1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217
|
stssearch
Wiki
The master copies of EMBOSS documentation are available at
http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.
Please help by correcting and extending the Wiki pages.
Function
Search a DNA database for matches with a set of STS primers
Description
stssearch searches one or more DNA sequences with a set of STS primers
and reports expected matches. The database to search, the input primer
pairs file and an output file for matches are specified. For each pair
of primers, it looks for matches between the primers and the query
sequence in either orientation. Details of any matches are written to
the output file. Only one primer need match for it to be reported.
Usage
Here is a sample session with stssearch
% stssearch
Search a DNA database for matches with a set of STS primers
Input nucleotide sequence(s): @eclac.list
Primer pairs file: lac.primers
Output file [j01636.stssearch]:
Go to the input files for this example
Go to the output files for this example
Command line arguments
Search a DNA database for matches with a set of STS primers
Version: EMBOSS:6.4.0.0
Standard (Mandatory) qualifiers:
[-seqall] seqall Nucleotide sequence(s) filename and optional
format, or reference (input USA)
[-infile] infile Primer pairs file
[-outfile] outfile [*.stssearch] Output file name
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-seqall" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory3 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
Input file format
Input files for usage example
File: eclac.list
#Formerly ECLAC
tembl:J01636
#Formerly ECLACA
tembl:X51872
#Formerly ECLACI
tembl:V00294
#Formerly ECLACY
tembl:V00295
#Formerly ECLACZ
tembl:V00296
File: lac.primers
PrimA ACCAGACACCCATCAACAG TATTTATGCCAGCCAGCCAG
PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG
PrimC CGTCAGTATCCCCGTTTACAG TATCGCCAAAATCACCGCC
PrimD AATACGCAAACCGCCTCTCC TTATCCGCTCACAATTCCACAC
PrimE AATACGCAAACCGCCTCTCC CACAACCCGCTCACAATTCCA
The primers file consists of three columns separated by tabs or spaces.
The first column is the name of the primer pair.
The second column is the sequence of the first primer.
The third column is the sequence of the second primer.
Output file format
Output files for usage example
File: j01636.stssearch
J01636: PrimA PrimerA matched at 532
J01636: (rev) PrimA PrimerB matched at 689
J01636: PrimB PrimerA matched at 5743
J01636: (rev) PrimB PrimerB matched at 5942
J01636: PrimC PrimerA matched at 2954
J01636: (rev) PrimC PrimerB matched at 3069
J01636: PrimD PrimerA matched at 1074
J01636: (rev) PrimD PrimerB matched at 1261
J01636: PrimE PrimerA matched at 1074
X51872: PrimB PrimerA matched at 98
X51872: (rev) PrimB PrimerB matched at 297
V00294: PrimA PrimerA matched at 484
V00294: (rev) PrimA PrimerB matched at 641
V00294: PrimD PrimerA matched at 1026
V00294: PrimE PrimerA matched at 1026
V00295: PrimB PrimerA matched at 1439
V00296: PrimC PrimerA matched at 1668
V00296: (rev) PrimC PrimerB matched at 1783
The output file consists of one line per match. This consists of:
* The name of the sequence that the match is found in, followed by a
':'.
* If the match is in the reverse sense, it has a '(rev)'.
* The name of the primer pair.
* 'PrimerA' or 'PrimerB'.
* 'matched at' the start of the match position.
Data files
None.
Notes
None.
References
None.
Warnings
None.
Diagnostic Error Messages
None.
Exit status
None.
Known bugs
None.
See also
Program name Description
eprimer3 Picks PCR primers and hybridization oligos
eprimer32 Picks PCR primers and hybridization oligos
primersearch Search DNA sequences for matches with primer pairs
If you want something that only reports matches of both primer pairs
and can find mismatches, use primersearch.
Author(s)
Peter Rice
European Bioinformatics Institute, Wellcome Trust Genome Campus,
Hinxton, Cambridge CB10 1SD, UK
Please report all bugs to the EMBOSS bug team
(emboss-bug (c) emboss.open-bio.org) not to the original author.
History
Target users
This program is intended to be used by everyone and everything, from
naive users to embedded scripts.
Comments
None
|