1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648
|
<HTML>
<HEAD>
<TITLE>
EMBOSS: trimseq
</TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">
<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
trimseq
</font></b>
</td></tr>
</table>
<br>
<p>
<H2>
Function
</H2>
Trim ambiguous bits off the ends of sequences
<H2>
Description
</H2>
This program is used to tidy up the ends of sequences, removing all
the bits that you would really rather were not published.
<p>
Specifically, it:
<ul>
<li>removes all gap characters from the ends.
<li>removes X's and N's (in nucleic sequences) from the ends.
<li>optionally removes *'s from the ends
<li>optionally removes IUPAC ambiguity codes from the ends
(B and Z in proteins, M,R,W,S,Y,K,V,H,D and B in nucleic sequences)
</ul>
<p>
It then optionally trims off poor quality regions from the end, using
a threshold percentage of unwanted characters in a window which is moved
along the sequence from the ends. The unwanted characters which are used
are X's and N's (in nucleic sequences), optionally *'s, and optionally
IUPAC ambiguity codes.
<p>
The program stops trimming the ends when the percentage of
unwanted characters in the moving window drops below the
threshold percentage.
<p>
Thus if the window size is set to 1 and the percentage threshold
is 100, no further poor quality regions will be removed.
If the window size is set to 5 and the percentage threshold is 40
then the sequence AAGCTNNNNATT will be trimmed to AAGCT,
while AAGCTNATT or AAGCTNNNNATTT will not be trimmed as less than
40% of the last 5 characters are N's.
<p>
After trimming these poor quality regions, it will again then
trim off any dangling gap characters from the ends .
<H2>
Usage
</H2>
<b>Here is a sample session with trimseq</b>
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>trimseq untrimmed.seq trim1.seq -window 1 -percent 100 </b>
Trim ambiguous bits off the ends of sequences
</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>
<p>
<b>Example 2</b>
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>trimseq untrimmed.seq trim2.seq -window 5 -percent 40 </b>
Trim ambiguous bits off the ends of sequences
</pre></td></tr></table><p>
<p>
<a href="#output.2">Go to the output files for this example</a><p><p>
<p>
<b>Example 3</b>
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>trimseq untrimmed.seq trim3.seq -window 5 -percent 50 </b>
Trim ambiguous bits off the ends of sequences
</pre></td></tr></table><p>
<p>
<a href="#output.3">Go to the output files for this example</a><p><p>
<p>
<b>Example 4</b>
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>trimseq untrimmed.seq trim4.seq -window 5 -percent 50 -strict </b>
Trim ambiguous bits off the ends of sequences
</pre></td></tr></table><p>
<p>
<a href="#output.4">Go to the output files for this example</a><p><p>
<p>
<b>Example 5</b>
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>trimseq untrimmed.seq trim5.seq -window 5 -percent 50 -strict -noright </b>
Trim ambiguous bits off the ends of sequences
</pre></td></tr></table><p>
<p>
<a href="#output.5">Go to the output files for this example</a><p><p>
<H2>
Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
Standard (Mandatory) qualifiers:
[-sequence] seqall (Gapped) sequence(s) filename and optional
format, or reference (input USA)
[-outseq] seqoutall [<sequence>.<format>] Sequence set(s)
filename and optional format (output USA)
Additional (Optional) qualifiers:
-window integer [1] This determines the size of the region
that is considered when deciding whether the
percentage of ambiguity is greater than the
threshold. A value of 5 means that a region
of 5 letters in the sequence is shifted
along the sequence from the ends and
trimming is done only if there is a greater
or equal percentage of ambiguity than the
threshold percentage. (Any integer value)
-percent float [100.0] This is the threshold of the
percentage ambiguity in the window required
in order to trim a sequence. (Any numeric
value)
-strict boolean [N] In nucleic sequences, trim off not only
N's and X's, but also the nucleotide IUPAC
ambiguity codes M, R, W, S, Y, K, V, H, D
and B. In protein sequences, trim off not
only X's but also B and Z.
