File: descseq.html

package info (click to toggle)
emboss 5.0.0-7
links: PTS, VCS
area: main
in suites: lenny
size: 81,332 kB
ctags: 25,201
sloc: ansic: 229,873; java: 29,051; sh: 10,636; perl: 8,714; makefile: 1,227; csh: 520; asm: 351; pascal: 237; xml: 94; modula3: 8
file content (512 lines) | stat: -rw-r--r-- 12,427 bytes
<HTML>

<HEAD>
  <TITLE>
  EMBOSS: descseq
  </TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">

<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
descseq
</font></b>
</td></tr>
</table>
<br>&nbsp;
<p>



<H2>
    Function
</H2>
Alter the name or description of a sequence
<H2>
    Description
</H2>

Most sequence formats allow, at the very minimum, a name for the
sequence and some comments to be stored in the sequence file.

<p>

Rather than using an editor to alter the name or the comments,
<b>descseq</b> allows you to simply change them and write out a new file
with the changes in and the sequence left unaltered. 

<p>

The default action is to replace the existing name or description with
your new one, but by using the qualifier '-append' what you enter is
appended to the existing name or description. 

<p>

Note that if you append to a description, no space is inserted by
default bewteen the existing description and your appended text. You
have to put in a space yourself if you require one. 

<H2>
    Usage
</H2>
<b>Here is a sample session with descseq</b>
<p>
Set the name of a sequence to "myclone23"  
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>descseq -seq dna.text -out clone23.seq -name "myclone23" </b>
Alter the name or description of a sequence.

</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>
<p>
<b>Example 2</b>
<p>
Set the description of a sequence to "This is my clone number 244"  
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>descseq -seq dna.text -out xy24.seq -desc "This is my clone number 244" </b>
Alter the name or description of a sequence.

</pre></td></tr></table><p>
<p>
<a href="#output.2">Go to the output files for this example</a><p><p>
<p>
<b>Example 3</b>
<p>
Append some text to the description of a sequence 
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>descseq -seq dna.text -out est4.seq -desc " (submitted)" -append </b>
Alter the name or description of a sequence.

</pre></td></tr></table><p>
<p>
<a href="#output.3">Go to the output files for this example</a><p><p>

<H2>
    Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   (Gapped) sequence filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqout     [<sequence>.<format>] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers:
   -name               string     Name of the sequence (Any string is
                                  accepted)
   -description        string     Description of the sequence (Any string is
                                  accepted)

   Advanced (Unprompted) qualifiers:
   -append             boolean    [N] This allows you to append the name or
                                  description you have given on to the end of
                                  the existing name or description of the
                                  sequence.

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Standard (Mandatory) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>

<tr>
<td>[-sequence]<br>(Parameter 1)</td>
<td>(Gapped) sequence filename and optional format, or reference (input USA)</td>
<td>Readable sequence</td>
<td><b>Required</b></td>
</tr>

<tr>
<td>[-outseq]<br>(Parameter 2)</td>
<td>Sequence filename and optional format (output USA)</td>
<td>Writeable sequence</td>
<td><i>&lt;*&gt;</i>.<i>format</i></td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Additional (Optional) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>

<tr>
<td>-name</td>
<td>Name of the sequence</td>
<td>Any string is accepted</td>
<td><i>An empty string is accepted</i></td>
</tr>

<tr>
<td>-description</td>
<td>Description of the sequence</td>
<td>Any string is accepted</td>
<td><i>An empty string is accepted</i></td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Advanced (Unprompted) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>

<tr>
<td>-append</td>
<td>This allows you to append the name or description you have given on to the end of the existing name or description of the sequence.</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>

</table>

<H2>
    Input file format
</H2>
<b>descseq</b> reads a normal sequence USA.

<p>

<a name="input.1"></a>
<h3>Input files for usage example </h3>
<p><h3>File: dna.text</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
</pre>
</td></tr></table><p>

<H2>
    Output file format
</H2>


<b>descseq</b> writes the sequence file with a changed name or description.

<p>

<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: clone23.seq</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
&gt;myclone23
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
</pre>
</td></tr></table><p>

<a name="output.2"></a>
<h3>Output files for usage example 2</h3>
<p><h3>File: xy24.seq</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
&gt;EMBOSS_001 This is my clone number 244
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
</pre>
</td></tr></table><p>

<a name="output.3"></a>
<h3>Output files for usage example 3</h3>
<p><h3>File: est4.seq</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
&gt;EMBOSS_001  (submitted)
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
</pre>
</td></tr></table><p>

<H2>
    Data files
</H2>


None.
	
