1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659
|
<HTML>
<HEAD>
<TITLE>
EMBOSS: showorf
</TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">
<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
showorf
</font></b>
</td></tr>
</table>
<br>
<p>
<H2>
Function
</H2>
Pretty output of DNA translations
<H2>
Description
</H2>
Showorf displays a nucleic acid sequence with its protein translation in
a style suitable for publication. The translation can be done in any
frame or combination of frames.
<p>
It uses codon frequency files to do the translation. You can specify
the codon frequency file that you use with the '-cfile' option. The
default table is 'Ehum.cut'.
<H2>
Usage
</H2>
<b>Here is a sample session with showorf</b>
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>showorf </b>
Pretty output of DNA translations
Input nucleotide sequence: <b>tembl:x13776</b>
Select Frames To Translate
0 : None
1 : F1
2 : F2
3 : F3
4 : R1
5 : R2
6 : R3
Select one or more values [1,2,3,4,5,6]: <b></b>
Output file [x13776.showorf]: <b></b>
</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>
<H2>
Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
Standard (Mandatory) qualifiers:
[-sequence] sequence Nucleotide sequence filename and optional
format, or reference (input USA)
-frames menu [1,2,3,4,5,6] Select one or more values
(Values: 0 (None); 1 (F1); 2 (F2); 3 (F3); 4
(R1); 5 (R2); 6 (R3))
[-outfile] outfile [*.showorf] Output file name
Additional (Optional) qualifiers:
-table menu [0] Genetic code to use (Values: 0
(Standard); 1 (Standard (with alternative
initiation codons)); 2 (Vertebrate
Mitochondrial); 3 (Yeast Mitochondrial); 4
(Mold, Protozoan, Coelenterate Mitochondrial
and Mycoplasma/Spiroplasma); 5
(Invertebrate Mitochondrial); 6 (Ciliate
Macronuclear and Dasycladacean); 9
(Echinoderm Mitochondrial); 10 (Euplotid
Nuclear); 11 (Bacterial); 12 (Alternative
Yeast Nuclear); 13 (Ascidian Mitochondrial);
14 (Flatworm Mitochondrial); 15
(Blepharisma Macronuclear); 16
(Chlorophycean Mitochondrial); 21 (Trematode
Mitochondrial); 22 (Scenedesmus obliquus);
23 (Thraustochytrium Mitochondrial))
-[no]ruler boolean [Y] Add a ruler
-[no]plabel boolean [Y] Number translations
-[no]nlabel boolean [Y] Number DNA sequence
Advanced (Unprompted) qualifiers:
-width integer [50] Width of screen (Integer 10 or more)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of the sequence to be used
-send1 integer End of the sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Standard (Mandatory) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr>
<td>[-sequence]<br>(Parameter 1)</td>
<td>Nucleotide sequence filename and optional format, or reference (input USA)</td>
<td>Readable sequence</td>
<td><b>Required</b></td>
</tr>
<tr>
<td>-frames</td>
<td>Select one or more values</td>
<td><table><tr><td>0</td> <td><i>(None)</i></td></tr><tr><td>1</td> <td><i>(F1)</i></td></tr><tr><td>2</td> <td><i>(F2)</i></td></tr><tr><td>3</td> <td><i>(F3)</i></td></tr><tr><td>4</td> <td><i>(R1)</i></td></tr><tr><td>5</td> <td><i>(R2)</i></td></tr><tr><td>6</td> <td><i>(R3)</i></td></tr></table></td>
<td>1,2,3,4,5,6</td>
</tr>
<tr>
<td>[-outfile]<br>(Parameter 2)</td>
<td>Output file name</td>
<td>Output file</td>
<td><i><*></i>.showorf</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Additional (Optional) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr>
<td>-table</td>
<td>Genetic code to use</td>
<td><table><tr><td>0</td> <td><i>(Standard)</i></td></tr><tr><td>1</td> <td><i>(Standard (with alternative initiation codons))</i></td></tr><tr><td>2</td> <td><i>(Vertebrate Mitochondrial)</i></td></tr><tr><td>3</td> <td><i>(Yeast Mitochondrial)</i></td></tr><tr><td>4</td> <td><i>(Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma)</i></td></tr><tr><td>5</td> <td><i>(Invertebrate Mitochondrial)</i></td></tr><tr><td>6</td> <td><i>(Ciliate Macronuclear and Dasycladacean)</i></td></tr><tr><td>9</td> <td><i>(Echinoderm Mitochondrial)</i></td></tr><tr><td>10</td> <td><i>(Euplotid Nuclear)</i></td></tr><tr><td>11</td> <td><i>(Bacterial)</i></td></tr><tr><td>12</td> <td><i>(Alternative Yeast Nuclear)</i></td></tr><tr><td>13</td> <td><i>(Ascidian Mitochondrial)</i></td></tr><tr><td>14</td> <td><i>(Flatworm Mitochondrial)</i></td></tr><tr><td>15</td> <td><i>(Blepharisma Macronuclear)</i></td></tr><tr><td>16</td> <td><i>(Chlorophycean Mitochondrial)</i></td></tr><tr><td>21</td> <td><i>(Trematode Mitochondrial)</i></td></tr><tr><td>22</td> <td><i>(Scenedesmus obliquus)</i></td></tr><tr><td>23</td> <td><i>(Thraustochytrium Mitochondrial)</i></td></tr></table></td>
<td>0</td>
</tr>
<tr>
<td>-[no]ruler</td>