-star boolean [N] In protein sequences, trim off not only
X's, but also the *'s
Advanced (Unprompted) qualifiers:
-[no]left boolean [Y] Trim at the start
-[no]right boolean [Y] Trim at the end
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Standard (Mandatory) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr>
<td>[-sequence]<br>(Parameter 1)</td>
<td>(Gapped) sequence(s) filename and optional format, or reference (input USA)</td>
<td>Readable sequence(s)</td>
<td><b>Required</b></td>
</tr>
<tr>
<td>[-outseq]<br>(Parameter 2)</td>
<td>Sequence set(s) filename and optional format (output USA)</td>
<td>Writeable sequence(s)</td>
<td><i><*></i>.<i>format</i></td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Additional (Optional) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr>
<td>-window</td>
<td>This determines the size of the region that is considered when deciding whether the percentage of ambiguity is greater than the threshold. A value of 5 means that a region of 5 letters in the sequence is shifted along the sequence from the ends and trimming is done only if there is a greater or equal percentage of ambiguity than the threshold percentage.</td>
<td>Any integer value</td>
<td>1</td>
</tr>
<tr>
<td>-percent</td>
<td>This is the threshold of the percentage ambiguity in the window required in order to trim a sequence.</td>
<td>Any numeric value</td>
<td>100.0</td>
</tr>
<tr>
<td>-strict</td>
<td>In nucleic sequences, trim off not only N's and X's, but also the nucleotide IUPAC ambiguity codes M, R, W, S, Y, K, V, H, D and B. In protein sequences, trim off not only X's but also B and Z.</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>
<tr>
<td>-star</td>
<td>In protein sequences, trim off not only X's, but also the *'s</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=2>Advanced (Unprompted) qualifiers</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr>
<td>-[no]left</td>
<td>Trim at the start</td>
<td>Boolean value Yes/No</td>
<td>Yes</td>
</tr>
<tr>
<td>-[no]right</td>
<td>Trim at the end</td>
<td>Boolean value Yes/No</td>
<td>Yes</td>
</tr>
</table>
<H2>
Input file format
</H2>
Normal sequence.
<p>
<a name="input.1"></a>
<h3>Input files for usage example </h3>
<p><h3>File: untrimmed.seq</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
>myseq
...ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
tctaataaaaaagccacttagttca.gnntcynnnnnn</pre>
</td></tr></table><p>
<H2>
Output file format
</H2>
Normal sequence file.
<p>
<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: trim1.seq</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
>myseq
ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
tctaataaaaaagccacttagttca-gnntcy
</pre>
</td></tr></table><p>
<a name="output.2"></a>
<h3>Output files for usage example 2</h3>
<p><h3>File: trim2.seq</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
>myseq
ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
tctaataaaaaagccacttagttca-g
</pre>
</td></tr></table><p>
<a name="output.3"></a>
<h3>Output files for usage example 3</h3>
<p><h3>File: trim3.seq</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
>myseq
ttyyyctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg
cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc
tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc
tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga
agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca
cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc
tctaataaaaaagccacttagttca-gnntcy
</pre>
</td></tr></table><p>
<a name="output.4"></a>
<h3>Output files for usage example 4</h3>
<p><h3>File: trim4.seq</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
>myseq
ctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctc
tttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccag
atcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctg
gcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgact
accctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgct
ggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagaca
ggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccaccttt
ggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaa
taaaaaagccacttagttca-gnntc
</pre>
</td></tr></table><p>
<a name="output.5"></a>
<h3>Output files for usage example 5</h3>
<p><h3>File: trim5.seq</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
>myseq
ctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgcagctc
tttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccag
atcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctg
gcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgact
accctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggcccgtgct
ggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaagaagaca
ggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgcccaccttt
ggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttctctaa
taaaaaagccacttagttca-gnntcynnnnnn
</pre>
</td></tr></table><p>
<H2>
Data files
</H2>
None.
<H2>
Notes
</H2>
If you use the '-star' qualifier and set the window size to greater
than 1, you may trim bits of sequence with internal *'s. This may
not be what you expected.
<H2>
References
</H2>
None.
<H2>
Warnings
</H2>
None.
<H2>
Diagnostic Error Messages
</H2>
None.
<H2>
Exit status
</H2>
It always exits with status 0.
