File: dan.html

package info (click to toggle)
emboss 5.0.0-7
links: PTS, VCS
area: main
in suites: lenny
size: 81,332 kB
ctags: 25,201
sloc: ansic: 229,873; java: 29,051; sh: 10,636; perl: 8,714; makefile: 1,227; csh: 520; asm: 351; pascal: 237; xml: 94; modula3: 8
file content (839 lines) | stat: -rw-r--r-- 30,967 bytes
<HTML>

<HEAD>
  <TITLE>
  EMBOSS: dan
  </TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">

<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
dan
</font></b>
</td></tr>
</table>
<br>&nbsp;
<p>


<H2>
    Function
</H2>
Calculates DNA RNA/DNA melting temperature
<H2>
    Description
</H2>

Dan calculates the melting temperature (Tm) and the percent G+C of a
nucleic acid sequence (optionally plotting them).  For the Melting
temperature profile, free energy values calculated from nearest neighbor
thermodynamics are used (Breslauer et al.  Proc.  Natl.  Acad.  Sci. 
USA 83, 3746-3750 and Baldino et al.  Methods in Enzymol.  168,
761-777). 

<H2>
    Usage
</H2>
<b>Here is a sample session with dan</b>
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>dan </b>
Calculates DNA RNA/DNA melting temperature
Input nucleotide sequence(s): <b>tembl:x13776</b>
Enter window size [20]: <b></b>
Enter Shift Increment [1]: <b></b>
Enter DNA concentration (nM) [50.]: <b></b>
Enter salt concentration (mM) [50.]: <b></b>
Output report [x13776.dan]: <b></b>

</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>
<p>
<b>Example 2</b>
<p>
An example of producing a plot of Tm: 
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>dan -plot -graph cps </b>
Calculates DNA RNA/DNA melting temperature
Input nucleotide sequence(s): <b>tembl:x13776</b>
Enter window size [20]: <b></b>
Enter Shift Increment [1]: <b></b>
Enter DNA concentration (nM) [50.]: <b></b>
Enter salt concentration (mM) [50.]: <b></b>
Enter minimum temperature [55.]: <b></b>

Created dan.ps

</pre></td></tr></table><p>
<p>
<a href="#output.2">Go to the output files for this example</a><p><p>


<H2>
    Command line arguments
</H2>

<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
   Standard (Mandatory) qualifiers (* if not always prompted):
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
   -windowsize         integer    [20] The values of melting point and other
                                  thermodynamic properties of the sequence are
                                  determined by taking a short length of
                                  sequence known as a window and determining
                                  the properties of the sequence in that
                                  window. The window is incrementally moved
                                  along the sequence with the properties being
                                  calculated at each new position. (Integer
                                  from 1 to 100)
   -shiftincrement     integer    [1] This is the amount by which the window
                                  is moved at each increment in order to find
                                  the melting point and other properties along
                                  the sequence. (Integer 1 or more)
   -dnaconc            float      [50.] Enter DNA concentration (nM) (Number
                                  from 1.000 to 100000.000)
   -saltconc           float      [50.] Enter salt concentration (mM) (Number
                                  from 1.000 to 1000.000)
*  -mintemp            float      [55.] Enter a minimum value for the
                                  temperature scale (y-axis) of the plot.
                                  (Number from 0.000 to 150.000)
*  -graph              xygraph    [$EMBOSS_GRAPHICS value, or x11] Graph type
                                  (ps, hpgl, hp7470, hp7580, meta, cps, x11,
                                  tekt, tek, none, data, xterm, png, gif)
*  -outfile            report     [*.dan] If a plot is not being produced then
                                  data on the melting point etc. in each
                                  window along the sequence is output to the
                                  file.

