1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500
|
prettyseq
Function
Output sequence with translated ranges
Description
This writes out a nicely formatted display of the sequence with the
translation (within specified ranges) displayed beneath it.
The translated nucleic acid region will be shown in lower-case letters
while the rest of the input sequence will be left in the input case.
The base and residue numbers of the sequences are shown beside the
sequences in the output.
Slightly unusually, this application uses the codon usage tables to
translate the codons.
Usage
Here is a sample session with prettyseq
% prettyseq
Output sequence with translated ranges
Input nucleotide sequence: tembl:x13776
Range(s) to translate [1-2167]: 135-1292
Output file [x13776.prettyseq]:
Go to the input files for this example
Go to the output files for this example
Command line arguments
Standard (Mandatory) qualifiers:
[-sequence] sequence Nucleotide sequence filename and optional
format, or reference (input USA)
-range range [Whole sequence] Range(s) to translate
[-outfile] outfile [*.prettyseq] Output file name
Additional (Optional) qualifiers:
-table menu [0] Genetic code to use (Values: 0
(Standard); 1 (Standard (with alternative
initiation codons)); 2 (Vertebrate
Mitochondrial); 3 (Yeast Mitochondrial); 4
(Mold, Protozoan, Coelenterate Mitochondrial
and Mycoplasma/Spiroplasma); 5
(Invertebrate Mitochondrial); 6 (Ciliate
Macronuclear and Dasycladacean); 9
(Echinoderm Mitochondrial); 10 (Euplotid
Nuclear); 11 (Bacterial); 12 (Alternative
Yeast Nuclear); 13 (Ascidian Mitochondrial);
14 (Flatworm Mitochondrial); 15
(Blepharisma Macronuclear); 16
(Chlorophycean Mitochondrial); 21 (Trematode
Mitochondrial); 22 (Scenedesmus obliquus);
23 (Thraustochytrium Mitochondrial))
-[no]ruler boolean [Y] Add a ruler
-[no]plabel boolean [Y] Number translations
-[no]nlabel boolean [Y] Number DNA sequence
Advanced (Unprompted) qualifiers:
-width integer [60] Width of screen (Integer 10 or more)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of the sequence to be used
-send1 integer End of the sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
Input file format
prettyseq reads any nucleic acid sequence USA.
Input files for usage example
'tembl:x13776' is a sequence entry in the example nucleic acid
database 'tembl'
Database entry: tembl:x13776
ID X13776; SV 1; linear; genomic DNA; STD; PRO; 2167 BP.
XX
AC X13776; M43175;
XX
DT 19-APR-1989 (Rel. 19, Created)
DT 14-NOV-2006 (Rel. 89, Last updated, Version 24)
XX
DE Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS Pseudomonas aeruginosa
OC Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
OC Pseudomonadaceae; Pseudomonas.
XX
RN [1]
RP 1167-2167
RA Rice P.M.;
RT ;
RL Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG
.
XX
RN [2]
RP 1167-2167
RX DOI; 10.1016/0014-5793(89)80249-2.
RX PUBMED; 2495988.
RA Lowe N., Rice P.M., Drew R.E.;
RT "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomona
s
RT aeruginosa";
RL FEBS Lett. 246(1-2):39-43(1989).
XX
RN [3]
RP 1-1292
RX PUBMED; 1907262.
RA Wilson S., Drew R.;
RT "Cloning and DNA seqence of amiC, a new gene regulating expression of the
RT Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT product.";
RL J. Bacteriol. 173(16):4914-4921(1991).
XX
RN [4]
RP 1-2167
RA Rice P.M.;
RT ;
RL Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG
.
XX
DR GOA; Q51417.
DR UniProtKB/Swiss-Prot; Q51417; AMIS_PSEAE.
