trimRg) {
			if(os != NULL) { *os << (char)tolower(read.toChar(i)); }
			continue;
		}
		bool del = false, mm = false;
		while(eidx < ei + en && edits[eidx].pos == i) {
			if(edits[eidx].isReadGap()) {
				if(os != NULL) { *os << '-'; }
			} else if(edits[eidx].isRefGap()) {
				del = true;
				assert_eq((int)edits[eidx].qchr, read.toChar(i));
				if(os != NULL) { *os << read.toChar(i); }
			} else {
				mm = true;
				assert(edits[eidx].isMismatch());
				assert_eq((int)edits[eidx].qchr, read.toChar(i));
				if(os != NULL) { *os << (char)edits[eidx].qchr; }
			}
			eidx++;
		}
		if(!del && !mm) {
			// Print read character
			if(os != NULL) { *os << read.toChar(i); }
		}
	}
	if(os != NULL) {
		*os << endl;
		*os << prefix;
	}
	eidx = ei;
	// Print match bars
	for(size_t i = 0; i < read.length(); i++) {
		if(i < trimLf || i >= read.length() - trimRg) {
			if(os != NULL) { *os << ' '; }
			continue;
		}
		bool del = false, mm = false;
		while(eidx < ei + en && edits[eidx].pos == i) {
			if(edits[eidx].isReadGap()) {
				if(os != NULL) { *os << ' '; }
			} else if(edits[eidx].isRefGap()) {
				del = true;
				if(os != NULL) { *os << ' '; }
			} else {
				mm = true;
				assert(edits[eidx].isMismatch());
				if(os != NULL) { *os << ' '; }
			}
			eidx++;
		}
		if(!del && !mm && os != NULL) { *os << '|'; }
	}
	if(os != NULL) {
		*os << endl;
		*os << prefix;
	}
	eidx = ei;
	// Print reference
	for(size_t i = 0; i < read.length(); i++) {
		if(i < trimLf || i >= read.length() - trimRg) {
			if(os != NULL) { *os << ' '; }
			continue;
		}
		bool del = false, mm = false;
		while(eidx < ei + en && edits[eidx].pos == i) {
			if(edits[eidx].isReadGap()) {
				rf.appendChar((char)edits[eidx].chr);
				if(os != NULL) { *os << (char)edits[eidx].chr; }
			} else if(edits[eidx].isRefGap()) {
				del = true;
				if(os != NULL) { *os << '-'; }
			} else {
				mm = true;
				assert(edits[eidx].isMismatch());
				rf.appendChar((char)edits[eidx].chr);
				if(os != NULL) { *os << (char)edits[eidx].chr; }
			}
			eidx++;
		}
		if(!del && !mm) {
			rf.append(read[i]);
			if(os != NULL) { *os << read.toChar(i); }
		}
	}
	if(os != NULL) { *os << endl; }
}

/**
 * Create a new Descent 
 */
bool Descent::bounce(
	const Read& q,                  // query string
    TIndexOffU topf,                 // SA range top in fw index
    TIndexOffU botf,                 // SA range bottom in fw index
    TIndexOffU topb,                 // SA range top in bw index
    TIndexOffU botb,                 // SA range bottom in bw index
	const Ebwt& ebwtFw,             // forward index
	const Ebwt& ebwtBw,             // mirror index
	const Scoring& sc,              // scoring scheme
	TAlScore minsc,                 // minimum score
	TAlScore maxpen,                // maximum penalty
	DescentRedundancyChecker& re,   // redundancy checker
	EFactory<Descent>& df,          // factory with Descent
	EFactory<DescentPos>& pf,       // factory with DescentPoss
    const EList<DescentRoot>& rs,   // roots
    const EList<DescentConfig>& cs, // configs
	EHeap<TDescentPair>& heap,      // heap of descents
    DescentAlignmentSink& alsink,   // alignment sink
    DescentMetrics& met,            // metrics
	PerReadMetrics& prm)            // per-read metrics
{
    assert_gt(botf, topf);
    assert(al5pi_ == 0 || al5pf_ == q.length()-1);
    assert(!(al5pi_ == 0 && al5pf_ == q.length()-1));
    size_t dfsz = df.size();
    size_t pfsz = pf.size();
	TDescentId id = df.alloc();
    Edit e_null;
    assert(!e_null.inited());
	// Follow matches 
	bool succ = df[id].init(
		q,         // query
        rid_,      // root id
		sc,        // scoring scheme
		minsc,     // minimum score
		maxpen,    // maximum penalty
		al5pi_,    // new near-5' extreme
		al5pf_,    // new far-5' extreme
		topf,      // SA range top in FW index
		botf,      // SA range bottom in FW index
		topb,      // SA range top in BW index
		botb,      // SA range bottom in BW index
		!l2r_,     // direction this descent will go in; opposite from parent
		id,        // my ID
		descid_,   // parent ID
		pen_,      // total penalties so far - same as parent
		e_null,    // edit for incoming edge; uninitialized if bounced
		ebwtFw,    // forward index
		ebwtBw,    // mirror index
		re,        // redundancy checker
		df,        // Descent factory
		pf,        // DescentPos factory
        rs,        // DescentRoot list
        cs,        // DescentConfig list
		heap,      // heap
        alsink,    // alignment sink
		met,       // metrics
		prm);      // per-read metrics
    if(!succ) {
        // Reclaim memory we had used for this descent and its DescentPos info
        df.resize(dfsz);
        pf.resize(pfsz);
    }
    return succ;
}

/**
 * Take the best outgoing edge and place it in the heap.  When deciding what
 * outgoing edges exist, abide by constraints in DescentConfig.  These
 * constraints limit total penalty accumulated so far versus distance from
 * search root.  E.g. a constraint might disallow any gaps or mismatches within
 * 20 ply of the root, then allow 1 mismatch within 30 ply, 1 mismatch or 1 gap
 * within 40 ply, etc.
 */
void Descent::followBestOutgoing(
	const Read& q,                  // query string
	const Ebwt& ebwtFw,             // forward index
	const Ebwt& ebwtBw,             // mirror index
	const Scoring& sc,              // scoring scheme
	TAlScore minsc,                 // minimum score
	TAlScore maxpen,                // maximum penalty
	DescentRedundancyChecker& re,   // redundancy checker
	EFactory<Descent>& df,          // factory with Descent
	EFactory<DescentPos>& pf,       // factory with DescentPoss
    const EList<DescentRoot>& rs,   // roots
    const EList<DescentConfig>& cs, // configs
	EHeap<TDescentPair>& heap,      // heap of descents
    DescentAlignmentSink& alsink,   // alignment sink
	DescentMetrics& met,            // metrics
	PerReadMetrics& prm)            // per-read metrics
{
	// We assume this descent has been popped off the heap.  We'll re-add it if
	// it hasn't been exhausted.
	assert(q.repOk());
	assert(!empty());
	assert(!out_.empty());
	while(!out_.empty()) {
		DescentPriority best = out_.bestPri();
		DescentEdge e = out_.rotate();
		TReadOff al5pi_new = al5pi_, al5pf_new = al5pf_;
		bool fw = rs[rid_].fw;
		bool toward3p = (l2r_ == fw);
		TReadOff edoff = e.off5p; // 5' offset of edit
		assert_leq(edoff, al5pf_ + 1);
		assert_geq(edoff + 1, al5pi_);
		if(out_.empty()) {
			if(!lastRecalc_) {
				// This might allocate new Descents
				recalcOutgoing(q, sc, minsc, maxpen, re, pf, rs, cs, prm);
				if(empty()) {
					// Could happen, since some outgoing edges may have become
					// redundant in the meantime.
					break;
				}
			} else {
				assert(empty());
			}
		}
		TReadOff doff; // edit's offset into this descent
		int chr = asc2dna[e.e.chr];
		// hitEnd is set to true iff this edit pushes us to the extreme 5' or 3'
		// end of the alignment
		bool hitEnd = false;
		// done is set to true iff this edit aligns the only remaining character of
		// the read
		bool done = false;
		if(toward3p) {
			// The 3' extreme of the new Descent is further in (away from the 3'
			// end) than the parent's.
			al5pf_new = doff = edoff;
			if(e.e.isReadGap()) {
				// We didn't actually consume the read character at 'edoff', so
				// retract al5pf_new by one position.  This doesn't effect the
				// "depth" (doff) of the SA range we took, though.
				assert_gt(al5pf_new, 0);
				al5pf_new--;
			}
			assert_lt(al5pf_new, q.length());
			hitEnd = (al5pf_new == q.length() - 1);
			done = (hitEnd && al5pi_new == 0);
			assert_geq(doff, off5p_i_);
			doff = doff - off5p_i_;
			assert_leq(doff, len_);
		} else {
			// The 5' extreme of the new Descent is further in (away from the 5'
			// end) than the parent's.
			al5pi_new = doff = edoff;
			if(e.e.isReadGap()) {
				// We didn't actually consume the read character at 'edoff', so
				// move al5pi_new closer to the 3' end by one position.  This
				// doesn't effect the "depth" (doff) of the SA range we took,
				// though.
				al5pi_new++;
			}
			hitEnd = (al5pi_new == 0);
			done = (hitEnd && al5pf_new == q.length() - 1);
			assert_geq(off5p_i_, doff);
			doff = off5p_i_ - doff;
			assert_leq(doff, len_);
		}
		// Check if this is redundant with an already-explored path
		bool l2r = l2r_; // gets overridden if we bounce
		if(!done && hitEnd) {
			// Alignment finsihed extending in one direction
			l2r = !l2r;
		}
		size_t dfsz = df.size();
		size_t pfsz = pf.size();
		TIndexOffU topf, botf, topb, botb;
		size_t d = posid_ + doff;
		if(e.e.isRefGap()) {
			d--; // might underflow
			if(doff == 0) {
				topf = topf_;
				botf = botf_;
				topb = topb_;
				botb = botb_;
				d = std::numeric_limits<size_t>::max();
				assert_eq(botf-topf, botb-topb);
			} else {
				assert_gt(al5pf_new, 0);
				assert_gt(d, 0);
				chr = pf[d].c;
				assert(pf[d].inited());
				assert_range(0, 3, chr);
				topf = pf[d].topf[chr];
				botf = pf[d].botf[chr];
				topb = pf[d].topb[chr];
				botb = pf[d].botb[chr];
				assert_eq(botf-topf, botb-topb);
			}
		} else {
			// A read gap or a mismatch
			assert(pf[d].inited());
			topf = pf[d].topf[chr];
			botf = pf[d].botf[chr];
			topb = pf[d].topb[chr];
			botb = pf[d].botb[chr];
			assert_eq(botf-topf, botb-topb);
		}
		assert_eq(d, e.d);
		assert_eq(topf, e.topf);
		assert_eq(botf, e.botf);
		assert_eq(topb, e.topb);
		assert_eq(botb, e.botb);
		if(done) {
			// Aligned the entire read end-to-end.  Presumably there's no need to
			// create a new Descent object.  We just report the alignment.
			alsink.reportAlignment(
				q,        // query
				ebwtFw,   // forward index
				ebwtBw,   // backward index
				topf,     // top of SA range in forward index
				botf,     // bottom of SA range in forward index
				topb,     // top of SA range in backward index
				botb,     // bottom of SA range in backward index
				descid_,  // Descent at the leaf
				rid_,     // root id
				e.e,      // extra edit, if necessary
				best.pen, // penalty
				df,       // factory with Descent
				pf,       // factory with DescentPoss
				rs,       // roots
				cs);      // configs
			assert(alsink.repOk());
			return;
		}
		assert(al5pi_new != 0 || al5pf_new != q.length() - 1);
		TDescentId id = df.alloc();
		bool succ = df[id].init(
			q,         // query
			rid_,      // root id
			sc,        // scoring scheme
			minsc,     // minimum score
			maxpen,    // maximum penalty
			al5pi_new, // new near-5' extreme
			al5pf_new, // new far-5' extreme
			topf,      // SA range top in FW index
			botf,      // SA range bottom in FW index
			topb,      // SA range top in BW index
			botb,      // SA range bottom in BW index
			l2r,       // direction this descent will go in
			id,        // my ID
			descid_,   // parent ID
			best.pen,  // total penalties so far
			e.e,       // edit for incoming edge; uninitialized if bounced
			ebwtFw,    // forward index
			ebwtBw,    // mirror index
			re,        // redundancy checker
			df,        // Descent factory
			pf,        // DescentPos factory
			rs,        // DescentRoot list
			cs,        // DescentConfig list
			heap,      // heap
			alsink,    // alignment sink
			met,       // metrics
			prm);      // per-read metrics
		if(!succ) {
			// Reclaim memory we had used for this descent and its DescentPos info
			df.resize(dfsz);
			pf.resize(pfsz);
		}
		break;
	}
	if(!empty()) {
		// Re-insert this Descent with its new priority
		heap.insert(make_pair(out_.bestPri(), descid_));
	}
}

