1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272
|
nthseq
Function
Writes one sequence from a multiple set of sequences
Description
In EMBOSS, when an application has to write out many sequences, the
normal style is to write them all into one file containing multiple
sequences.
This default behaviour can be changed by using the qualifier
'-ossingle' which writes many sequences into many files, each
containing one sequence.
The program seqretsplit will take a file containing many sequences and
will output many files, each containing one sequence. However you have
no choice over the naming of the files - they are named after the ID
name fo the sequence they contain.
If, however you have the situation where you have a file containing
multiple sequences and you wish to extract one of them, then this
application may be useful.
nthseq allows you to specify the name of the output file, so you may
find that it is useful to include this program in scripts where you
need to be able to specify the name of the resulting sequence files
you create.
This application extracts the indicated sequence from a multiple set
of sequences and writes it out.
Usage
Here is a sample session with nthseq
% nthseq
Writes one sequence from a multiple set of sequences
Input (gapped) sequence(s): @eclac.list
The number of the sequence to output [1]: 2
output sequence [j01636.fasta]:
Go to the input files for this example
Go to the output files for this example
Command line arguments
Standard (Mandatory) qualifiers:
[-sequence] seqall (Gapped) sequence(s) filename and optional
format, or reference (input USA)
-number integer [1] The number of the sequence to output
(Integer 1 or more)
[-outseq] seqout [.] Sequence filename and
optional format (output USA)
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
Input file format
nthseq reads a a normal sequence USA.
Input files for usage example
File: eclac.list
#Formerly ECLAC
tembl:J01636
#Formerly ECLACA
tembl:X51872
#Formerly ECLACI
tembl:V00294
#Formerly ECLACY
tembl:V00295
#Formerly ECLACZ
tembl:V00296
Output file format
The output is the specified ordinal sequence from the input USA.
In the example, the second sequence from the input file will be
written out to the specified output file.
Output files for usage example
File: j01636.fasta
>X51872 X51872.1 Escherichia coli lacA gene for thiogalactoside transacetylase
gtgaatgaagtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccgaccaaca
tatcataacggagtgatcgcattgaacatgccaatgaccgaaagaataagagcaggcaag
ctatttaccgatatgtgcgaaggcttaccggaaaaaagacttcgtgggaaaacgttaatg
tatgagtttaatcactcgcatccatcagaagttgaaaaaagagaaagcctgattaaagaa
atgtttgccacggtaggggaaaacgcctgggtagaaccgcctgtctatttctcttacggt
tccaacatccatataggccgcaatttttatgcaaatttcaatttaaccattgtcgatgac
tacacggtaacaatcggtgataacgtactgattgcacccaacgttactctttccgttacg
ggacaccctgtacaccatgaattgagaaaaaacggcgagatgtactcttttccgataacg
attggcaataacgtctggatcggaagtcatgtggttattaatccaggcgtcaccatcggg
gataattctgttattggcgcgggtagtatcgtcacaaaagacattccaccaaacgtcgtg
gcggctggcgttccttgtcgggttattcgcgaaataaacgaccgggataagcactattat
ttcaaagattataaagttgaatcgtcagtttaaattataaaaattgcctgatacgctgcg
cttatcaggcctacaagttcagcgatctacattagccgcatccggcatgaacaaagcgca
ggaacaagcgtcgcatcatgcctctttgacccacagctgcggaaaacgtactggtgcaaa
acgcagggttatgatcatcagcccaacgacgcacagcgcatgaaatgcccagtccatcag
gtaattgccgctgatactacgcagcacgccagaaaaccacggggcaagcccggcgatgat
aaaaccgattccctgcataaacgccaccagcttgccagcaatagccggttgcacagagtg
atcgagcgccagcagcaaacagagcggaaacgcgccgcccagacctaacccacacaccat
cgcccacaataccggcaattgcatcggcagccagataaagccgcagaaccccaccagttg
taacaccagcgccagcattaacagtttgcgccgatcctgatggcgagccatagcaggcat
cagcaaagctcctgcggcttgcccaagcgtcatcaatgccagtaaggaaccgctgtactg
cgcgctggcaccaatctcaatatagaaagcgggtaaccaggcaatcaggctggcgtaacc
gccgttaatcagaccgaagtaaacacccagcgtccacgcgcggggagtgaataccacgcg
aaccggagtggttgttgtcttgtgggaagaggcgacctcgcgggcgctttgccaccacca
ggcaaagagcgcaacaacggcaggcagcgccaccaggcgagtgtttgataccaggtttcg
ctatgttgaactaaccagggcgttatggcggcaccaagcccaccgccgcccatcagagcc
gcggaccacagccccatcaccagtggcgtgcgctgctgaaaccgccgtttaatcaccgaa
gcatcaccgcctgaatgatgccgatccccaccccaccaagcagtgcgctgctaagcagca
gcgcactttgcgggtaaagctcacgcatcaatgcaccgacggcaatcagcaacagactga
tggcgacactgcgacgttcgctgacatgctgatgaagccagcttccggccagcgccagcc
cgcccatggtaaccaccggcagagcggtcgac
Data files
None.
Notes
It may be useful to use this application in a small script that
extracts all sequences from a multiple sequence file and explicitly
names the output files in the way that you require.
For example:
#!/usr/local/bin/perl -w
if ($#ARGV !=1) {
die "Usage: scriptname in out\n";
}
$count=1;
@list = `infoseq $ARGV[0] -auto -only -name`;
while ($count <= $#list+1) {
system("nthseq -auto $ARGV[0] -n $count $ARGV[1]-$count.seq");
$count++;
}
References
None.
Warnings
None.
Diagnostic Error Messages
None.
Exit status
It always exits with a status of 0.
Known bugs
None.
See also
Program name Description
biosed Replace or delete sequence sections
codcopy Reads and writes a codon usage table
cutseq Removes a specified section from a sequence
degapseq Removes gap characters from sequences
descseq Alter the name or description of a sequence
entret Reads and writes (returns) flatfile entries
extractalign Extract regions from a sequence alignment
extractfeat Extract features from a sequence
extractseq Extract regions from a sequence
listor Write a list file of the logical OR of two sets of sequences
makenucseq Creates random nucleotide sequences
makeprotseq Creates random protein sequences
maskfeat Mask off features of a sequence
maskseq Mask off regions of a sequence
newseq Type in a short new sequence
noreturn Removes carriage return from ASCII files
notseq Exclude a set of sequences and write out the remaining ones
pasteseq Insert one sequence into another
revseq Reverse and complement a sequence
seqret Reads and writes (returns) sequences
seqretsplit Reads and writes (returns) sequences in individual files
skipseq Reads and writes (returns) sequences, skipping first few
splitter Split a sequence into (overlapping) smaller sequences
trimest Trim poly-A tails off EST sequences
trimseq Trim ambiguous bits off the ends of sequences
union Reads sequence fragments and builds one sequence
vectorstrip Strips out DNA between a pair of vector sequences
yank Reads a sequence range, appends the full USA to a list file
The program seqretsplit will take a file containing many sequences and
will output many files, each containing one sequence. However you have
no choice over the naming of the files - they are named after the ID
name fo the sequence they contain.
Author(s)
Gary Williams (gwilliam rfcgr.mrc.ac.uk)
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust
Genome Campus, Hinxton, Cambridge, CB10 1SB, UK
History
Written (2000) - Gary Williams
Target users
This program is intended to be used by everyone and everything, from
naive users to embedded scripts.
Comments
None
|