   Additional (Optional) qualifiers (* if not always prompted):
   -product            toggle     This prompts for percent formamide, percent
                                  of mismatches allowed and product length.
*  -formamide          float      [0.] This specifies the percent formamide to
                                  be used in calculations (it is ignored
                                  unless -product is used). (Number from 0.000
                                  to 100.000)
*  -mismatch           float      [0.] This specifies the percent mismatch to
                                  be used in calculations (it is ignored
                                  unless -product is used). (Number from 0.000
                                  to 100.000)
*  -prodlen            integer    [Window size (20)] This specifies the
                                  product length to be used in calculations
                                  (it is ignored unless -product is used).
                                  (Any integer value)
   -thermo             toggle     Output the DeltaG, DeltaH and DeltaS values
                                  of the sequence windows to the output data
                                  file.
*  -temperature        float      [25.] If -thermo has been specified then
                                  this specifies the temperature at which to
                                  calculate the DeltaG, DeltaH and DeltaS
                                  values. (Number from 0.000 to 100.000)

   Advanced (Unprompted) qualifiers:
   -rna                boolean    This specifies that the sequence is an RNA
                                  sequence and not a DNA sequence.
   -plot               toggle     If this is not specified then the file of
                                  output data is produced, else a plot of the
                                  melting point along the sequence is
                                  produced.

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-graph" associated qualifiers
   -gprompt            boolean    Graph prompting
   -gdesc              string     Graph description
   -gtitle             string     Graph title
   -gsubtitle          string     Graph subtitle
   -gxtitle            string     Graph x axis title
   -gytitle            string     Graph y axis title
   -goutfile           string     Output file for non interactive displays
   -gdirectory         string     Output directory

   "-outfile" associated qualifiers
   -rformat            string     Report format
   -rname              string     Base file name
   -rextension         string     File name extension
   -rdirectory         string     Output directory
   -raccshow           boolean    Show accession number in the report
   -rdesshow           boolean    Show description in the report
   -rscoreshow         boolean    Show the score in the report
   -rusashow           boolean    Show the full USA in the report
   -rmaxall            integer    Maximum total hits to report
   -rmaxseq            integer    Maximum hits to report for one sequence

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Standard (Mandatory) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>

<tr>
<td>[-sequence]<br>(Parameter 1)</td>
<td>Nucleotide sequence(s) filename and optional format, or reference (input USA)</td>
<td>Readable sequence(s)</td>
<td><b>Required</b></td>
</tr>

<tr>
<td>-windowsize</td>
<td>The values of melting point and other thermodynamic properties of the sequence are determined by taking a short length of sequence known as a window and determining the properties of the sequence in that window. The window is incrementally moved along the sequence with the properties being calculated at each new position.</td>
<td>Integer from 1 to 100</td>
<td>20</td>
</tr>

<tr>
<td>-shiftincrement</td>
<td>This is the amount by which the window is moved at each increment in order to find the melting point and other properties along the sequence.</td>
<td>Integer 1 or more</td>
<td>1</td>
</tr>

<tr>
<td>-dnaconc</td>
<td>Enter DNA concentration (nM)</td>
<td>Number from 1.000 to 100000.000</td>
<td>50.</td>
</tr>

<tr>
<td>-saltconc</td>
<td>Enter salt concentration (mM)</td>
<td>Number from 1.000 to 1000.000</td>
<td>50.</td>
</tr>

<tr>
<td>-mintemp</td>
<td>Enter a minimum value for the temperature scale (y-axis) of the plot.</td>
<td>Number from 0.000 to 150.000</td>
<td>55.</td>
</tr>

<tr>
<td>-graph</td>
<td>Graph type</td>
<td>EMBOSS has a list of known devices, including ps, hpgl, hp7470, hp7580, meta, cps, x11, tekt, tek, none, data, xterm, png, gif</td>
<td><i>EMBOSS_GRAPHICS</i> value, or x11</td>
</tr>

<tr>
<td>-outfile</td>
<td>If a plot is not being produced then data on the melting point etc. in each window along the sequence is output to the file.</td>
<td>Report output file</td>
<td><i>&lt;*&gt;</i>.dan</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Additional (Optional) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>

<tr>
<td>-product</td>
<td>This prompts for percent formamide, percent of mismatches allowed and product length.</td>
<td>Toggle value Yes/No</td>
<td>No</td>
</tr>

<tr>
<td>-formamide</td>
<td>This specifies the percent formamide to be used in calculations (it is ignored unless -product is used).</td>
<td>Number from 0.000 to 100.000</td>
<td>0.</td>
</tr>

<tr>
<td>-mismatch</td>
<td>This specifies the percent mismatch to be used in calculations (it is ignored unless -product is used).</td>
<td>Number from 0.000 to 100.000</td>
<td>0.</td>
</tr>

