1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778
|
<HTML>
<HEAD>
<TITLE>
EMBOSS: abiview
</TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">
<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="/images/emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
abiview
</font></b>
</td></tr>
</table>
<br>
<p>
<H2>
Wiki
</H2>
The master copies of EMBOSS documentation are available
at <a href="http://emboss.open-bio.org/wiki/Appdocs">
http://emboss.open-bio.org/wiki/Appdocs</a>
on the EMBOSS Wiki.
<p>
Please help by correcting and extending the Wiki pages.
<H2>
Function
</H2>
Display the trace in an ABI sequencer file
<H2>
Description
</H2>
<p><b>abiview</b> reads in an ABI sequencer trace file and graphically displays the data. The probabilities of each of the 4 nucleotide bases along the sequencing run is plotted and the assigned nucleotide (<tt>G</tt>, <tt>A</tt>, <tt>T</tt>, <tt>C</tt> or <tt>N</tt>) from the ABI file is overlayed on the graphs. The complete sequence is written to an output file.</p>
<H2>
Usage
</H2>
Here is a sample session with <b>abiview</b>
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>abiview -graph cps </b>
Display the trace in an ABI sequencer file
ABI sequencing trace file: <b>abiview.abi</b>
nucleotide output sequence [abiview.fasta]: <b></b>
Created abiview.ps
</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>
<H2>
Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
Display the trace in an ABI sequencer file
Version: EMBOSS:6.6.0.0
Standard (Mandatory) qualifiers:
[-infile] infile ABI sequencing trace file
[-outseq] seqout [<sequence>.<format>] Nucleotide sequence
filename and optional format (output USA)
-graph xygraph [$EMBOSS_GRAPHICS value, or x11] Graph type
(ps, hpgl, hp7470, hp7580, meta, cps, x11,
tek, tekt, none, data, xterm, png, gif, pdf,
svg)
Additional (Optional) qualifiers:
-startbase integer [0] First base to report or display (Integer
0 or more)
-endbase integer [0] Last sequence base to report or display.
If the default is set to zero then the
value of this is taken as the maximum number
of bases. (Any integer value)
-yticks boolean [N] Display y-axis ticks
-[no]sequence boolean [Y] Display the sequence on the graph
-window integer [40] Sequence display window size (Any
integer value)
-bases string [GATC] Base graphs to be displayed (Any
string, matching regular expression
/[GATC]+/)
Advanced (Unprompted) qualifiers:
-separate boolean [N] Separate the trace graphs for the 4
bases
Associated qualifiers:
"-outseq" associated qualifiers
-osformat2 string Output seq format
-osextension2 string File name extension
-osname2 string Base file name
-osdirectory2 string Output directory
-osdbname2 string Database name to add
-ossingle2 boolean Separate file for each entry
-oufo2 string UFO features
-offormat2 string Features format
-ofname2 string Features file name
-ofdirectory2 string Output directory
"-graph" associated qualifiers
-gprompt boolean Graph prompting
-gdesc string Graph description
-gtitle string Graph title
-gsubtitle string Graph subtitle
-gxtitle string Graph x axis title
-gytitle string Graph y axis title
-goutfile string Output file for non interactive displays
-gdirectory string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left">Qualifier</th>
<th align="left">Type</th>
<th align="left">Description</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Standard (Mandatory) qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td>[-infile]<br>(Parameter 1)</td>
<td>infile</td>
<td>ABI sequencing trace file</td>
<td>Input file</td>
<td><b>Required</b></td>
</tr>
<tr bgcolor="#FFFFCC">
<td>[-outseq]<br>(Parameter 2)</td>
<td>seqout</td>
<td>Nucleotide sequence filename and optional format (output USA)</td>
<td>Writeable sequence</td>
<td><i><*></i>.<i>format</i></td>
</tr>
<tr bgcolor="#FFFFCC">
<td>-graph</td>
<td>xygraph</td>
<td>Graph type</td>
<td>EMBOSS has a list of known devices, including ps, hpgl, hp7470, hp7580, meta, cps, x11, tek, tekt, none, data, xterm, png, gif, pdf, svg</td>
<td><i>EMBOSS_GRAPHICS</i> value, or x11</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Additional (Optional) qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td>-startbase</td>
<td>integer</td>
<td>First base to report or display</td>
<td>Integer 0 or more</td>
<td>0</td>
</tr>
<tr bgcolor="#FFFFCC">
<td>-endbase</td>
<td>integer</td>