/**
 * Given the forward and backward indexes, and given topf/botf/topb/botb, get
 * tloc, bloc ready for the next step.
 */
void Descent::nextLocsBi(
	const Ebwt& ebwtFw, // forward index
	const Ebwt& ebwtBw, // mirror index
	SideLocus& tloc,    // top locus
	SideLocus& bloc,    // bot locus
	TIndexOffU topf,     // top in BWT
	TIndexOffU botf,     // bot in BWT
	TIndexOffU topb,     // top in BWT'
	TIndexOffU botb)     // bot in BWT'
{
	assert_gt(botf, 0);
	// Which direction are we going in next?
	if(l2r_) {
		// Left to right; use BWT'
		if(botb - topb == 1) {
			// Already down to 1 row; just init top locus
			tloc.initFromRow(topb, ebwtBw.eh(), ebwtBw.ebwt());
			bloc.invalidate();
		} else {
			SideLocus::initFromTopBot(
				topb, botb, ebwtBw.eh(), ebwtBw.ebwt(), tloc, bloc);
			assert(bloc.valid());
		}
	} else {
		// Right to left; use BWT
		if(botf - topf == 1) {
			// Already down to 1 row; just init top locus
			tloc.initFromRow(topf, ebwtFw.eh(), ebwtFw.ebwt());
			bloc.invalidate();
		} else {
			SideLocus::initFromTopBot(
				topf, botf, ebwtFw.eh(), ebwtFw.ebwt(), tloc, bloc);
			assert(bloc.valid());
		}
	}
	// Check if we should update the tracker with this refinement
	assert(botf - topf == 1 ||  bloc.valid());
	assert(botf - topf > 1  || !bloc.valid());
}

/**
 * Advance this descent by following read matches as far as possible.
 *
 * This routine doesn't have to consider the whole gamut of constraints on
 * which outgoing edges can be followed.  If it is a root descent, it does have
 * to know how deep the no-edit constraint goes, though, so we can decide
 * whether using the ftab would potentially jump over relevant branch points.
 * Apart from that, though, we simply proceed as far as it can go by matching
 * characters in the query, irrespective of the constraints.
 * recalcOutgoing(...) and followBestOutgoing(...) do have to consider these
 * constraints, though.
 *
 * Conceptually, as we make descending steps, we have:
 * 1. Before each step, a single range indicating how we departed the previous
 *    step
 * 2. As part of each step, a quad of ranges indicating what range would result
 *    if we proceeded on an a, c, g ot t
 *
 * Return true iff it is possible to branch from this descent.  If we haven't
 * exceeded the no-branch depth.
 */
bool Descent::followMatches(
	const Read& q,     // query string
    const Scoring& sc,         // scoring scheme
	const Ebwt& ebwtFw,        // forward index
	const Ebwt& ebwtBw,        // mirror index
	DescentRedundancyChecker& re, // redundancy checker
	EFactory<Descent>& df,     // Descent factory
	EFactory<DescentPos>& pf,  // DescentPos factory
    const EList<DescentRoot>& rs,   // roots
    const EList<DescentConfig>& cs, // configs
	EHeap<TDescentPair>& heap, // heap
    DescentAlignmentSink& alsink, // alignment sink
	DescentMetrics& met,       // metrics
	PerReadMetrics& prm,       // per-read metrics
    bool& branches,            // out: true -> there are > 0 ways to branch
    bool& hitEnd,              // out: true -> hit read end with non-empty range
    bool& done,                // out: true -> we made a full alignment
    TReadOff& off5p_i,         // out: initial 5' offset
    TIndexOffU& topf_bounce,    // out: top of SA range for fw idx for bounce
    TIndexOffU& botf_bounce,    // out: bot of SA range for fw idx for bounce
    TIndexOffU& topb_bounce,    // out: top of SA range for bw idx for bounce
    TIndexOffU& botb_bounce)    // out: bot of SA range for bw idx for bounce
{
	// TODO: make these full-fledged parameters
	size_t nobranchDepth = 20;
	bool stopOnN = true;
	assert(q.repOk());
	assert(repOk(&q));
	assert_eq(ebwtFw.eh().ftabChars(), ebwtBw.eh().ftabChars());
#ifndef NDEBUG
	for(int i = 0; i < 4; i++) {
		assert_eq(ebwtFw.fchr()[i], ebwtBw.fchr()[i]);
	}
#endif
	SideLocus tloc, bloc;
	TIndexOffU topf = topf_, botf = botf_, topb = topb_, botb = botb_;
    bool fw = rs[rid_].fw;
	bool toward3p;
	size_t off5p;
	assert_lt(al5pi_, q.length());
	assert_lt(al5pf_, q.length());
	while(true) {
		toward3p = (l2r_ == fw);
		assert_geq(al5pf_, al5pi_);
		assert(al5pi_ != 0 || al5pf_ != q.length() - 1);
		if(toward3p) {
			if(al5pf_ == q.length()-1) {
				l2r_ = !l2r_;
				continue;
			}
			if(al5pi_ == al5pf_ && root()) {
				off5p = off5p_i = al5pi_;
			} else {
				off5p = off5p_i = (al5pf_ + 1);
			}
		} else {
			if(al5pi_ == 0) {
				l2r_ = !l2r_;
				continue;
			}
			assert_gt(al5pi_, 0);
			if(al5pi_ == al5pf_ && root()) {
				off5p = off5p_i = al5pi_;
			} else {
				off5p = off5p_i = (al5pi_ - 1);
			}
		}
		break;
	}
	size_t off3p = q.length() - off5p - 1;
	assert_lt(off5p, q.length());
	assert_lt(off3p, q.length());
	bool firstPos = true;
	assert_eq(0, len_);
    