<tr>
<td>-prodlen</td>
<td>This specifies the product length to be used in calculations (it is ignored unless -product is used).</td>
<td>Any integer value</td>
<td>Window size (20)</td>
</tr>

<tr>
<td>-thermo</td>
<td>Output the DeltaG, DeltaH and DeltaS values of the sequence windows to the output data file.</td>
<td>Toggle value Yes/No</td>
<td>No</td>
</tr>

<tr>
<td>-temperature</td>
<td>If -thermo has been specified then this specifies the temperature at which to calculate the DeltaG, DeltaH and DeltaS values.</td>
<td>Number from 0.000 to 100.000</td>
<td>25.</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Advanced (Unprompted) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>

<tr>
<td>-rna</td>
<td>This specifies that the sequence is an RNA sequence and not a DNA sequence.</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>

<tr>
<td>-plot</td>
<td>If this is not specified then the file of output data is produced, else a plot of the melting point along the sequence is produced.</td>
<td>Toggle value Yes/No</td>
<td>No</td>
</tr>

</table>

<H2>
    Input file format
</H2>

Any DNA or RNA sequence USA. 

<p>

<a name="input.1"></a>
<h3>Input files for usage example </h3>

'tembl:x13776' is a sequence entry in the example nucleic acid database 'tembl'
<p>
<p><h3>Database entry: tembl:x13776</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
ID   X13776; SV 1; linear; genomic DNA; STD; PRO; 2167 BP.
XX
AC   X13776; M43175;
XX
DT   19-APR-1989 (Rel. 19, Created)
DT   14-NOV-2006 (Rel. 89, Last updated, Version 24)
XX
DE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW   aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS   Pseudomonas aeruginosa
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
OC   Pseudomonadaceae; Pseudomonas.
XX
RN   [1]
RP   1167-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN   [2]
RP   1167-2167
RX   DOI; 10.1016/0014-5793(89)80249-2.
RX   PUBMED; 2495988.
RA   Lowe N., Rice P.M., Drew R.E.;
RT   "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomonas
RT   aeruginosa";
RL   FEBS Lett. 246(1-2):39-43(1989).
XX
RN   [3]
RP   1-1292
RX   PUBMED; 1907262.
RA   Wilson S., Drew R.;
RT   "Cloning and DNA seqence of amiC, a new gene regulating expression of the
RT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT   product.";
RL   J. Bacteriol. 173(16):4914-4921(1991).
XX
RN   [4]
RP   1-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR   GOA; Q51417.
DR   UniProtKB/Swiss-Prot; Q51417; AMIS_PSEAE.
XX


<font color=red>  [Part of this file has been deleted for brevity]</font>

FT                   /replace=""
FT                   /note="ClaI fragment deleted in pSW36,  constitutive
FT                   phenotype"
FT   misc_feature    1
FT                   /note="last base of an XhoI site"
FT   misc_feature    648..653
FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 causes
FT                   constitutive expression of amiE"
FT   conflict        1281
FT                   /replace="g"
FT                   /citation=[3]
XX
SQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        60
     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       120
     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       180
     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       240
     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       300
     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       360
     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       420
     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       480
     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       540
     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       600
     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       660
     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       720
     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       780
     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       840
     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       900
     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       960
     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      1020
     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      1080
     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      1140
     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      1200
     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      1260
     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      1320
     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      1380
     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      1440
     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      1500
     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      1560
     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      1620
     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      1680
     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      1740
     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      1800
     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      1860
     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      1920
     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      1980
     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      2040
     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      2100
     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      2160
     cctcgag                                                                2167
//
</pre>
</td></tr></table><p>


<H2>
    Output file format
</H2>

If a plot is not being produced, dan reports the sequence of each
oligomer window, its melting temperature under the specified conditions
and its GC content. 

<p>
<p>

The output is a standard EMBOSS report file. 

<p>

The results can be output in one of several styles by using the
command-line qualifier <b>-rformat xxx</b>, where 'xxx' is replaced by
the name of the required format.  The available format names are: embl,
genbank, gff, pir, swiss, trace, listfile, dbmotif, diffseq, excel,
feattable, motif, regions, seqtable, simple, srs, table, tagseq

<p>

See:
<A href="http://emboss.sf.net/docs/themes/ReportFormats.html">
http://emboss.sf.net/docs/themes/ReportFormats.html</A>
for further information on report formats.