XX
[Part of this file has been deleted for brevity]
FT /replace=""
FT /note="ClaI fragment deleted in pSW36, constitutive
FT phenotype"
FT misc_feature 1
FT /note="last base of an XhoI site"
FT misc_feature 648..653
FT /note="end of 658bp XhoI fragment, deletion in pSW3 cause
s
FT constitutive expression of amiE"
FT conflict 1281
FT /replace="g"
FT /citation=[3]
XX
SQ Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat 6
0
ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac 12
0
aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg 18
0
aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg 24
0
agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc 30
0
ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg 36
0
tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg 42
0
agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga 48
0
acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga 54
0
ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa 60
0
gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct 66
0
acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg 72
0
cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg 78
0
ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg 84
0
aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt 90
0
acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct 96
0
tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc 102
0
tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt 108
0
acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca 114
0
gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc 120
0
agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt 126
0
ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg 132
0
cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca 138
0
gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt 144
0
gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc 150
0
gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc 156
0
cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga 162
0
tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa 168
0
gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca 174
0
ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct 180
0
gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg 186
0
aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt 192
0
catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg 198
0
gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct 204
0
gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa 210
0
ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt 216
0
cctcgag 216
7
//
You can specifiy a file of ranges to extract by giving the '-range'
qualifier the value '@' followed by the name of the file containing
the ranges. (eg: '-range @myfile').
The format of the range file is:
* Comment lines start with '#' in the first column.
* Comment lines and blank lines are ignored.
* The line may start with white-space.
* There are two positive (integer) numbers per line separated by one
or more space or TAB characters.
* The second number must be greater or equal to the first number.
* There can be optional text after the two numbers to annotate the
line.
* White-space before or after the text is removed.
An example range file is:
# this is my set of ranges
12 23
4 5 this is like 12-23, but smaller
67 10348 interesting region
Output file format
Output files for usage example
File: x13776.prettyseq
PRETTYSEQ of X13776 from 1 to 2167
---------|---------|---------|---------|---------|---------|
1 GGTACCGCTGGCCGAGCATCTGCTCGATCACCACCAGCCGGGCGACGGGAACTGCACGAT 60
---------|---------|---------|---------|---------|---------|
61 CTACCTGGCGAGCCTGGAGCACGAGCGGGTTCGCTTCGTACGGCGCTGAGCGACAGTCAC 120
---------|---------|---------|---------|---------|---------|
121 AGGAGAGGAAACGGatgggatcgcaccaggagcggccgctgatcggcctgctgttctccg 180
1 M G S H Q E R P L I G L L F S E 16
---------|---------|---------|---------|---------|---------|
181 aaaccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcg 240
17 T G V T A D I E R S H A Y G A L L A V E 36
---------|---------|---------|---------|---------|---------|
241 agcaactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc 300
37 Q L N R E G G V G G R P I E T L S Q D P 56
---------|---------|---------|---------|---------|---------|
301 ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccgggggg 360
57 G G D P D R Y R L C A E D F I R N R G V 76
---------|---------|---------|---------|---------|---------|
361 tacggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcg 420
77 R F L V G C Y M S H T R K A V M P V V E 96
---------|---------|---------|---------|---------|---------|
421 agcgcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccga 480
97 R A D A L L C Y P T P Y E G F E Y S P N 116
---------|---------|---------|---------|---------|---------|
481 acatcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctga 540
117 I V Y G G P A P N Q N S A P L A A Y L I 136
---------|---------|---------|---------|---------|---------|