	// Number of times pf.alloc() is called.  So we can sanity check it.
	size_t nalloc = 0;
    // Set to true as soon as we encounter a branch point along this descent.
    branches = false;
    // hitEnd is set to true iff this edit pushes us to the extreme 5' or 3'
    // end of the alignment
    hitEnd = false;
    // done is set to true iff this edit aligns the only remaining character of
    // the read
    done = false;
	if(root()) {
        assert_eq(al5pi_, al5pf_);
		// Check whether/how far we can jump using ftab
		int ftabLen = ebwtFw.eh().ftabChars();
		bool ftabFits = true;
		if(toward3p && ftabLen + off5p > q.length()) {
			ftabFits = false;
		} else if(!toward3p && off5p < (size_t)ftabLen) {
			ftabFits = false;
		}
		bool useFtab = ftabLen > 1 && (size_t)ftabLen <= nobranchDepth && ftabFits;
		bool ftabFailed = false;
		if(useFtab) {
			prm.nFtabs++;
			// Forward index: right-to-left
			size_t off_r2l = fw ? off5p : q.length() - off5p - 1;
			if(l2r_) {
				//
			} else {
				assert_geq((int)off_r2l, ftabLen - 1);
				off_r2l -= (ftabLen - 1);
			}
			bool ret = ebwtFw.ftabLoHi(fw ? q.patFw : q.patRc, off_r2l,
			                           false, // reverse
			                           topf, botf);
			if(!ret) {
				// Encountered an N or something else that made it impossible
				// to use the ftab
				ftabFailed = true;
			} else {
				if(botf - topf == 0) {
					return false;
				}
				int c_r2l = fw ? q.patFw[off_r2l] : q.patRc[off_r2l];
				// Backward index: left-to-right
				size_t off_l2r = fw ? off5p : q.length() - off5p - 1;
				if(l2r_) {
					//
				} else {
					assert_geq((int)off_l2r, ftabLen - 1);
					off_l2r -= (ftabLen - 1);
				}
				ASSERT_ONLY(bool ret2 = )
				ebwtBw.ftabLoHi(fw ? q.patFw : q.patRc, off_l2r,
								false, // don't reverse
								topb, botb);
				assert(ret == ret2);
				int c_l2r = fw ? q.patFw[off_l2r + ftabLen - 1] :
				                 q.patRc[off_l2r + ftabLen - 1];
				assert_eq(botf - topf, botb - topb);
				if(toward3p) {
					assert_geq((int)off3p, ftabLen - 1);
					off5p += ftabLen; off3p -= ftabLen;
				} else {
					assert_geq((int)off5p, ftabLen - 1);
					off5p -= ftabLen; off3p += ftabLen;
				}
				len_ += ftabLen;
				if(toward3p) {
					// By convention, al5pf_ and al5pi_ start out equal, so we only
					// advance al5pf_ by ftabLen - 1 (not ftabLen)
					al5pf_ += (ftabLen - 1); // -1 accounts for inclusive al5pf_
					if(al5pf_ == q.length() - 1) {
						hitEnd = true;
						done = (al5pi_ == 0);
					}
				} else {
					// By convention, al5pf_ and al5pi_ start out equal, so we only
					// advance al5pi_ by ftabLen - 1 (not ftabLen)
					al5pi_ -= (ftabLen - 1);
					if(al5pi_ == 0) {
						hitEnd = true;
						done = (al5pf_ == q.length()-1);
					}
				}
				// Allocate DescentPos data structures and leave them empty.  We
				// jumped over them by doing our lookup in the ftab, so we have no
				// info about outgoing edges from them, besides the matching
				// outgoing edge from the last pos which is in topf/botf and
				// topb/botb.
				size_t id = 0;
				if(firstPos) {
					posid_ = pf.alloc();
					pf[posid_].reset();
					firstPos = false;
					for(int i = 1; i < ftabLen; i++) {
						id = pf.alloc();
						pf[id].reset();
					}
				} else {
					for(int i = 0; i < ftabLen; i++) {
						id = pf.alloc();
						pf[id].reset();
					}
				}
				assert_eq(botf-topf, botb-topb);
				pf[id].c = l2r_ ? c_l2r : c_r2l;
				pf[id].topf[l2r_ ? c_l2r : c_r2l] = topf;
				pf[id].botf[l2r_ ? c_l2r : c_r2l] = botf;
				pf[id].topb[l2r_ ? c_l2r : c_r2l] = topb;
				pf[id].botb[l2r_ ? c_l2r : c_r2l] = botb;
				assert(pf[id].inited());
				nalloc += ftabLen;
			}
		}
		if(!useFtab || ftabFailed) {
			// Can't use ftab, use fchr instead
			int rdc = q.getc(off5p, fw);
			// If rdc is N, that's pretty bad!  That means we placed a root
			// right on an N.  The only thing we can reasonably do is to pick a
			// nucleotide at random and proceed.
			if(rdc > 3) {
				return false;
			}
			assert_range(0, 3, rdc);
			topf = topb = ebwtFw.fchr()[rdc];
			botf = botb = ebwtFw.fchr()[rdc+1];
			if(botf - topf == 0) {
				return false;
			}
			if(toward3p) {
				off5p++; off3p--;
			} else {
				off5p--; off3p++;
			}
			len_++;
            if(toward3p) {
                if(al5pf_ == q.length()-1) {
                    hitEnd = true;
                    done = (al5pi_ == 0);
                }
            } else {
                if(al5pi_ == 0) {
                    hitEnd = true;
                    done = (al5pf_ == q.length()-1);
                }
            }
			// Allocate DescentPos data structure.  We could fill it with the
			// four ranges from fchr if we wanted to, but that will never be
			// relevant.
			size_t id = 0;
			if(firstPos) {
				posid_ = id = pf.alloc();
                firstPos = false;
			} else {
				id = pf.alloc();
			}
			assert_eq(botf-topf, botb-topb);
			pf[id].c = rdc;
			pf[id].topf[rdc] = topf;
			pf[id].botf[rdc] = botf;
			pf[id].topb[rdc] = topb;
			pf[id].botb[rdc] = botb;
			assert(pf[id].inited());
			nalloc++;
		}
		assert_gt(botf, topf);
		assert_eq(botf - topf, botb - topb);
		// Check if this is redundant with an already-explored path
		if(!re.check(fw, l2r_, al5pi_, al5pf_, al5pf_ - al5pi_ + 1 + gapadd_,
		             topf, botf, pen_))
		{
			prm.nRedSkip++;
			return false;
		}
		prm.nRedFail++; // not pruned by redundancy list
		prm.nRedIns++;  // inserted into redundancy list
	}
    if(done) {
        Edit eempty;
        alsink.reportAlignment(
            q,        // query
			ebwtFw,   // forward index
			ebwtBw,   // backward index
			topf,     // top of SA range in forward index
			botf,     // bottom of SA range in forward index
			topb,     // top of SA range in backward index
			botb,     // bottom of SA range in backward index
            descid_,  // Descent at the leaf
			rid_,     // root id
            eempty,   // extra edit, if necessary
            pen_,     // penalty
            df,       // factory with Descent
            pf,       // factory with DescentPoss
            rs,       // roots
            cs);      // configs
		assert(alsink.repOk());
        return true;
    } else if(hitEnd) {
		assert(botf > 0 || topf > 0);
        assert_gt(botf, topf);
        topf_bounce = topf;
        botf_bounce = botf;
        topb_bounce = topb;
        botb_bounce = botb;
        return true; // Bounced
    }
    // We just advanced either ftabLen characters, or 1 character,
    // depending on whether we used ftab or fchr.
    nextLocsBi(ebwtFw, ebwtBw, tloc, bloc, topf, botf, topb, botb);
    assert(tloc.valid());
	assert(botf - topf == 1 ||  bloc.valid());
	assert(botf - topf > 1  || !bloc.valid());
	TIndexOffU t[4], b[4];   // dest BW ranges
	TIndexOffU tp[4], bp[4]; // dest BW ranges for "prime" index
	ASSERT_ONLY(TIndexOffU lasttot = botf - topf);
	bool fail = false;
	while(!fail && !hitEnd) {
        assert(!done);
		int rdc = q.getc(off5p, fw);
		int rdq = q.getq(off5p);
		assert_range(0, 4, rdc);
		assert_gt(botf, topf);
		assert(botf - topf == 1 ||  bloc.valid());
		assert(botf - topf > 1  || !bloc.valid());
		assert(tloc.valid());
        TIndexOffU width = botf - topf;
		bool ltr = l2r_;
		const Ebwt& ebwt = ltr ? ebwtBw : ebwtFw;
		t[0] = t[1] = t[2] = t[3] = b[0] = b[1] = b[2] = b[3] = 0;
		int only = -1; // if we only get 1 non-empty range, this is the char
		size_t nopts = 1;
		if(bloc.valid()) {
			// Set up initial values for the primes
			if(ltr) {
				tp[0] = tp[1] = tp[2] = tp[3] = topf;
				bp[0] = bp[1] = bp[2] = bp[3] = botf;
			} else {
				tp[0] = tp[1] = tp[2] = tp[3] = topb;
				bp[0] = bp[1] = bp[2] = bp[3] = botb;
			}
			// Range delimited by tloc/bloc has size >1.  If size == 1,
			// we use a simpler query (see if(!bloc.valid()) blocks below)
			met.bwops++;
			met.bwops_bi++;
			prm.nSdFmops++;
			if(prm.doFmString) {
				prm.fmString.add(false, pen_, 1);
			}
			ebwt.mapBiLFEx(tloc, bloc, t, b, tp, bp);
			// t, b, tp and bp now filled
			ASSERT_ONLY(TIndexOffU tot = (b[0]-t[0])+(b[1]-t[1])+(b[2]-t[2])+(b[3]-t[3]));
			ASSERT_ONLY(TIndexOffU totp = (bp[0]-tp[0])+(bp[1]-tp[1])+(bp[2]-tp[2])+(bp[3]-tp[3]));
			assert_eq(tot, totp);
			assert_leq(tot, lasttot);
			ASSERT_ONLY(lasttot = tot);
			fail = (rdc > 3 || b[rdc] <= t[rdc]);
			size_t nopts = 0;
			if(b[0] > t[0]) { nopts++; only = 0; }
			if(b[1] > t[1]) { nopts++; only = 1; }
			if(b[2] > t[2]) { nopts++; only = 2; }
			if(b[3] > t[3]) { nopts++; only = 3; }
            if(!fail && b[rdc] - t[rdc] < width) {
                branches = true;
            }
		} else {
			tp[0] = tp[1] = tp[2] = tp[3] = bp[0] = bp[1] = bp[2] = bp[3] = 0;
			// Range delimited by tloc/bloc has size 1
			TIndexOffU ntop = ltr ? topb : topf;
			met.bwops++;
			met.bwops_1++;
			prm.nSdFmops++;
			if(prm.doFmString) {
				prm.fmString.add(false, pen_, 1);
			}
			int cc = ebwt.mapLF1(ntop, tloc);
			assert_range(-1, 3, cc);
            fail = (cc != rdc);
            if(fail) {
                branches = true;
            }
			if(cc >= 0) {
				only = cc;
				t[cc] = ntop; b[cc] = ntop+1;
				tp[cc] = ltr ? topf : topb;
				bp[cc] = ltr ? botf : botb;
			}
		}
		// Now figure out what to do with our N.
		int origRdc = rdc;
		if(rdc == 4) {
			fail = true;
		} else {
			topf = ltr ? tp[rdc] : t[rdc];
			botf = ltr ? bp[rdc] : b[rdc];
			topb = ltr ? t[rdc] : tp[rdc];
			botb = ltr ? b[rdc] : bp[rdc];
			assert_eq(botf - topf, botb - topb);
		}
		// The trouble with !stopOnN is that we don't have a way to store the N
		// edits.  There could be several per Descent.
		if(rdc == 4 && !stopOnN && nopts == 1) {
			fail = false;
			rdc = only;
			int pen = sc.n(rdq);
			assert_gt(pen, 0);
			pen_ += pen;
		}
		assert_range(0, 4, origRdc);
		assert_range(0, 4, rdc);
        // If 'fail' is true, we failed to align this read character.  We still
        // install the SA ranges into the DescentPos and increment len_ in this
        // case.
        