<H2>
    Notes
</H2>


None.
	
<H2>
    References
</H2>


None.
	
<H2>
    Warnings
</H2>


None.
	
<H2>
    Diagnostic Error Messages
</H2>


None.
	
<H2>
    Exit status
</H2>


It always exits with status 0.

<H2>
    Known bugs
</H2>


None noted.

<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th><th>Description</th></tr>
<tr>
<td><a href="biosed.html">biosed</a></td>
<td>Replace or delete sequence sections</td>
</tr>

<tr>
<td><a href="codcopy.html">codcopy</a></td>
<td>Reads and writes a codon usage table</td>
</tr>

<tr>
<td><a href="cutseq.html">cutseq</a></td>
<td>Removes a specified section from a sequence</td>
</tr>

<tr>
<td><a href="degapseq.html">degapseq</a></td>
<td>Removes gap characters from sequences</td>
</tr>

<tr>
<td><a href="entret.html">entret</a></td>
<td>Reads and writes (returns) flatfile entries</td>
</tr>

<tr>
<td><a href="extractalign.html">extractalign</a></td>
<td>Extract regions from a sequence alignment</td>
</tr>

<tr>
<td><a href="extractfeat.html">extractfeat</a></td>
<td>Extract features from a sequence</td>
</tr>

<tr>
<td><a href="extractseq.html">extractseq</a></td>
<td>Extract regions from a sequence</td>
</tr>

<tr>
<td><a href="listor.html">listor</a></td>
<td>Write a list file of the logical OR of two sets of sequences</td>
</tr>

<tr>
<td><a href="makenucseq.html">makenucseq</a></td>
<td>Creates random nucleotide sequences</td>
</tr>

<tr>
<td><a href="makeprotseq.html">makeprotseq</a></td>
<td>Creates random protein sequences</td>
</tr>

<tr>
<td><a href="maskfeat.html">maskfeat</a></td>
<td>Mask off features of a sequence</td>
</tr>

<tr>
<td><a href="maskseq.html">maskseq</a></td>
<td>Mask off regions of a sequence</td>
</tr>

<tr>
<td><a href="newseq.html">newseq</a></td>
<td>Type in a short new sequence</td>
</tr>

<tr>
<td><a href="noreturn.html">noreturn</a></td>
<td>Removes carriage return from ASCII files</td>
</tr>

<tr>
<td><a href="notseq.html">notseq</a></td>
<td>Exclude a set of sequences and write out the remaining ones</td>
</tr>

<tr>
<td><a href="nthseq.html">nthseq</a></td>
<td>Writes one sequence from a multiple set of sequences</td>
</tr>

<tr>
<td><a href="pasteseq.html">pasteseq</a></td>
<td>Insert one sequence into another</td>
</tr>

<tr>
<td><a href="revseq.html">revseq</a></td>
<td>Reverse and complement a sequence</td>
</tr>

<tr>
<td><a href="seqret.html">seqret</a></td>
<td>Reads and writes (returns) sequences</td>
</tr>

<tr>
<td><a href="seqretsplit.html">seqretsplit</a></td>
<td>Reads and writes (returns) sequences in individual files</td>
</tr>

<tr>
<td><a href="skipseq.html">skipseq</a></td>
<td>Reads and writes (returns) sequences, skipping first few</td>
</tr>

<tr>
<td><a href="splitter.html">splitter</a></td>
<td>Split a sequence into (overlapping) smaller sequences</td>
</tr>

<tr>
<td><a href="trimest.html">trimest</a></td>
<td>Trim poly-A tails off EST sequences</td>
</tr>

<tr>
<td><a href="trimseq.html">trimseq</a></td>
<td>Trim ambiguous bits off the ends of sequences</td>
</tr>

<tr>
<td><a href="union.html">union</a></td>
<td>Reads sequence fragments and builds one sequence</td>
</tr>

<tr>
<td><a href="vectorstrip.html">vectorstrip</a></td>
<td>Strips out DNA between a pair of vector sequences</td>
</tr>

<tr>
<td><a href="yank.html">yank</a></td>
<td>Reads a sequence range, appends the full USA to a list file</td>
</tr>

</table>

<H2>
    Author(s)
</H2>

Gary Williams (gwilliam&nbsp;&copy;&nbsp;rfcgr.mrc.ac.uk)
<br>
MRC Rosalind Franklin Centre for Genomics Research
Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK


<H2>
    History
</H2>


<H2>
    Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.

<H2>
    Comments
</H2>
None

</BODY>
</HTML>