<td>Add a ruler</td>
<td>Boolean value Yes/No</td>
<td>Yes</td>
</tr>
<tr>
<td>-[no]plabel</td>
<td>Number translations</td>
<td>Boolean value Yes/No</td>
<td>Yes</td>
</tr>
<tr>
<td>-[no]nlabel</td>
<td>Number DNA sequence</td>
<td>Boolean value Yes/No</td>
<td>Yes</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Advanced (Unprompted) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr>
<td>-width</td>
<td>Width of screen</td>
<td>Integer 10 or more</td>
<td>50</td>
</tr>
</table>
<H2>
Input file format
</H2>
<b>showorf</b> reads a normal nucleic acid sequence USA.
<p>
<a name="input.1"></a>
<h3>Input files for usage example </h3>
'tembl:x13776' is a sequence entry in the example nucleic acid database 'tembl'
<p>
<p><h3>Database entry: tembl:x13776</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
ID X13776; SV 1; linear; genomic DNA; STD; PRO; 2167 BP.
XX
AC X13776; M43175;
XX
DT 19-APR-1989 (Rel. 19, Created)
DT 14-NOV-2006 (Rel. 89, Last updated, Version 24)
XX
DE Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS Pseudomonas aeruginosa
OC Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
OC Pseudomonadaceae; Pseudomonas.
XX
RN [1]
RP 1167-2167
RA Rice P.M.;
RT ;
RL Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN [2]
RP 1167-2167
RX DOI; 10.1016/0014-5793(89)80249-2.
RX PUBMED; 2495988.
RA Lowe N., Rice P.M., Drew R.E.;
RT "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomonas
RT aeruginosa";
RL FEBS Lett. 246(1-2):39-43(1989).
XX
RN [3]
RP 1-1292
RX PUBMED; 1907262.
RA Wilson S., Drew R.;
RT "Cloning and DNA seqence of amiC, a new gene regulating expression of the
RT Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT product.";
RL J. Bacteriol. 173(16):4914-4921(1991).
XX
RN [4]
RP 1-2167
RA Rice P.M.;
RT ;
RL Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR GOA; Q51417.
DR UniProtKB/Swiss-Prot; Q51417; AMIS_PSEAE.
XX
<font color=red> [Part of this file has been deleted for brevity]</font>
FT /replace=""
FT /note="ClaI fragment deleted in pSW36, constitutive
FT phenotype"
FT misc_feature 1
FT /note="last base of an XhoI site"
FT misc_feature 648..653
FT /note="end of 658bp XhoI fragment, deletion in pSW3 causes
FT constitutive expression of amiE"
FT conflict 1281
FT /replace="g"
FT /citation=[3]
XX
SQ Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat 60
ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac 120
aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg 180
aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg 240
agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc 300
ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg 360
tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg 420
agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga 480
acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga 540
ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa 600
gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct 660
acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg 720
cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg 780
ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg 840
aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt 900
acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct 960
tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc 1020
tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt 1080
acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca 1140
gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc 1200
agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt 1260
ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg 1320
cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca 1380
gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt 1440
gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc 1500
gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc 1560
cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga 1620
tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa 1680
gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca 1740
ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct 1800
gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg 1860
aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt 1920
catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg 1980
gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct 2040
gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa 2100
ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt 2160
cctcgag 2167
//
</pre>
</td></tr></table><p>
<H2>
Output file format
</H2>
As a sequence with high GC content (from Pseudmonas aeruginosa) PAAMIR
has several overlapping open reading frames.