		// Convert t, tp, b, bp info tf, bf, tb, bb
		TIndexOffU *tf = ltr ? tp : t;
		TIndexOffU *bf = ltr ? bp : b;
		TIndexOffU *tb = ltr ? t : tp;
		TIndexOffU *bb = ltr ? b : bp;
		// Allocate DescentPos data structure.
		if(firstPos) {
			posid_ = pf.alloc();
            firstPos = false;
		} else {
			pf.alloc();
		}
		nalloc++;
		pf[posid_ + len_].reset();
        pf[posid_ + len_].c = origRdc;
		for(size_t i = 0; i < 4; i++) {
			pf[posid_ + len_].topf[i] = tf[i];
			pf[posid_ + len_].botf[i] = bf[i];
			pf[posid_ + len_].topb[i] = tb[i];
			pf[posid_ + len_].botb[i] = bb[i];
			assert_eq(pf[posid_ + len_].botf[i] - pf[posid_ + len_].topf[i],
			          pf[posid_ + len_].botb[i] - pf[posid_ + len_].topb[i]);
		}
		if(!fail) {
			// Check if this is redundant with an already-explored path
			size_t al5pf = al5pf_, al5pi = al5pi_;
			if(toward3p) {
				al5pf++;
			} else {
				al5pi--;
			}
			fail = !re.check(fw, l2r_, al5pi, al5pf,
			                 al5pf - al5pi + 1 + gapadd_, topf, botf, pen_);
			if(fail) {
				prm.nRedSkip++;
			} else {
				prm.nRedFail++; // not pruned by redundancy list
				prm.nRedIns++;  // inserted into redundancy list
			}
		}
		if(!fail) {
			len_++;
			if(toward3p) {
				al5pf_++;
				off5p++;
				off3p--;
				if(al5pf_ == q.length() - 1) {
					hitEnd = true;
					done = (al5pi_ == 0);
				}
			} else {
				assert_gt(al5pi_, 0);
				al5pi_--;
				off5p--;
				off3p++;
				if(al5pi_ == 0) {
					hitEnd = true;
					done = (al5pf_ == q.length() - 1);
				}
			}
		}
        if(!fail && !hitEnd) {
            nextLocsBi(ebwtFw, ebwtBw, tloc, bloc, tf[rdc], bf[rdc], tb[rdc], bb[rdc]);
        }
	}
	assert_geq(al5pf_, al5pi_);
	assert(!root() || al5pf_ - al5pi_ + 1 == nalloc || al5pf_ - al5pi_ + 2 == nalloc);
	assert_geq(pf.size(), nalloc);
    if(done) {
        Edit eempty;
        alsink.reportAlignment(
            q,        // query
			ebwtFw,   // forward index
			ebwtBw,   // backward index
			topf,     // top of SA range in forward index
			botf,     // bottom of SA range in forward index
			topb,     // top of SA range in backward index
			botb,     // bottom of SA range in backward index
            descid_,  // Descent at the leaf
			rid_,     // root id
            eempty,   // extra edit, if necessary
            pen_,     // penalty
            df,       // factory with Descent
            pf,       // factory with DescentPoss
            rs,       // roots
            cs);      // configs
		assert(alsink.repOk());
        return true;
    } else if(hitEnd) {
        assert(botf > 0 || topf > 0);
        assert_gt(botf, topf);
        topf_bounce = topf;
        botf_bounce = botf;
        topb_bounce = topb;
        botb_bounce = botb;
        return true; // Bounced
    }
    assert(repOk(&q));
	assert(!hitEnd || topf_bounce > 0 || botf_bounce > 0);
	return true;
}

#ifdef ALIGNER_SEED2_MAIN

#include <string>
#include "sstring.h"
#include "aligner_driver.h"

using namespace std;

bool gReportOverhangs = true;

/**
 * A way of feeding simply tests to the seed alignment infrastructure.
 */
int main(int argc, char **argv) {

    EList<string> strs;
    //                            GCTATATAGCGCGCTCGCATCATTTTGTGT
    strs.push_back(string("CATGTCAGCTATATAGCGCGCTCGCATCATTTTGTGTGTAAACCA"
                          "NNNNNNNNNN"
                          "CATGTCAGCTATATAGCGCGCTCGCATCATTTTGTGTGTAAACCA"));
    //                            GCTATATAGCGCGCTTGCATCATTTTGTGT
    //                                           ^
    bool packed = false;
	pair<Ebwt*, Ebwt*> ebwts = Ebwt::fromStrings<SString<char> >(
		strs,
		packed,
		0,
		REF_READ_REVERSE,
		Ebwt::default_bigEndian,
		Ebwt::default_lineRate,
		Ebwt::default_offRate,
		Ebwt::default_ftabChars,
		".aligner_seed2.cpp.tmp",
		Ebwt::default_useBlockwise,
		Ebwt::default_bmax,
		Ebwt::default_bmaxMultSqrt,
		Ebwt::default_bmaxDivN,
		Ebwt::default_dcv,
		Ebwt::default_seed,
		false,  // verbose
		false,  // autoMem
		false); // sanity
    
    ebwts.first->loadIntoMemory (0, -1, true, true, true, true, false);
    ebwts.second->loadIntoMemory(0,  1, true, true, true, true, false);
	
	int testnum = 0;

	// Query is longer than ftab and matches exactly twice
    for(int rc = 0; rc < 2; rc++) {
		for(int i = 0; i < 2; i++) {
			cerr << "Test " << (++testnum) << endl;
			cerr << "  Query with length greater than ftab" << endl;
			DescentMetrics mets;
			PerReadMetrics prm;
			DescentDriver dr;
			
			// Set up the read
			BTDnaString seq ("GCTATATAGCGCGCTCGCATCATTTTGTGT", true);
			BTString    qual("ABCDEFGHIabcdefghiABCDEFGHIabc");
			if(rc) {
				seq.reverseComp();
				qual.reverse();
			}
			dr.initRead(
				Read("test", seq.toZBuf(), qual.toZBuf()),
				false, // nofw
				false, // norc
				-30,   // minsc
				30);   // maxpen

			// Set up the DescentConfig
			DescentConfig conf;
			conf.cons.init(Ebwt::default_ftabChars, 1.0);
			conf.expol = DESC_EX_NONE;
			
			// Set up the search roots
			dr.addRoot(
				conf,   // DescentConfig
				(i == 0) ? 0 : (seq.length() - 1), // 5' offset into read of root
				(i == 0) ? true : false,           // left-to-right?
				rc == 0,   // forward?
				1,         // landing
				0.0f);   // root priority
			
			// Do the search
			Scoring sc = Scoring::base1();
			dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
			
			// Confirm that an exact-matching alignment was found
			assert_eq(1, dr.sink().nrange());
			assert_eq(2, dr.sink().nelt());
		}
	}
	
	// Query has length euqal to ftab and matches exactly twice
    for(int i = 0; i < 2; i++) {
		cerr << "Test " << (++testnum) << endl;
		cerr << "  Query with length equal to ftab" << endl;
        DescentMetrics mets;
		PerReadMetrics prm;
        DescentDriver dr;
        
        // Set up the read
        BTDnaString seq ("GCTATATAGC", true);
        BTString    qual("ABCDEFGHIa");
		dr.initRead(
			Read("test", seq.toZBuf(), qual.toZBuf()),
			false, // nofw
			false, // norc
			-30,   // minsc
			30);   // maxpen
        
        // Set up the DescentConfig
        DescentConfig conf;
        conf.cons.init(Ebwt::default_ftabChars, 1.0);
        conf.expol = DESC_EX_NONE;
        
        // Set up the search roots
        dr.addRoot(
            conf,   // DescentConfig
            (i == 0) ? 0 : (seq.length() - 1), // 5' offset into read of root
            (i == 0) ? true : false,           // left-to-right?
            true,   // forward?
			1,      // landing
            0.0f);  // root priority
        
        // Do the search
        Scoring sc = Scoring::base1();
        dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
		
		// Confirm that an exact-matching alignment was found
		assert_eq(1, dr.sink().nrange());
		assert_eq(2, dr.sink().nelt());
    }

	// Query has length less than ftab length and matches exactly twice
    for(int i = 0; i < 2; i++) {
		cerr << "Test " << (++testnum) << endl;
		cerr << "  Query with length less than ftab" << endl;
        DescentMetrics mets;
		PerReadMetrics prm;
        DescentDriver dr;
        
        // Set up the read
        BTDnaString seq ("GCTATATAG", true);
        BTString    qual("ABCDEFGHI");
		dr.initRead(
			Read("test", seq.toZBuf(), qual.toZBuf()),
			false, // nofw
			false, // norc
			-30,   // minsc
			30);   // maxpen
        
        // Set up the DescentConfig
        DescentConfig conf;
        conf.cons.init(Ebwt::default_ftabChars, 1.0);
        conf.expol = DESC_EX_NONE;
        
        // Set up the search roots
        dr.addRoot(
            conf,   // DescentConfig
            (i == 0) ? 0 : (seq.length() - 1), // 5' offset into read of root
            (i == 0) ? true : false,           // left-to-right?
            true,   // forward?
			1,      // landing
            0.0f);   // root priority
        
        // Do the search
        Scoring sc = Scoring::base1();
        dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
		
		// Confirm that an exact-matching alignment was found
		assert_eq(1, dr.sink().nrange());
		assert_eq(2, dr.sink().nelt());
    }
	
	// Search root is in the middle of the read, requiring a bounce
    for(int i = 0; i < 2; i++) {
		cerr << "Test " << (++testnum) << endl;
		cerr << "  Search root in middle of read" << endl;
        DescentMetrics mets;
		PerReadMetrics prm;
        DescentDriver dr;
        
        // Set up the read
		//                012345678901234567890123456789
        BTDnaString seq ("GCTATATAGCGCGCTCGCATCATTTTGTGT", true);
        BTString    qual("ABCDEFGHIabcdefghiABCDEFGHIabc");
		TIndexOffU top, bot;
		top = bot = 0;
		bool ret = ebwts.first->contains("GCGCTCGCATCATTTTGTGT", &top, &bot);
		cerr << ret << ", " << top << ", " << bot << endl;
		dr.initRead(
			Read("test", seq.toZBuf(), qual.toZBuf()),
			false, // nofw
			false, // norc
			-30,   // minsc
			30);   // maxpen
        