<p>
<p>

By default <b>dan</b> writes a 'seqtable' report file.

<p>

<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: x13776.dan</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
########################################
# Program: dan
# Rundate: Sun 15 Jul 2007 12:00:00
# Commandline: dan
#    -sequence tembl:x13776
# Report_format: seqtable
# Report_file: x13776.dan
########################################

#=======================================
#
# Sequence: X13776     from: 1   to: 2167
# HitCount: 2148
#=======================================

  Start     End     Tm     GC DeltaG DeltaH DeltaS TmProd Sequence
      1      20   64.9   70.0      .      .      .      . ggtaccgctggccgagcatc
      2      21   63.7   65.0      .      .      .      . gtaccgctggccgagcatct
      3      22   63.7   65.0      .      .      .      . taccgctggccgagcatctg
      4      23   66.9   70.0      .      .      .      . accgctggccgagcatctgc
      5      24   66.7   70.0      .      .      .      . ccgctggccgagcatctgct
      6      25   65.5   70.0      .      .      .      . cgctggccgagcatctgctc
      7      26   65.5   70.0      .      .      .      . gctggccgagcatctgctcg
      8      27   63.7   65.0      .      .      .      . ctggccgagcatctgctcga
      9      28   62.9   60.0      .      .      .      . tggccgagcatctgctcgat
     10      29   62.6   65.0      .      .      .      . ggccgagcatctgctcgatc
     11      30   61.7   60.0      .      .      .      . gccgagcatctgctcgatca
     12      31   60.2   60.0      .      .      .      . ccgagcatctgctcgatcac
     13      32   60.2   60.0      .      .      .      . cgagcatctgctcgatcacc
     14      33   59.0   55.0      .      .      .      . gagcatctgctcgatcacca
     15      34   59.2   55.0      .      .      .      . agcatctgctcgatcaccac
     16      35   60.4   60.0      .      .      .      . gcatctgctcgatcaccacc
     17      36   58.9   55.0      .      .      .      . catctgctcgatcaccacca
     18      37   58.6   55.0      .      .      .      . atctgctcgatcaccaccag
     19      38   61.3   60.0      .      .      .      . tctgctcgatcaccaccagc
     20      39   62.4   65.0      .      .      .      . ctgctcgatcaccaccagcc
     21      40   63.9   65.0      .      .      .      . tgctcgatcaccaccagccg
     22      41   64.9   70.0      .      .      .      . gctcgatcaccaccagccgg
     23      42   64.3   70.0      .      .      .      . ctcgatcaccaccagccggg
     24      43   66.1   70.0      .      .      .      . tcgatcaccaccagccgggc
     25      44   67.5   75.0      .      .      .      . cgatcaccaccagccgggcg
     26      45   66.1   70.0      .      .      .      . gatcaccaccagccgggcga
     27      46   66.3   70.0      .      .      .      . atcaccaccagccgggcgac
     28      47   68.6   75.0      .      .      .      . tcaccaccagccgggcgacg
     29      48   69.8   80.0      .      .      .      . caccaccagccgggcgacgg
     30      49   70.7   80.0      .      .      .      . accaccagccgggcgacggg
     31      50   70.5   80.0      .      .      .      . ccaccagccgggcgacggga
     32      51   68.6   75.0      .      .      .      . caccagccgggcgacgggaa
     33      52   68.6   75.0      .      .      .      . accagccgggcgacgggaac
     34      53   68.4   75.0      .      .      .      . ccagccgggcgacgggaact