<p>
The true ORFs are 1..109 (amiB partial) 135..1292 (amiC) 1289..1879 (amiR)
1925..end (amiS partial)
<p>
<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: x13776.showorf</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
SHOWORF of X13776 from 1 to 2167
---------|---------|---------|---------|---------|
1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacggga 50
F1 1 G T A G R A S A R S P P A G R R E 17
F2 1 V P L A E H L L D H H Q P G D G N 17
F3 1 Y R W P S I C S I T T S R A T G 16
R1 9 T G S A S C R S S * W W G P S P 5
R2 106 Y R Q G L M Q E I V V L R A V P 91
R3 38 V A P R A D A R D G G A P R R S 23
---------|---------|---------|---------|---------|
51 actgcacgatctacctggcgagcctggagcacgagcgggttcgcttcgta 100
F1 18 L H D L P G E P G A R A G S L R T 34
F2 18 C T I Y L A S L E H E R V R F V 33
F3 17 T A R S T W R A W S T S G F A S Y 33
R1 4 F Q V I * R A L R S C S R T R K T 31
R2 90 V A R D V Q R A Q L V L P N A E Y 74
R3 22 S C S R G P S G P A R A P E S R 7
---------|---------|---------|---------|---------|
101 cggcgctgagcgacagtcacaggagaggaaacggatgggatcgcaccagg 150
F1 35 A L S D S H R R G N G W D R T R 50
F2 34 R R * A T V T G E E T D G I A P G 14
F3 34 G A E R Q S Q E R K R M G S H Q E 50
R1 30 R R Q A V T V P S S V S P I A G P 14
R2 73 P A S R C D C S L F R I P D C W 58
R3 6 V A S L S L * L L P F P H S R V L 398
---------|---------|---------|---------|---------|
151 agcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat 200
F1 51 S G R * S A C C S P K P A S P P I 13
F2 15 A A A D R P A V L R N R R H R R Y 31
F3 51 R P L I G L L F S E T G V T A D 66
R1 13 A A A S R G A T R R F R R * R R 49
R2 57 S R G S I P R S N E S V P T V A S 41
R3 397 L P R Q D A Q Q E G F G A D G G I 381
---------|---------|---------|---------|---------|
201 atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaa 250
F1 14 S S A R T R M A H C S R S S N * T 1
F2 32 R A L A R V W R I A R G R A T E 47
F3 67 I E R S H A Y G A L L A V E Q L N 83
R1 48 Y R A S A R T H R M A R P R A V S 32
R2 40 I S R E C A Y P A N S A T S C S F 24
R3 380 D L A R V R I A C Q E R D L L Q 365
---------|---------|---------|---------|---------|
251 ccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc 300
F1 2 A R A A S A V A R S K R C P R T 17
<font color=red> [Part of this file has been deleted for brevity]</font>
F2 8 N N K R G I V I M L G L V L L Y V 24
F3 22 I T R G V S S S C W D W F C C T L 38
R1 53 L L L L P I T M M S P S T R S Y T 37
R2 73 I V L P T D D D H Q S Q N Q Q V 58
R3 7 C Y C S P Y R * * A P V P E A T R 7
---------|---------|---------|---------|---------|
1951 tggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg 2000
F1 16 W R G A V S Q C R L V A G Q D Q R 32
F2 25 G A V L F L N A V W L L G K I S G 41
F3 39 A R C C F S M P S G C W A R S A 54
R1 36 P A T S N R L A T Q N S P L I L 21
R2 57 N A R H Q K E I G D P Q Q A L D A 41
R3 6 Q R P A T E * H R R T A P C S * R 7
---------|---------|---------|---------|---------|
2001 gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgc 2050
F1 33 S G G G G D Q L P G R R A E R L R 49
F2 42 R E V A V I N F L V G V L S A C 57
F3 55 V G R W R * S T S W S A C * A P A 3
R1 20 P R S T A T I L K R T P T S L A Q 4
R2 40 T P L H R H D V E Q D A H Q A G A 24
R3 6 D P P P P S * S G P R R A S R R 28
---------|---------|---------|---------|---------|
2051 gtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa 2100
F1 50 R V L P D L F R S S R A G L A E 65
F2 58 V A F Y L I F S A A A G Q G S L K 74
F3 4 S R S T * S F P Q Q P G R A R * R 1
R1 3 T A N * R I K E A A A P C P E S F 12
R2 23 D R E V Q D K G C C G P L A R Q 8
R3 27 R R T R G S R K R L L R A P S A S 11
---------|---------|---------|---------|---------|
2101 ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccg 2150
F1 66 G R S A D P A I R F Y L S V G G R 82
F2 75 A G A L T L L F A F T Y L W V A A 91
F3 2 P E R * P C Y S L L P I C G W P 12
R1 11 A P A S V R S N A K V * R H T A 7
R2 7 L G S R Q G Q * E S K G I Q P H G 7
R3 10 P R L A S G A I R K * R D T P P R 6
---------|-------
2151 ccaaccagttcctcgag 2167
F1 83 Q P V P R 87
F2 92 N Q F L E 96
F3 13 P T S S S 17
R1 6 A L W N R S 1
R2 6 G V L E E L 1
R3 5 W G T G R 1
</pre>
</td></tr></table><p>
<H2>
Data files
</H2>
Showorf uses the codon frequency files to translate the sequence.