        // Set up the DescentConfig
        DescentConfig conf;
        conf.cons.init(Ebwt::default_ftabChars, 1.0);
        conf.expol = DESC_EX_NONE;
        
        // Set up the search roots
        dr.addRoot(
            conf,   // DescentConfig
            (i == 0) ? 10 : (seq.length() - 1 - 10), // 5' offset into read of root
            (i == 0) ? true : false,                 // left-to-right?
            true,   // forward?
			1,      // landing
            0.0f);   // root priority
        
        // Do the search
        Scoring sc = Scoring::base1();
        dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
		
		// Confirm that an exact-matching alignment was found
		assert_eq(1, dr.sink().nrange());
		assert_eq(2, dr.sink().nelt());
    }

	delete ebwts.first;
	delete ebwts.second;
	
	strs.clear();
    strs.push_back(string("CATGTCAGCTATATAGCGCGCTCGCATCATTTTGTGTGTAAACCA"
                          "NNNNNNNNNN"
                          "CATGTCAGCTATATAGCG"));
	ebwts = Ebwt::fromStrings<SString<char> >(
		strs,
		packed,
		0,
		REF_READ_REVERSE,
		Ebwt::default_bigEndian,
		Ebwt::default_lineRate,
		Ebwt::default_offRate,
		Ebwt::default_ftabChars,
		".aligner_seed2.cpp.tmp",
		Ebwt::default_useBlockwise,
		Ebwt::default_bmax,
		Ebwt::default_bmaxMultSqrt,
		Ebwt::default_bmaxDivN,
		Ebwt::default_dcv,
		Ebwt::default_seed,
		false,  // verbose
		false,  // autoMem
		false); // sanity
    
    ebwts.first->loadIntoMemory (0, -1, true, true, true, true, false);
    ebwts.second->loadIntoMemory(0,  1, true, true, true, true, false);

	// Test to see if the root selector works as we expect
	{
		BTDnaString seq ("GCTATATAGCGCGCTCGCATCATTTTGTGT", true);
		BTString    qual("ABCDEFGHIabcdefghiABCDEFGHIabc");
		//                012345678901234567890123456789
		//                         abcdefghiA: 644
		//                                    CDEFGHIabc : 454 + 100 = 554
		DescentDriver dr;
		PrioritizedRootSelector sel(
			2.0,
			SimpleFunc(SIMPLE_FUNC_CONST, 10.0, 10.0, 10.0, 10.0), // 6 roots
			10);
		// Set up the read
		dr.initRead(
			Read("test", seq.toZBuf(), qual.toZBuf()),
			false, // nofw
			false, // norc
			-30,   // minsc
			30,    // maxpen
			NULL,  // opposite mate
			&sel); // root selector
		dr.printRoots(std::cerr);
		assert_eq(12, dr.roots().size());
		assert_eq(652, dr.roots()[0].pri);
		assert_eq(652, dr.roots()[1].pri);
	}

	// Test to see if the root selector works as we expect; this time the
	// string is longer (64 chars) and there are a couple Ns
	{
		BTDnaString seq ("NCTATATAGCGCGCTCGCATCNTTTTGTGTGCTATATAGCGCGCTCGCATCATTTTGTGTTTAT", true);
		BTString    qual("ABCDEFGHIJKLMNOPabcdefghijklmnopABCDEFGHIJKLMNOPabcdefghijklmnop");
		//                0123456789012345678901234567890123456789012345678901234567890123
		//                                 bcdefghijklmnop: 1080 - 150     bcdefghijklmnop: 1080 + 150 = 1230
		//                                                 = 930
		DescentDriver dr;
		PrioritizedRootSelector sel(
			2.0,
			SimpleFunc(SIMPLE_FUNC_CONST, 10.0, 10.0, 10.0, 10.0), // 6 * 4 = 24 roots
			15);  // landing size
		// Set up the read
		dr.initRead(
			Read("test", seq.toZBuf(), qual.toZBuf()),
			false, // nofw
			false, // norc
			-30,   // minsc
			30,    // maxpen
			NULL,  // opposite mate
			&sel); // root selector
		dr.printRoots(std::cerr);
		assert_eq(24, dr.roots().size());
		assert_eq(1230, dr.roots()[0].pri);
		assert_eq(1230, dr.roots()[1].pri);
	}
	
	// Query is longer than ftab and matches exactly once.  One search root for
	// forward read.
	{
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
			BTDnaString seq ("GCTATATAGCGCGCTCGCATCATTTTGTGT", true);
			BTString    qual("ABCDEFGHIabcdefghiABCDEFGHIabc");
			for(size_t j = 0; j < seq.length(); j++) {
				cerr << "Test " << (++testnum) << endl;
				cerr << "  Query with length greater than ftab and matches exactly once" << endl;
				DescentMetrics mets;
				PerReadMetrics prm;
				DescentDriver dr;
				
				// Set up the read
				dr.initRead(
					Read("test", seq.toZBuf(), qual.toZBuf()),
					false, // nofw
					false, // norc
					-30,   // minsc
					30);   // maxpen
				
				// Set up the DescentConfig
				DescentConfig conf;
				conf.cons.init(Ebwt::default_ftabChars, 1.0);
				conf.expol = DESC_EX_NONE;
				
				// Set up the search roots
				dr.addRoot(
					conf,   // DescentConfig
					j,      // 5' offset into read of root
					i == 0, // left-to-right?
					true,   // forward?
					1,      // landing
					0.0f);   // root priority
				
				// Do the search
				Scoring sc = Scoring::base1();
				dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
				
				// Confirm that an exact-matching alignment was found
				assert_eq(1, dr.sink().nrange());
				assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
				assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
				assert_eq(1, dr.sink().nelt());
			}
		}
	}

	// Query is longer than ftab and its reverse complement matches exactly
	// once.  Search roots on forward and reverse-comp reads.
	{
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
			BTDnaString seq ("GCTATATAGCGCGCTCGCATCATTTTGTGT", true);
			BTString    qual("ABCDEFGHIabcdefghiABCDEFGHIabc");
			for(size_t j = 0; j < seq.length(); j++) {
				cerr << "Test " << (++testnum) << endl;
				cerr << "  Query with length greater than ftab and reverse complement matches exactly once" << endl;
				DescentMetrics mets;
				PerReadMetrics prm;
				DescentDriver dr;
				
				// Set up the read
				dr.initRead(
					Read("test", seq.toZBuf(), qual.toZBuf()),
					false, // nofw
					false, // norc
					-30,   // minsc
					30);   // maxpen
				
				// Set up the DescentConfig
				DescentConfig conf;
				conf.cons.init(Ebwt::default_ftabChars, 1.0);
				conf.expol = DESC_EX_NONE;
				
				// Set up the search roots
				dr.addRoot(
					conf,   // DescentConfig
					j,      // 5' offset into read of root
					i == 0, // left-to-right?
					true,   // forward?
					1,      // landing
					0.0f);   // root priority
				dr.addRoot(
					conf,   // DescentConfig
					j,      // 5' offset into read of root
					i == 0, // left-to-right?
					false,  // forward?
					1,      // landing
					1.0f);   // root priority
				
				// Do the search
				Scoring sc = Scoring::base1();
				dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
				
				// Confirm that an exact-matching alignment was found
				assert_eq(1, dr.sink().nrange());
				assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
				assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
				assert_eq(1, dr.sink().nelt());
			}
		}
	}

	// Query is longer than ftab and matches exactly once with one mismatch
	{
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
			// Set up the read
			//    Ref: CATGTCAGCTATATAGCGCGCTCGCATCATTTTGTGTGTAAACCA
			//                ||||||||||||||||||||||||||||||
			BTDnaString orig("GCTATATAGCGCGCTCGCATCATTTTGTGT", true);
			//                012345678901234567890123456789
			BTString    qual("ABCDEFGHIabcdefghiABCDEFGHIabc");
			for(size_t k = 0; k < orig.length(); k++) {
				BTDnaString seq = orig;
				seq.set(seq[k] ^ 3, k);
				for(size_t j = 0; j < seq.length(); j++) {
					// Assume left-to-right
					size_t beg = j;
					size_t end = j + Ebwt::default_ftabChars;
					// Mismatch penalty is 3, so we have to skip starting
					// points that are within 2 from the mismatch
					if((i > 0 && j > 0) || j == seq.length()-1) {
						// Right-to-left
						if(beg < Ebwt::default_ftabChars) {
							beg = 0;
						} else {
							beg -= Ebwt::default_ftabChars;
						}
						end -= Ebwt::default_ftabChars;
					}
					size_t kk = k;
					//if(rc) {
					//	kk = seq.length() - k - 1;
					//}
					if(beg <= kk && end > kk) {
						continue;
					}
					if((j > kk) ? (j - kk <= 2) : (kk - j <= 2)) {
						continue;
					}
					cerr << "Test " << (++testnum) << endl;
					cerr << "  Query with length greater than ftab and matches exactly once with 1mm" << endl;
					DescentMetrics mets;
					PerReadMetrics prm;
					DescentDriver dr;
					
					dr.initRead(
						Read("test", seq.toZBuf(), qual.toZBuf()),
						false, // nofw
						false, // norc
						-30,   // minsc
						30);   // maxpen
					
					// Set up the DescentConfig
					DescentConfig conf;
					// Changed 
					conf.cons.init(0, 1.0);
					conf.expol = DESC_EX_NONE;
					
					// Set up the search roots
					dr.addRoot(
						conf,    // DescentConfig
						j,       // 5' offset into read of root
						i == 0,  // left-to-right?
						true,    // forward?
						1,      // landing
						0.0f);    // root priority
					
					// Do the search
					Scoring sc = Scoring::base1();
					dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
					
					// Confirm that an exact-matching alignment was found
					assert_eq(1, dr.sink().nrange());
					assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
					assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
					cerr << dr.sink()[0].topf << ", " << dr.sink()[0].botf << endl;
					assert_eq(1, dr.sink().nelt());
					last_topf = dr.sink()[0].topf;
					last_botf = dr.sink()[0].botf;
				}
			}
		}
    }