<font color=red>  [Part of this file has been deleted for brevity]</font>

   2101    2120   69.9   80.0      .      .      .      . ggccggagcgctgaccctgc
   2102    2121   68.7   75.0      .      .      .      . gccggagcgctgaccctgct
   2103    2122   65.5   70.0      .      .      .      . ccggagcgctgaccctgcta
   2104    2123   63.5   65.0      .      .      .      . cggagcgctgaccctgctat
   2105    2124   61.3   60.0      .      .      .      . ggagcgctgaccctgctatt
   2106    2125   60.1   60.0      .      .      .      . gagcgctgaccctgctattc
   2107    2126   61.7   60.0      .      .      .      . agcgctgaccctgctattcg
   2108    2127   63.4   65.0      .      .      .      . gcgctgaccctgctattcgc
   2109    2128   61.7   60.0      .      .      .      . cgctgaccctgctattcgct
   2110    2129   59.5   55.0      .      .      .      . gctgaccctgctattcgctt
   2111    2130   57.1   50.0      .      .      .      . ctgaccctgctattcgcttt
   2112    2131   56.4   45.0      .      .      .      . tgaccctgctattcgctttt
   2113    2132   54.7   45.0      .      .      .      . gaccctgctattcgctttta
   2114    2133   55.0   45.0      .      .      .      . accctgctattcgcttttac
   2115    2134   55.9   50.0      .      .      .      . ccctgctattcgcttttacc
   2116    2135   54.7   45.0      .      .      .      . cctgctattcgcttttacct
   2117    2136   52.0   40.0      .      .      .      . ctgctattcgcttttaccta
   2118    2137   51.2   35.0      .      .      .      . tgctattcgcttttacctat
   2119    2138   50.9   40.0      .      .      .      . gctattcgcttttacctatc
   2120    2139   49.0   35.0      .      .      .      . ctattcgcttttacctatct
   2121    2140   49.3   35.0      .      .      .      . tattcgcttttacctatctg
   2122    2141   51.1   35.0      .      .      .      . attcgcttttacctatctgt
   2123    2142   52.2   40.0      .      .      .      . ttcgcttttacctatctgtg
   2124    2143   54.0   45.0      .      .      .      . tcgcttttacctatctgtgg
   2125    2144   55.2   50.0      .      .      .      . cgcttttacctatctgtggg
   2126    2145   53.9   45.0      .      .      .      . gcttttacctatctgtgggt
   2127    2146   52.3   45.0      .      .      .      . cttttacctatctgtgggtg
   2128    2147   53.5   45.0      .      .      .      . ttttacctatctgtgggtgg
   2129    2148   56.0   50.0      .      .      .      . tttacctatctgtgggtggc
   2130    2149   57.8   55.0      .      .      .      . ttacctatctgtgggtggcc
   2131    2150   60.1   60.0      .      .      .      . tacctatctgtgggtggccg
   2132    2151   63.4   65.0      .      .      .      . acctatctgtgggtggccgc
   2133    2152   64.3   70.0      .      .      .      . cctatctgtgggtggccgcc
   2134    2153   63.4   65.0      .      .      .      . ctatctgtgggtggccgcca
   2135    2154   62.7   60.0      .      .      .      . tatctgtgggtggccgccaa
   2136    2155   64.5   65.0      .      .      .      . atctgtgggtggccgccaac
   2137    2156   66.5   70.0      .      .      .      . tctgtgggtggccgccaacc
   2138    2157   66.8   70.0      .      .      .      . ctgtgggtggccgccaacca
   2139    2158   66.8   70.0      .      .      .      . tgtgggtggccgccaaccag
   2140    2159   66.8   70.0      .      .      .      . gtgggtggccgccaaccagt
   2141    2160   65.9   65.0      .      .      .      . tgggtggccgccaaccagtt
   2142    2161   65.6   70.0      .      .      .      . gggtggccgccaaccagttc
   2143    2162   65.6   70.0      .      .      .      . ggtggccgccaaccagttcc
   2144    2163   64.4   65.0      .      .      .      . gtggccgccaaccagttcct
   2145    2164   64.1   65.0      .      .      .      . tggccgccaaccagttcctc
   2146    2165   65.4   70.0      .      .      .      . ggccgccaaccagttcctcg
   2147    2166   64.2   65.0      .      .      .      . gccgccaaccagttcctcga
   2148    2167   62.4   65.0      .      .      .      . ccgccaaccagttcctcgag

#---------------------------------------
#---------------------------------------
</pre>
</td></tr></table><p>

<a name="output.2"></a>
<h3>Output files for usage example 2</h3>
<p><h3>Graphics File: dan.ps</h3>
<p><img src="dan.2.dan.gif" alt="[dan results]">
<p><h3>File: x13776.dan</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
</pre>
</td></tr></table><p>
<p>

The header information contains details of the program, date and sequence

<p>
Subsequent lines contain columns of data for each window into the
sequence as it is moved along, giving:

<p>
<ul>
<li> The start postion of the window
<li> The end position of the window
<li> The melting temperature of the window
<li> The percentage C+G of the window
<li> The sequence of the window
</ul>


<p>

If the qualifier '-product' is used to make the program prompt for
percent formamide percent of mismatches allowed and product length, then
the output includes the melting temperature of the specified product.