<p>
The codon usage table is read by default from "Ehum.cut" in the 'data/CODONS'
directory of the EMBOSS distribution. If the name of a codon usage file
is specified on the command line with the '-cfile' option, then this
file will first be searched for in the current directory and then in the
'data/CODONS' directory of the EMBOSS distribution.
<p>
To see the available EMBOSS codon usage files, run:
<pre>
% embossdata -showall
</pre>
<p>
To fetch one of the codon usage tables (for example 'Emus.cut') into your
current directory for you to inspect or modify, run:
<pre>
% embossdata -fetch -file Emus.cut
</pre>
<H2>
Notes
</H2>
None.
<H2>
References
</H2>
None.
<H2>
Warnings
</H2>
None.
<H2>
Diagnostic Error Messages
</H2>
None.
<H2>
Exit status
</H2>
It exits with a status of 0.
It always exits with status 0.
<H2>
Known bugs
</H2>
None.
<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th><th>Description</th></tr>
<tr>
<td><a href="backtranambig.html">backtranambig</a></td>
<td>Back translate a protein sequence to ambiguous codons</td>
</tr>
<tr>
<td><a href="backtranseq.html">backtranseq</a></td>
<td>Back translate a protein sequence</td>
</tr>
<tr>
<td><a href="coderet.html">coderet</a></td>
<td>Extract CDS, mRNA and translations from feature tables</td>
</tr>
<tr>
<td><a href="getorf.html">getorf</a></td>
<td>Finds and extracts open reading frames (ORFs)</td>
</tr>
<tr>
<td><a href="marscan.html">marscan</a></td>
<td>Finds MAR/SAR sites in nucleic sequences</td>
</tr>
<tr>
<td><a href="plotorf.html">plotorf</a></td>
<td>Plot potential open reading frames</td>
</tr>
<tr>
<td><a href="prettyseq.html">prettyseq</a></td>
<td>Output sequence with translated ranges</td>
</tr>
<tr>
<td><a href="remap.html">remap</a></td>
<td>Display sequence with restriction sites, translation etc</td>
</tr>
<tr>
<td><a href="showseq.html">showseq</a></td>
<td>Display a sequence with features, translation etc</td>
</tr>
<tr>
<td><a href="sixpack.html">sixpack</a></td>
<td>Display a DNA sequence with 6-frame translation and ORFs</td>
</tr>
<tr>
<td><a href="syco.html">syco</a></td>
<td>Synonymous codon usage Gribskov statistic plot</td>
</tr>
<tr>
<td><a href="tcode.html">tcode</a></td>
<td>Fickett TESTCODE statistic to identify protein-coding DNA</td>
</tr>
<tr>
<td><a href="transeq.html">transeq</a></td>
<td>Translate nucleic acid sequences</td>
</tr>
<tr>
<td><a href="wobble.html">wobble</a></td>
<td>Wobble base plot</td>
</tr>
</table>
<H2>
Author(s)
</H2>
Alan Bleasby (ajb © ebi.ac.uk)
<br>
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK
<H2>
History
</H2>
1999 - written - Alan Bleasby
<H2>
Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.
<H2>
Comments
</H2>
None
</BODY>
</HTML>
|