	// Query is longer than ftab and matches exactly once with one N mismatch
	{
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
			// Set up the read
			//    Ref: CATGTCAGCTATATAGCGCGCTCGCATCATTTTGTGTGTAAACCA
			//                ||||||||||||||||||||||||||||||
			BTDnaString orig("GCTATATAGCGCGCTCGCATCATTTTGTGT", true);
			//                012345678901234567890123456789
			BTString    qual("ABCDEFGHIabcdefghiABCDEFGHIabc");
			for(size_t k = 0; k < orig.length(); k++) {
				BTDnaString seq = orig;
				seq.set(4, k);
				for(size_t j = 0; j < seq.length(); j++) {
					// Assume left-to-right
					size_t beg = j;
					size_t end = j + Ebwt::default_ftabChars;
					// Mismatch penalty is 3, so we have to skip starting
					// points that are within 2 from the mismatch
					if((i > 0 && j > 0) || j == seq.length()-1) {
						// Right-to-left
						if(beg < Ebwt::default_ftabChars) {
							beg = 0;
						} else {
							beg -= Ebwt::default_ftabChars;
						}
						end -= Ebwt::default_ftabChars;
					}
					if(beg <= k && end > k) {
						continue;
					}
					if((j > k) ? (j - k <= 2) : (k - j <= 2)) {
						continue;
					}
					cerr << "Test " << (++testnum) << endl;
					cerr << "  Query with length greater than ftab and matches exactly once with 1mm" << endl;
					DescentMetrics mets;
					PerReadMetrics prm;
					DescentDriver dr;
					
					dr.initRead(
						Read("test", seq.toZBuf(), qual.toZBuf()),
						false, // nofw
						false, // norc
						-30,   // minsc
						30);   // maxpen
					
					// Set up the DescentConfig
					DescentConfig conf;
					// Changed 
					conf.cons.init(0, 1.0);
					conf.expol = DESC_EX_NONE;
					
					// Set up the search roots
					dr.addRoot(
						conf,   // DescentConfig
						j,      // 5' offset into read of root
						i == 0, // left-to-right?
						true,   // forward?
						1,      // landing
						0.0f);   // root priority
					
					// Do the search
					Scoring sc = Scoring::base1();
					dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
					
					// Confirm that an exact-matching alignment was found
					assert_eq(1, dr.sink().nrange());
					assert_eq(sc.n(40), dr.sink()[0].pen);
					assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
					assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
					cerr << dr.sink()[0].topf << ", " << dr.sink()[0].botf << endl;
					assert_eq(1, dr.sink().nelt());
					last_topf = dr.sink()[0].topf;
					last_botf = dr.sink()[0].botf;
				}
			}
		}
    }

	// Throw a bunch of queries with a bunch of Ns in and try to force an assert
	{
		RandomSource rnd(79);
		for(int i = 0; i < 2; i++) {
			// Set up the read
			//    Ref: CATGTCAGCTATATAGCGCGCTCGCATCATTTTGTGTGTAAACCA
			//                ||||||||||||||||||||||||||||||
			BTDnaString orig("GCTATATAGCGCGCTCGCATCATTTTGTGT", true);
			//                012345678901234567890123456789
			BTString    qual("ABCDEFGHIabcdefghiABCDEFGHIabc");
			if(i == 1) {
				orig.reverseComp();
				qual.reverse();
			}
			for(size_t trials = 0; trials < 100; trials++) {
				BTDnaString seq = orig;
				size_t ns = 10;
				for(size_t k = 0; k < ns; k++) {
					size_t pos = rnd.nextU32() % seq.length();
					seq.set(4, pos);
				}
				
				cerr << "Test " << (++testnum) << endl;
				cerr << "  Query with a bunch of Ns" << endl;
				
				DescentMetrics mets;
				PerReadMetrics prm;
				DescentDriver dr;
				
				dr.initRead(
					Read("test", seq.toZBuf(), qual.toZBuf()),
					false, // nofw
					false, // norc
					-30,   // minsc
					30);   // maxpen
				
				// Set up the DescentConfig
				DescentConfig conf;
				// Changed 
				conf.cons.init(Ebwt::default_ftabChars, 1.0);
				conf.expol = DESC_EX_NONE;
				
				// Set up the search roots
				for(size_t k = 0; k < ns; k++) {
					size_t j = rnd.nextU32() % seq.length();
					bool ltr = (rnd.nextU2() == 0) ? true : false;
					bool fw = (rnd.nextU2() == 0) ? true : false;
					dr.addRoot(
						conf,   // DescentConfig
						j,      // 5' offset into read of root
						ltr,    // left-to-right?
						fw,     // forward?
						1,      // landing
						0.0f);   // root priority
				}
				
				// Do the search
				Scoring sc = Scoring::base1();
				dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
			}
		}
    }

	// Query is longer than ftab and matches exactly once with one mismatch
	{
		RandomSource rnd(77);
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
			// Set up the read
			//    Ref: CATGTCAGCTATATAGCGCGCTCGCATCATTTTGTGTGTAAACCA
			//                ||||||||||||||||||||||||||||||
			BTDnaString orig("GCTATATAGCGCGCTCGCATCATTTTGTGT", true);
			//                012345678901234567890123456789
			BTString    qual("ABCDEFGHIabcdefghiABCDEFGHIabc");
			//       revcomp: ACACAAAATGATGCGAGCGCGCTATATAGC
			//       revqual: cbaIHGFEDCBAihgfedcbaIHGFEDCBA
			bool fwi = (i == 0);
			if(!fwi) {
				orig.reverseComp();
			}
			for(size_t k = 0; k < orig.length(); k++) {
				BTDnaString seq = orig;
				seq.set(seq[k] ^ 3, k);
				cerr << "Test " << (++testnum) << endl;
				cerr << "  Query with length greater than ftab and matches exactly once with 1mm.  Many search roots." << endl;
				DescentMetrics mets;
				PerReadMetrics prm;
				DescentDriver dr;
				
				dr.initRead(
					Read("test", seq.toZBuf(), qual.toZBuf()),
					false, // nofw
					false, // norc
					-30,   // minsc
					30);   // maxpen
				
				// Set up the DescentConfig
				DescentConfig conf;
				// Changed 
				conf.cons.init(0, 1.0);
				conf.expol = DESC_EX_NONE;
				
				// Set up several random search roots
				bool onegood = false;
				for(size_t y = 0; y < 10; y++) {
					size_t j = rnd.nextU32() % seq.length();
					bool ltr = (rnd.nextU2() == 0) ? true : false;
					bool fw = (rnd.nextU2() == 0) ? true : false;
					dr.addRoot(
						conf,     // DescentConfig
						(TReadOff)j,        // 5' offset into read of root
						ltr,      // left-to-right?
						fw,       // forward?
						1,        // landing
						(float)((float)y * 1.0f)); // root priority
					// Assume left-to-right
					size_t beg = j;
					size_t end = j + Ebwt::default_ftabChars;
					// Mismatch penalty is 3, so we have to skip starting
					// points that are within 2 from the mismatch
					if(!ltr) {
						// Right-to-left
						if(beg < Ebwt::default_ftabChars) {
							beg = 0;
						} else {
							beg -= Ebwt::default_ftabChars;
						}
						end -= Ebwt::default_ftabChars;
					}
					bool good = true;
					if(fw != fwi) {
						good = false;
					}
					if(beg <= k && end > k) {
						good = false;
					}
					if((j > k) ? (j - k <= 2) : (k - j <= 2)) {
						good = false;
					}
					if(good) {
						onegood = true;
					}
				}
				if(!onegood) {
					continue;
				}
				
				// Do the search
				Scoring sc = Scoring::base1();
				dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
				
				// Confirm that an exact-matching alignment was found
				assert_eq(1, dr.sink().nrange());
				assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
				assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
				cerr << dr.sink()[0].topf << ", " << dr.sink()[0].botf << endl;
				assert_eq(1, dr.sink().nelt());
				last_topf = dr.sink()[0].topf;
				last_botf = dr.sink()[0].botf;
			}
		}
    }

	// Query is longer than ftab and matches exactly once with one read gap
	{
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
		for(int k = 0; k < 2; k++) {
			// Set up the read
			//                GCTATATAGCGCGCCTGCATCATTTTGTGT
			//    Ref: CATGTCAGCTATATAGCGCGCTCGCATCATTTTGTGTGTAAACCA
			//                |||||||||||||||///////////////
			BTDnaString seq ("GCTATATAGCGCGCTGCATCATTTTGTGT", true);
			//                01234567890123456789012345678
			//                87654321098765432109876543210
			BTString    qual("ABCDEFGHIabcdefghiABCDEFGHIab");
			if(k == 1) {
				seq.reverseComp();
				qual.reverse();
			}
			assert_eq(seq.length(), qual.length());
			// js iterate over offsets from 5' end for the search root
			for(size_t j = 0; j < seq.length(); j++) {
				// Assume left-to-right
				size_t beg = j;
				if(k == 1) {
					beg = seq.length() - beg - 1;
				}
				size_t end = beg + Ebwt::default_ftabChars;
				// Mismatch penalty is 3, so we have to skip starting
				// points that are within 2 from the mismatch
				if((i > 0 && j > 0) || j == seq.length()-1) {
					// Right-to-left
					if(beg < Ebwt::default_ftabChars) {
						beg = 0;
					} else {
						beg -= Ebwt::default_ftabChars;
					}
					end -= Ebwt::default_ftabChars;
				}
				assert_geq(end, beg);
				if(beg <= 15 && end >= 15) {
					continue;
				}
				cerr << "Test " << (++testnum) << endl;
				cerr << "  Query matches once with a read gap of length 1" << endl;
				DescentMetrics mets;
				PerReadMetrics prm;
				DescentDriver dr;
				
				Read q("test", seq.toZBuf(), qual.toZBuf());
				assert(q.repOk());
				dr.initRead(
					q,     // read
					false, // nofw
					false, // norc
					-30,   // minsc
					30);   // maxpen
				
				// Set up the DescentConfig
				DescentConfig conf;
				// Changed 
				conf.cons.init(0, 0.5);
				conf.expol = DESC_EX_NONE;
				
				// Set up the search roots
				dr.addRoot(
					conf,   // DescentConfig
					j,      // 5' offset into read of root
					i == 0, // left-to-right?
					k == 0, // forward?
					1,      // landing
					0.0f);  // root priority
				
				// Do the search
				Scoring sc = Scoring::base1();
				dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
				