541 ttcgccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa 600
137 R H Y G E R V V F I G S D Y I Y P R E S 156
---------|---------|---------|---------|---------|---------|
601 gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatct 660
157 N H V M R H L Y R Q H G G T V L E E I Y 176
---------|---------|---------|---------|---------|---------|
661 acattccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccagg 720
177 I P L Y P S D D D L Q R A V E R I Y Q A 196
[Part of this file has been deleted for brevity]
1441 GCCGGTGGACGTGGTCTTCACCAGCATTTTCCAGAATGGCCACCACGACGAGATCGCTGC 1500
---------|---------|---------|---------|---------|---------|
1501 GCTGCTCGCCGCCGGGACTCCGCGCACTACCCTGGTGGCGCTGGTGGAGTACGAAAGCCC 1560
---------|---------|---------|---------|---------|---------|
1561 CGCGGTGCTCTCGCAGATCATCGAGCTGGAGTGCCACGGCGTGATCACCCAGCCGCTCGA 1620
---------|---------|---------|---------|---------|---------|
1621 TGCCCACCGGGTGCTGCCTGTGCTGGTATCGGCGCGGCGCATCAGCGAGGAAATGGCGAA 1680
---------|---------|---------|---------|---------|---------|
1681 GCTGAAGCAGAAGACCGAGCAGCTCCAGGACCGCATCGCCGGCCAGGCCCGGATCAACCA 1740
---------|---------|---------|---------|---------|---------|
1741 GGCCAAGGTGTTGCTGATGCAGCGCCATGGCTGGGACGAGCGCGAGGCGCACCAGCACCT 1800
---------|---------|---------|---------|---------|---------|
1801 GTCGCGGGAAGCGATGAAGCGGCGCGAGCCGATCCTGAAGATCGCTCAGGAGTTGCTGGG 1860
---------|---------|---------|---------|---------|---------|
1861 AAACGAGCCGTCCGCCTGAGCGATCCGGGCCGACCAGAACAATAACAAGAGGGGTATCGT 1920
---------|---------|---------|---------|---------|---------|
1921 CATCATGCTGGGACTGGTTCTGCTGTACGTTGGCGCGGTGCTGTTTCTCAATGCCGTCTG 1980
---------|---------|---------|---------|---------|---------|
1981 GTTGCTGGGCAAGATCAGCGGTCGGGAGGTGGCGGTGATCAACTTCCTGGTCGGCGTGCT 2040
---------|---------|---------|---------|---------|---------|
2041 GAGCGCCTGCGTCGCGTTCTACCTGATCTTTTCCGCAGCAGCCGGGCAGGGCTCGCTGAA 2100
---------|---------|---------|---------|---------|---------|
2101 GGCCGGAGCGCTGACCCTGCTATTCGCTTTTACCTATCTGTGGGTGGCCGCCAACCAGTT 2160
-------
2161 CCTCGAG 2167
Data files
The codon usage table is read by default from "Ehum.cut" in the
'data/CODONS' directory of the EMBOSS distribution. If the name of a
codon usage file is specified on the command line, then this file will
first be searched for in the current directory and then in the
'data/CODONS' directory of the EMBOSS distribution.
EMBOSS data files are distributed with the application and stored in
the standard EMBOSS data directory, which is defined by the EMBOSS
environment variable EMBOSS_DATA.
To see the available EMBOSS data files, run:
% embossdata -showall
To fetch one of the data files (for example 'Exxx.dat') into your
current directory for you to inspect or modify, run:
% embossdata -fetch -file Exxx.dat
Users can provide their own data files in their own directories.
Project specific files can be put in the current directory, or for
tidier directory listings in a subdirectory called ".embossdata".
Files for all EMBOSS runs can be put in the user's home directory, or
again in a subdirectory called ".embossdata".
The directories are searched in the following order:
* . (your current directory)
* .embossdata (under your current directory)
* ~/ (your home directory)
* ~/.embossdata
Notes
None.
References
None.
Warnings
None.
Diagnostic Error Messages
"Range outside length of sequence" - this is self explanatory. You
should specify a range of sequences to translate that is within the
length of the input sequence.
Exit status
It always exits with a status of 0.
Known bugs
None.
See also
Program name Description
abiview Reads ABI file and display the trace
backtranambig Back translate a protein sequence to ambiguous codons
backtranseq Back translate a protein sequence
cirdna Draws circular maps of DNA constructs
coderet Extract CDS, mRNA and translations from feature tables
lindna Draws linear maps of DNA constructs
pepnet Displays proteins as a helical net
pepwheel Shows protein sequences as helices
plotorf Plot potential open reading frames
prettyplot Displays aligned sequences, with colouring and boxing
remap Display sequence with restriction sites, translation etc
seealso Finds programs sharing group names
showalign Displays a multiple sequence alignment
showdb Displays information on the currently available databases
showfeat Show features of a sequence
showorf Pretty output of DNA translations
showseq Display a sequence with features, translation etc
sixpack Display a DNA sequence with 6-frame translation and ORFs
textsearch Search sequence documentation. Slow, use SRS and Entrez!
transeq Translate nucleic acid sequences
showseq has more options for specifying various ways of displaying a
sequence, with or without various ways of translating it.
Author(s)
Alan Bleasby (ajb ebi.ac.uk)
European Bioinformatics Institute, Wellcome Trust Genome Campus,
Hinxton, Cambridge CB10 1SD, UK
History
Written (1999) - Alan Bleasby
Target users
This program is intended to be used by everyone and everything, from
naive users to embedded scripts.
Comments
None
|