1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364
|
<HTML>
<HEAD>
<TITLE>
EMBOSS: stssearch
</TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">
<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
stssearch
</font></b>
</td></tr>
</table>
<br>
<p>
<H2>
Function
</H2>
Search a DNA database for matches with a set of STS primers
<H2>
Description
</H2>
<b>stssearch</b> searches a DNA sequence database with a set of STS
primers and reports expected matches.
<p>
<b>stssearch</b>s reads in one or more sequences to be searched. For
each pair of primers, it looks for matches between a the primers
and the query sequence in either orientation.
<p>
Any matches found will be reported. Only one primer need match for it
to be reported..
<H2>
Usage
</H2>
<b>Here is a sample session with stssearch</b>
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>stssearch </b>
Search a DNA database for matches with a set of STS primers
Input nucleotide sequence(s): <b>@eclac.list</b>
Primer pairs file: <b>lac.primers</b>
Output file [j01636.stssearch]: <b></b>
</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>
<H2>
Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
Standard (Mandatory) qualifiers:
[-seqall] seqall Nucleotide sequence(s) filename and optional
format, or reference (input USA)
[-infile] infile Primer pairs file
[-outfile] outfile [*.stssearch] Output file name
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-seqall" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory3 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Standard (Mandatory) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr>
<td>[-seqall]<br>(Parameter 1)</td>
<td>Nucleotide sequence(s) filename and optional format, or reference (input USA)</td>
<td>Readable sequence(s)</td>
<td><b>Required</b></td>
</tr>
<tr>
<td>[-infile]<br>(Parameter 2)</td>
<td>Primer pairs file</td>
<td>Input file</td>
<td><b>Required</b></td>
</tr>
<tr>
<td>[-outfile]<br>(Parameter 3)</td>
<td>Output file name</td>
<td>Output file</td>
<td><i><*></i>.stssearch</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Additional (Optional) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr>
<td colspan=4>(none)</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Advanced (Unprompted) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr>
<td colspan=4>(none)</td>
</tr>
</table>
<H2>
Input file format
</H2>
<a name="input.1"></a>
<h3>Input files for usage example </h3>
<p><h3>File: eclac.list</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
#Formerly ECLAC
tembl:J01636
#Formerly ECLACA
tembl:X51872
#Formerly ECLACI
tembl:V00294
#Formerly ECLACY
tembl:V00295
#Formerly ECLACZ
tembl:V00296
</pre>
</td></tr></table><p>
<p><h3>File: lac.primers</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
PrimA ACCAGACACCCATCAACAG TATTTATGCCAGCCAGCCAG
PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG
PrimC CGTCAGTATCCCCGTTTACAG TATCGCCAAAATCACCGCC
PrimD AATACGCAAACCGCCTCTCC TTATCCGCTCACAATTCCACAC
PrimE AATACGCAAACCGCCTCTCC CACAACCCGCTCACAATTCCA
</pre>
</td></tr></table><p>
<p>
The primers file consists of three columns separated by tabs or spaces.
<p>
The first column is the name of the primer pair.
<br>
The second column is the sequence of the first primer.
<br>
The third column is the sequence of the second primer.
<H2>
Output file format
</H2>
<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: j01636.stssearch</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
J01636: PrimA PrimerA matched at 532
J01636: (rev) PrimA PrimerB matched at 689
J01636: PrimB PrimerA matched at 5743
J01636: (rev) PrimB PrimerB matched at 5942
J01636: PrimC PrimerA matched at 2954
J01636: (rev) PrimC PrimerB matched at 3069
J01636: PrimD PrimerA matched at 1074
J01636: (rev) PrimD PrimerB matched at 1261
J01636: PrimE PrimerA matched at 1074
X51872: PrimB PrimerA matched at 98
X51872: (rev) PrimB PrimerB matched at 297
V00294: PrimA PrimerA matched at 484
V00294: (rev) PrimA PrimerB matched at 641
V00294: PrimD PrimerA matched at 1026
V00294: PrimE PrimerA matched at 1026
V00295: PrimB PrimerA matched at 1439
V00296: PrimC PrimerA matched at 1668
V00296: (rev) PrimC PrimerB matched at 1783
</pre>
</td></tr></table><p>
<p>
The output file consists of one line per match. This consists of:
<p>
<ul>
<li>The name of the sequence that the match is found in, followed by a ':'.
<li>If the match is in the reverse sense, it has a '(rev)'.
<li>The name of the primer pair.
<li>'PrimerA' or 'PrimerB'.
<li>'matched at' the start of the match position.
</ul>
<H2>
Data files
</H2>
None.
<H2>
Notes
</H2>
None.
<H2>
References
</H2>
None.
<H2>
Warnings
</H2>
None.
<H2>
Diagnostic Error Messages
</H2>
None.
<H2>
Exit status
</H2>
None.
<H2>
Known bugs
</H2>
None.
<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th><th>Description</th></tr>
<tr>
<td><a href="eprimer3.html">eprimer3</a></td>
<td>Picks PCR primers and hybridization oligos</td>
</tr>
<tr>
<td><a href="primersearch.html">primersearch</a></td>
<td>Searches DNA sequences for matches with primer pairs</td>
</tr>
</table>
<p>
If you want something that only reports matches of both primer pairs and
can find mismatches, use <A href="primersearch.html">primersearch</a>.
<H2>
Author(s)
</H2>
Peter Rice (pmr © ebi.ac.uk)
<br>
Informatics Division, European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK
<H2>
History
</H2>
<H2>
Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.
<H2>
Comments
</H2>
None
</BODY>
</HTML>
|