				// Confirm that an exact-matching alignment was found
				assert_eq(1, dr.sink().nrange());
				assert_eq(sc.readGapOpen() + 0 * sc.readGapExtend(), dr.sink()[0].pen);
				assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
				assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
				cerr << dr.sink()[0].topf << ", " << dr.sink()[0].botf << endl;
				assert_eq(1, dr.sink().nelt());
				last_topf = dr.sink()[0].topf;
				last_botf = dr.sink()[0].botf;
			}
		}}
    }

	// Query is longer than ftab and matches exactly once with one read gap of
	// length 3
	{
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
		for(int k = 0; k < 2; k++) {
			// Set up the read
			//                GCTATATAGCGCGCGCTCATCATTTTGTGT
			//    Ref: CATGTCAGCTATATAGCGCGCTCGCATCATTTTGTGTGTAAACCA
			//                ||||||||||||||   |||||||||||||
			BTDnaString seq ("GCTATATAGCGCGC" "CATCATTTTGTGT", true);
			//                01234567890123   4567890123456
			//                65432109876543   2109876543210
			BTString    qual("ABCDEFGHIabcde" "fghiABCDEFGHI");
			if(k == 1) {
				seq.reverseComp();
				qual.reverse();
			}
			for(size_t j = 0; j < seq.length(); j++) {
				// Assume left-to-right
				size_t beg = j;
				if(k == 1) {
					beg = seq.length() - beg - 1;
				}
				size_t end = beg + Ebwt::default_ftabChars;
				// Mismatch penalty is 3, so we have to skip starting
				// points that are within 2 from the mismatch
				if((i > 0 && j > 0) || j == seq.length()-1) {
					// Right-to-left
					if(beg < Ebwt::default_ftabChars) {
						beg = 0;
					} else {
						beg -= Ebwt::default_ftabChars;
					}
					end -= Ebwt::default_ftabChars;
				}
				if(beg <= 14 && end >= 14) {
					continue;
				}
				cerr << "Test " << (++testnum) << endl;
				cerr << "  Query matches once with a read gap of length 3" << endl;
				DescentMetrics mets;
				PerReadMetrics prm;
				DescentDriver dr;
				
				dr.initRead(
					Read("test", seq.toZBuf(), qual.toZBuf()),
					false, // nofw
					false, // norc
					-30,   // minsc
					30);   // maxpen
				
				// Set up the DescentConfig
				DescentConfig conf;
				// Changed
				conf.cons.init(0, 0.2);
				conf.expol = DESC_EX_NONE;
				
				// Set up the search roots
				dr.addRoot(
					conf,   // DescentConfig
					j,      // 5' offset into read of root
					i == 0, // left-to-right?
					k == 0, // forward?
					1,      // landing
					0.0f);  // root priority
				
				// Do the search
				Scoring sc = Scoring::base1();
				// Need to adjust the mismatch penalty up to avoid alignments
				// with lots of mismatches.
				sc.setMmPen(COST_MODEL_CONSTANT, 6, 6);
				dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
				
				// Confirm that an exact-matching alignment was found
				assert_eq(1, dr.sink().nrange());
				assert_eq(sc.readGapOpen() + 2 * sc.readGapExtend(), dr.sink()[0].pen);
				assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
				assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
				cerr << dr.sink()[0].topf << ", " << dr.sink()[0].botf << endl;
				assert_eq(1, dr.sink().nelt());
				last_topf = dr.sink()[0].topf;
				last_botf = dr.sink()[0].botf;
			}
		}}
    }

	// Query is longer than ftab and matches exactly once with one reference gap
	{
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
			// Set up the read
			//    Ref: CATGTCAGCTATATAGCGCGC" "TCGCATCATTTTGTGTGTAAACCA
			//                ||||||||||||||   ||||||||||||||||
			BTDnaString seq ("GCTATATAGCGCGCA""TCGCATCATTTTGTGT", true);
			//                012345678901234  5678901234567890
			BTString    qual("ABCDEFGHIabcdef""ghiABCDEFGHIabcd");
			for(size_t j = 0; j < seq.length(); j++) {
				// Assume left-to-right
				size_t beg = j;
				size_t end = j + Ebwt::default_ftabChars;
				// Mismatch penalty is 3, so we have to skip starting
				// points that are within 2 from the mismatch
				if((i > 0 && j > 0) || j == seq.length()-1) {
					// Right-to-left
					if(beg < Ebwt::default_ftabChars) {
						beg = 0;
					} else {
						beg -= Ebwt::default_ftabChars;
					}
					end -= Ebwt::default_ftabChars;
				}
				if(beg <= 14 && end >= 14) {
					continue;
				}
				cerr << "Test " << (++testnum) << endl;
				cerr << "  Query matches once with a reference gap of length 1" << endl;
				DescentMetrics mets;
				PerReadMetrics prm;
				DescentDriver dr;
				
				dr.initRead(
					Read("test", seq.toZBuf(), qual.toZBuf()),
					false, // nofw
					false, // norc
					-30,   // minsc
					30);   // maxpen
				
				// Set up the DescentConfig
				DescentConfig conf;
				// Changed 
				conf.cons.init(1, 0.5);
				conf.expol = DESC_EX_NONE;
				
				// Set up the search roots
				dr.addRoot(
					conf,   // DescentConfig
					j,      // 5' offset into read of root
					i == 0, // left-to-right?
					true,   // forward?
					1,      // landing
					0.0f);  // root priority
				
				// Do the search
				Scoring sc = Scoring::base1();
				// Need to adjust the mismatch penalty up to avoid alignments
				// with lots of mismatches.
				sc.setMmPen(COST_MODEL_CONSTANT, 6, 6);
				dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
				
				// Confirm that an exact-matching alignment was found
				assert_eq(1, dr.sink().nrange());
				assert_eq(sc.refGapOpen() + 0 * sc.refGapExtend(), dr.sink()[0].pen);
				assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
				assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
				cerr << dr.sink()[0].topf << ", " << dr.sink()[0].botf << endl;
				assert_eq(1, dr.sink().nelt());
				last_topf = dr.sink()[0].topf;
				last_botf = dr.sink()[0].botf;
			}
		}
    }

	// Query is longer than ftab and matches exactly once with one reference gap
	{
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
			// Set up the read
			//    Ref: CATGTCAGCTATATAGCGCGC"   "TCGCATCATTTTGTGTGTAAACCA
			//                ||||||||||||||     ||||||||||||||||
			BTDnaString seq ("GCTATATAGCGCGCATG""TCGCATCATTTTGTGT", true);
			//                01234567890123456  7890123456789012
			BTString    qual("ABCDEFGHIabcdefgh""iABCDEFGHIabcdef");
			for(size_t j = 0; j < seq.length(); j++) {
				// Assume left-to-right
				size_t beg = j;
				size_t end = j + Ebwt::default_ftabChars;
				// Mismatch penalty is 3, so we have to skip starting
				// points that are within 2 from the mismatch
				if((i > 0 && j > 0) || j == seq.length()-1) {
					// Right-to-left
					if(beg < Ebwt::default_ftabChars) {
						beg = 0;
					} else {
						beg -= Ebwt::default_ftabChars;
					}
					end -= Ebwt::default_ftabChars;
				}
				if(beg <= 14 && end >= 14) {
					continue;
				}
				if(beg <= 15 && end >= 15) {
					continue;
				}
				if(beg <= 16 && end >= 16) {
					continue;
				}
				cerr << "Test " << (++testnum) << endl;
				cerr << "  Query matches once with a reference gap of length 1" << endl;
				DescentMetrics mets;
				PerReadMetrics prm;
				DescentDriver dr;
				
				dr.initRead(
					Read("test", seq.toZBuf(), qual.toZBuf()),
					false, // nofw
					false, // norc
					-30,   // minsc
					30);   // maxpen
				
				// Set up the DescentConfig
				DescentConfig conf;
				// Changed 
				conf.cons.init(1, 0.25);
				conf.expol = DESC_EX_NONE;
				
				// Set up the search roots
				dr.addRoot(
					conf,   // DescentConfig
					j,      // 5' offset into read of root
					i == 0, // left-to-right?
					true,   // forward?
					1,      // landing
					0.0f);  // root priority
				
				// Do the search
				Scoring sc = Scoring::base1();
				// Need to adjust the mismatch penalty up to avoid alignments
				// with lots of mismatches.
				sc.setMmPen(COST_MODEL_CONSTANT, 6, 6);
				dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
				
				// Confirm that an exact-matching alignment was found
				assert_eq(1, dr.sink().nrange());
				assert_eq(sc.refGapOpen() + 2 * sc.refGapExtend(), dr.sink()[0].pen);
				assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
				assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
				cerr << dr.sink()[0].topf << ", " << dr.sink()[0].botf << endl;
				assert_eq(1, dr.sink().nelt());
				last_topf = dr.sink()[0].topf;
				last_botf = dr.sink()[0].botf;
			}
		}
    }

	// Query is longer than ftab and matches exactly once with one read gap,
	// one ref gap, and one mismatch
	{
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
			// Set up the read
			//           Ref: CATGTCAGCT   ATATAGCGCGCT  CGCATCATTTTGTGTGTAAACCA
			//                ||||||||||   ||||||||||||   |||||| |||||||||||||
			BTDnaString seq ("CATGTCAGCT""GATATAGCGCGCT" "GCATCAATTTGTGTGTAAAC", true);
			//                0123456789  0123456789012   34567890123456789012
			BTString    qual("ABCDEFGHIa""bcdefghiACDEF" "GHIabcdefghijkABCDEF");
			for(size_t j = 0; j < seq.length(); j++) {
				// Assume left-to-right
				size_t beg = j;
				size_t end = j + Ebwt::default_ftabChars;
				// Mismatch penalty is 3, so we have to skip starting
				// points that are within 2 from the mismatch
				if((i > 0 && j > 0) || j == seq.length()-1) {
					// Right-to-left
					if(beg < Ebwt::default_ftabChars) {
						beg = 0;
					} else {
						beg -= Ebwt::default_ftabChars;
					}
					end -= Ebwt::default_ftabChars;
				}
				if(beg <= 10 && end >= 10) {
					continue;
				}
				if(beg <= 22 && end >= 22) {
					continue;
				}
				if(beg <= 30 && end >= 30) {
					continue;
				}
				cerr << "Test " << (++testnum) << endl;
				cerr << "  Query matches once with a read gap of length 1" << endl;
				DescentMetrics mets;
				PerReadMetrics prm;
				DescentDriver dr;
				
				dr.initRead(
					Read("test", seq.toZBuf(), qual.toZBuf()),
					false, // nofw
					false, // norc
					-50,   // minsc
					50);   // maxpen
				