<p>

If the qualifier '-thermo' is gived then the DeltaG, DeltaH and DeltaS
of the sequence in the window is also output. 

<H2>
    Data files
</H2>


The EMBOSS data files "Edna.melt" and "Erna.melt" are used to read in the
entropy/enthalpy/energy data for DNA and RNA respectively. 

<p>
EMBOSS data files are distributed with the application and stored
in the standard EMBOSS data directory, which is defined
by the EMBOSS environment variable EMBOSS_DATA.

<p>

To see the available EMBOSS data files, run:
<p>
<pre>
% embossdata -showall
</pre>
<p>
To fetch one of the data files (for example 'Exxx.dat') into your
current directory for you to inspect or modify, run:

<pre>

% embossdata -fetch -file Exxx.dat

</pre>
<p>

Users can provide their own data files in their own directories.
Project specific files can be put in the current directory, or for
tidier directory listings in a subdirectory called
".embossdata". Files for all EMBOSS runs can be put in the user's home
directory, or again in a subdirectory called ".embossdata".

<p>
The directories are searched in the following order:

<ul>
   <li> . (your current directory)
   <li> .embossdata (under your current directory)
   <li> ~/ (your home directory)
   <li> ~/.embossdata
</ul>
<p>

<H2>
    Notes
</H2>

None.


<H2>
    References
</H2>

<ol>

<li>
Breslauer, K.J., Frank, R., Blocker, H., and Marky, L.A.  (1986). 
"Predicting DNA Duplex Stability from the Base Sequence." Proceedings of
the National Academy of Sciences USA 83, 3746-3750. 

<li>
Baldino, M., Jr.  (1989).  "High Resolution In Situ Hybridization
Histochemistry." In Methods in Enzymology, (P.M.  Conn, ed.), 168,
761-777, Academic Press, San Diego, California, USA. 

</ol>

<H2>
    Warnings
</H2>


RNA sequences must be submited to this application with the '-rna'
qualifier on the command line, otherwise the sequence will be assumed to
be DNA. 

<H2>
    Diagnostic Error Messages
</H2>

None.

<H2>
    Exit status
</H2>


0 if successful. 

<H2>
    Known bugs
</H2>

None.

<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th><th>Description</th></tr>
<tr>
<td><a href="banana.html">banana</a></td>
<td>Bending and curvature plot in B-DNA</td>
</tr>

<tr>
<td><a href="btwisted.html">btwisted</a></td>
<td>Calculates the twisting in a B-DNA sequence</td>
</tr>

<tr>
<td><a href="chaos.html">chaos</a></td>
<td>Create a chaos game representation plot for a sequence</td>
</tr>

<tr>
<td><a href="compseq.html">compseq</a></td>
<td>Count composition of dimer/trimer/etc words in a sequence</td>
</tr>

<tr>
<td><a href="freak.html">freak</a></td>
<td>Residue/base frequency table or plot</td>
</tr>

<tr>
<td><a href="isochore.html">isochore</a></td>
<td>Plots isochores in large DNA sequences</td>
</tr>

<tr>
<td><a href="sirna.html">sirna</a></td>
<td>Finds siRNA duplexes in mRNA</td>
</tr>

<tr>
<td><a href="wordcount.html">wordcount</a></td>
<td>Counts words of a specified size in a DNA sequence</td>
</tr>

</table>

<H2>
    Author(s)
</H2>

This program was originally included in EGCG under the names "MELT"
and "MELTPLOT", written by 
Rodrigo Lopez (rls&nbsp;&copy;&nbsp;ebi.ac.uk)
<br>
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK


<p>
This application was written by 
Alan Bleasby (ajb&nbsp;&copy;&nbsp;ebi.ac.uk)
<br>
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK



<H2>
    History
</H2>


Written (1999) - Alan Bleasby

<H2>
    Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.

<H2>
    Comments
</H2>
None

</BODY>
</HTML>