<H2>
Known bugs
</H2>
None noted.
<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th><th>Description</th></tr>
<tr>
<td><a href="biosed.html">biosed</a></td>
<td>Replace or delete sequence sections</td>
</tr>
<tr>
<td><a href="codcopy.html">codcopy</a></td>
<td>Reads and writes a codon usage table</td>
</tr>
<tr>
<td><a href="cutseq.html">cutseq</a></td>
<td>Removes a specified section from a sequence</td>
</tr>
<tr>
<td><a href="degapseq.html">degapseq</a></td>
<td>Removes gap characters from sequences</td>
</tr>
<tr>
<td><a href="descseq.html">descseq</a></td>
<td>Alter the name or description of a sequence</td>
</tr>
<tr>
<td><a href="entret.html">entret</a></td>
<td>Reads and writes (returns) flatfile entries</td>
</tr>
<tr>
<td><a href="extractalign.html">extractalign</a></td>
<td>Extract regions from a sequence alignment</td>
</tr>
<tr>
<td><a href="extractfeat.html">extractfeat</a></td>
<td>Extract features from a sequence</td>
</tr>
<tr>
<td><a href="extractseq.html">extractseq</a></td>
<td>Extract regions from a sequence</td>
</tr>
<tr>
<td><a href="listor.html">listor</a></td>
<td>Write a list file of the logical OR of two sets of sequences</td>
</tr>
<tr>
<td><a href="makenucseq.html">makenucseq</a></td>
<td>Creates random nucleotide sequences</td>
</tr>
<tr>
<td><a href="makeprotseq.html">makeprotseq</a></td>
<td>Creates random protein sequences</td>
</tr>
<tr>
<td><a href="maskfeat.html">maskfeat</a></td>
<td>Mask off features of a sequence</td>
</tr>
<tr>
<td><a href="maskseq.html">maskseq</a></td>
<td>Mask off regions of a sequence</td>
</tr>
<tr>
<td><a href="newseq.html">newseq</a></td>
<td>Type in a short new sequence</td>
</tr>
<tr>
<td><a href="noreturn.html">noreturn</a></td>
<td>Removes carriage return from ASCII files</td>
</tr>
<tr>
<td><a href="notseq.html">notseq</a></td>
<td>Exclude a set of sequences and write out the remaining ones</td>
</tr>
<tr>
<td><a href="nthseq.html">nthseq</a></td>
<td>Writes one sequence from a multiple set of sequences</td>
</tr>
<tr>
<td><a href="pasteseq.html">pasteseq</a></td>
<td>Insert one sequence into another</td>
</tr>
<tr>
<td><a href="revseq.html">revseq</a></td>
<td>Reverse and complement a sequence</td>
</tr>
<tr>
<td><a href="seqret.html">seqret</a></td>
<td>Reads and writes (returns) sequences</td>
</tr>
<tr>
<td><a href="seqretsplit.html">seqretsplit</a></td>
<td>Reads and writes (returns) sequences in individual files</td>
</tr>
<tr>
<td><a href="skipseq.html">skipseq</a></td>
<td>Reads and writes (returns) sequences, skipping first few</td>
</tr>
<tr>
<td><a href="splitter.html">splitter</a></td>
<td>Split a sequence into (overlapping) smaller sequences</td>
</tr>
<tr>
<td><a href="trimest.html">trimest</a></td>
<td>Trim poly-A tails off EST sequences</td>
</tr>
<tr>
<td><a href="union.html">union</a></td>
<td>Reads sequence fragments and builds one sequence</td>
</tr>
<tr>
<td><a href="vectorstrip.html">vectorstrip</a></td>
<td>Strips out DNA between a pair of vector sequences</td>
</tr>
<tr>
<td><a href="yank.html">yank</a></td>
<td>Reads a sequence range, appends the full USA to a list file</td>
</tr>
</table>
<H2>
Author(s)
</H2>
Gary Williams (gwilliam © rfcgr.mrc.ac.uk)
<br>
MRC Rosalind Franklin Centre for Genomics Research
Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK
<H2>
History
</H2>
<H2>
Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.
<H2>
Comments
</H2>
None
</BODY>
</HTML>
|