				// Set up the DescentConfig
				DescentConfig conf;
				// Changed 
				conf.cons.init(1, 0.5);
				conf.expol = DESC_EX_NONE;
				
				// Set up the search roots
				dr.addRoot(
					conf,   // DescentConfig
					j,      // 5' offset into read of root
					i == 0, // left-to-right?
					true,   // forward?
					1,      // landing
					0.0f);  // root priority
				
				// Do the search
				Scoring sc = Scoring::base1();
				dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
				
				// Confirm that an exact-matching alignment was found
				assert_eq(1, dr.sink().nrange());
				assert_eq(sc.readGapOpen() + sc.refGapOpen() + sc.mm((int)'d' - 33), dr.sink()[0].pen);
				assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
				assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
				cerr << dr.sink()[0].topf << ", " << dr.sink()[0].botf << endl;
				assert_eq(1, dr.sink().nelt());
				last_topf = dr.sink()[0].topf;
				last_botf = dr.sink()[0].botf;
			}
		}
    }

	delete ebwts.first;
	delete ebwts.second;
	
	//  Ref CATGTCAGCT-ATATAGCGCGCTCGCATCATTTTGTGTGTAAAC
	//      |||||||||| |||||||||||| |||||| |||||||||||||
	//  Rd  CATGTCAGCTGATATAGCGCGCT-GCATCAATTTGTGTGTAAAC
	strs.clear();
    strs.push_back(string("CATGTCAGCTATATAGCGCGCTCGCATCATTTTGTGTGTAAAC"
                          "NNNNNNNNNN"
                          "CATGTCAGCTGATATAGCGCGCTCGCATCATTTTGTGTGTAAAC" // same but without first ref gap
                          "N"
                          "CATGTCAGCTATATAGCGCGCTGCATCATTTTGTGTGTAAAC" // same but without first read gap
                          "N"
                          "CATGTCAGCTATATAGCGCGCTCGCATCAATTTGTGTGTAAAC" // same but without first mismatch
                          "N"
                          "CATGTCAGCTGATATAGCGCGCTGCATCAATTTGTGTGTAAAC" // Exact match for read
						  ));
	ebwts = Ebwt::fromStrings<SString<char> >(
		strs,
		packed,
		0,
		REF_READ_REVERSE,
		Ebwt::default_bigEndian,
		Ebwt::default_lineRate,
		Ebwt::default_offRate,
		Ebwt::default_ftabChars,
		".aligner_seed2.cpp.tmp",
		Ebwt::default_useBlockwise,
		Ebwt::default_bmax,
		Ebwt::default_bmaxMultSqrt,
		Ebwt::default_bmaxDivN,
		Ebwt::default_dcv,
		Ebwt::default_seed,
		false,  // verbose
		false,  // autoMem
		false); // sanity
    
    ebwts.first->loadIntoMemory (0, -1, true, true, true, true, false);
    ebwts.second->loadIntoMemory(0,  1, true, true, true, true, false);

	// Query is longer than ftab and matches exactly once with one read gap,
	// one ref gap, and one mismatch
	{
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
			// Set up the read
			//           Ref: CATGTCAGCT   ATATAGCGCGCT  CGCATCATTTTGTGTGTAAACCA
			//                ||||||||||   ||||||||||||   |||||| |||||||||||||
			BTDnaString seq ("CATGTCAGCT""GATATAGCGCGCT" "GCATCAATTTGTGTGTAAAC", true);
			//                0123456789  0123456789012   34567890123456789012
			BTString    qual("ABCDEFGHIa""bcdefghiACDEF" "GHIabcdefghijkABCDEF");
			for(size_t j = 0; j < seq.length(); j++) {
				// Assume left-to-right
				size_t beg = j;
				size_t end = j + Ebwt::default_ftabChars;
				// Mismatch penalty is 3, so we have to skip starting
				// points that are within 2 from the mismatch
				if((i > 0 && j > 0) || j == seq.length()-1) {
					// Right-to-left
					if(beg < Ebwt::default_ftabChars) {
						beg = 0;
					} else {
						beg -= Ebwt::default_ftabChars;
					}
					end -= Ebwt::default_ftabChars;
				}
				if(beg <= 10 && end >= 10) {
					continue;
				}
				if(beg <= 22 && end >= 22) {
					continue;
				}
				if(beg <= 30 && end >= 30) {
					continue;
				}
				cerr << "Test " << (++testnum) << endl;
				cerr << "  Query matches once with a read gap of length 1" << endl;
				DescentMetrics mets;
				PerReadMetrics prm;
				DescentDriver dr;
				
				dr.initRead(
					Read("test", seq.toZBuf(), qual.toZBuf()),
					false, // nofw
					false, // norc
					-50,   // minsc
					50);   // maxpen
				
				// Set up the DescentConfig
				DescentConfig conf;
				// Changed 
				conf.cons.init(1, 0.5);
				conf.expol = DESC_EX_NONE;
				
				// Set up the search roots
				dr.addRoot(
					conf,   // DescentConfig
					j,      // 5' offset into read of root
					i == 0, // left-to-right?
					true,   // forward?
					1,      // landing
					0.0f);  // root priority
				
				// Do the search
				Scoring sc = Scoring::base1();
				dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
				
				// Confirm that an exact-matching alignment was found
				assert_eq(5, dr.sink().nrange());
				assert_eq(0, dr.sink()[0].pen);
				assert_eq(min(sc.readGapOpen(), sc.refGapOpen()) + sc.mm((int)'d' - 33), dr.sink()[1].pen);
				assert_eq(max(sc.readGapOpen(), sc.refGapOpen()) + sc.mm((int)'d' - 33), dr.sink()[2].pen);
				assert_eq(sc.readGapOpen() + sc.refGapOpen(), dr.sink()[3].pen);
				assert_eq(sc.readGapOpen() + sc.refGapOpen() + sc.mm((int)'d' - 33), dr.sink()[4].pen);
				assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
				assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
				cerr << dr.sink()[0].topf << ", " << dr.sink()[0].botf << endl;
				assert_eq(5, dr.sink().nelt());
				last_topf = dr.sink()[0].topf;
				last_botf = dr.sink()[0].botf;
			}
		}
    }

	// Query is longer than ftab and matches exactly once with one read gap,
	// one ref gap, one mismatch, and one N
	{
		size_t last_topf = std::numeric_limits<size_t>::max();
		size_t last_botf = std::numeric_limits<size_t>::max();
		for(int i = 0; i < 2; i++) {
			// Set up the read
			//           Ref: CATGTCAGCT   ATATAGCGCGCT  CGCATCATTTTGTGTGTAAACCA
			//                ||||||||||   ||||||||||||   |||||| |||||| ||||||
			BTDnaString seq ("CATGTCAGCT""GATATAGCGCGCT" "GCATCAATTTGTGNGTAAAC", true);
			//                0123456789  0123456789012   34567890123456789012
			BTString    qual("ABCDEFGHIa""bcdefghiACDEF" "GHIabcdefghijkABCDEF");
			for(size_t j = 0; j < seq.length(); j++) {
				// Assume left-to-right
				size_t beg = j;
				size_t end = j + Ebwt::default_ftabChars;
				// Mismatch penalty is 3, so we have to skip starting
				// points that are within 2 from the mismatch
				if((i > 0 && j > 0) || j == seq.length()-1) {
					// Right-to-left
					if(beg < Ebwt::default_ftabChars) {
						beg = 0;
					} else {
						beg -= Ebwt::default_ftabChars;
					}
					end -= Ebwt::default_ftabChars;
				}
				if(beg <= 10 && end >= 10) {
					continue;
				}
				if(beg <= 22 && end >= 22) {
					continue;
				}
				if(beg <= 30 && end >= 30) {
					continue;
				}
				if(beg <= 36 && end >= 36) {
					continue;
				}
				cerr << "Test " << (++testnum) << endl;
				cerr << "  Query matches with various patterns of gaps, mismatches and Ns" << endl;
				DescentMetrics mets;
				PerReadMetrics prm;
				DescentDriver dr;
				
				dr.initRead(
					Read("test", seq.toZBuf(), qual.toZBuf()),
					false, // nofw
					false, // norc
					-50,   // minsc
					50);   // maxpen
				
				// Set up the DescentConfig
				DescentConfig conf;
				// Changed 
				conf.cons.init(1, 0.5);
				conf.expol = DESC_EX_NONE;
				
				// Set up the search roots
				dr.addRoot(
					conf,   // DescentConfig
					j,      // 5' offset into read of root
					i == 0, // left-to-right?
					true,   // forward?
					1,      // landing
					0.0f);  // root priority
				
				// Do the search
				Scoring sc = Scoring::base1();
				sc.setNPen(COST_MODEL_CONSTANT, 1);
				dr.go(sc, *ebwts.first, *ebwts.second, mets, prm);
				
				// Confirm that an exact-matching alignment was found
				assert_eq(5, dr.sink().nrange());
				assert_eq(sc.n(40), dr.sink()[0].pen);
				assert_eq(sc.n(40) + min(sc.readGapOpen(), sc.refGapOpen()) + sc.mm((int)'d' - 33), dr.sink()[1].pen);
				assert_eq(sc.n(40) + max(sc.readGapOpen(), sc.refGapOpen()) + sc.mm((int)'d' - 33), dr.sink()[2].pen);
				assert_eq(sc.n(40) + sc.readGapOpen() + sc.refGapOpen(), dr.sink()[3].pen);
				assert_eq(sc.n(40) + sc.readGapOpen() + sc.refGapOpen() + sc.mm((int)'d' - 33), dr.sink()[4].pen);
				assert(last_topf == std::numeric_limits<size_t>::max() || last_topf == dr.sink()[0].topf);
				assert(last_botf == std::numeric_limits<size_t>::max() || last_botf == dr.sink()[0].botf);
				cerr << dr.sink()[0].topf << ", " << dr.sink()[0].botf << endl;
				assert_eq(5, dr.sink().nelt());
				last_topf = dr.sink()[0].topf;
				last_botf = dr.sink()[0].botf;
			}
		}
    }

    delete ebwts.first;
    delete ebwts.second;
	
	cerr << "DONE" << endl;
}
#endif