<td>Last sequence base to report or display. If the default is set to zero then the value of this is taken as the maximum number of bases.</td>
<td>Any integer value</td>
<td>0</td>
</tr>
<tr bgcolor="#FFFFCC">
<td>-yticks</td>
<td>boolean</td>
<td>Display y-axis ticks</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>
<tr bgcolor="#FFFFCC">
<td>-[no]sequence</td>
<td>boolean</td>
<td>Display the sequence on the graph</td>
<td>Boolean value Yes/No</td>
<td>Yes</td>
</tr>
<tr bgcolor="#FFFFCC">
<td>-window</td>
<td>integer</td>
<td>Sequence display window size</td>
<td>Any integer value</td>
<td>40</td>
</tr>
<tr bgcolor="#FFFFCC">
<td>-bases</td>
<td>string</td>
<td>Base graphs to be displayed</td>
<td>Any string, matching regular expression /[GATC]+/</td>
<td>GATC</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Advanced (Unprompted) qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td>-separate</td>
<td>boolean</td>
<td>Separate the trace graphs for the 4 bases</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Associated qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-outseq" associated seqout qualifiers
</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -osformat2<br>-osformat_outseq</td>
<td>string</td>
<td>Output seq format</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -osextension2<br>-osextension_outseq</td>
<td>string</td>
<td>File name extension</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -osname2<br>-osname_outseq</td>
<td>string</td>
<td>Base file name</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -osdirectory2<br>-osdirectory_outseq</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -osdbname2<br>-osdbname_outseq</td>
<td>string</td>
<td>Database name to add</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -ossingle2<br>-ossingle_outseq</td>
<td>boolean</td>
<td>Separate file for each entry</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -oufo2<br>-oufo_outseq</td>
<td>string</td>
<td>UFO features</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -offormat2<br>-offormat_outseq</td>
<td>string</td>
<td>Features format</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -ofname2<br>-ofname_outseq</td>
<td>string</td>
<td>Features file name</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -ofdirectory2<br>-ofdirectory_outseq</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-graph" associated xygraph qualifiers
</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -gprompt</td>
<td>boolean</td>
<td>Graph prompting</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -gdesc</td>
<td>string</td>
<td>Graph description</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -gtitle</td>
<td>string</td>
<td>Graph title</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -gsubtitle</td>
<td>string</td>
<td>Graph subtitle</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -gxtitle</td>
<td>string</td>
<td>Graph x axis title</td>
<td>Any string</td>
<td>Residue Position</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -gytitle</td>
<td>string</td>
<td>Graph y axis title</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -goutfile</td>
<td>string</td>
<td>Output file for non interactive displays</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -gdirectory</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>General qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td> -auto</td>
<td>boolean</td>
<td>Turn off prompts</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -stdout</td>
<td>boolean</td>
<td>Write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -filter</td>
<td>boolean</td>
<td>Read first file from standard input, write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -options</td>
<td>boolean</td>
<td>Prompt for standard and additional values</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -debug</td>
<td>boolean</td>
<td>Write debug output to program.dbg</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -verbose</td>
<td>boolean</td>
<td>Report some/full command line options</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -help</td>
<td>boolean</td>
<td>Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -warning</td>
<td>boolean</td>
<td>Report warnings</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -error</td>
<td>boolean</td>
<td>Report errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -fatal</td>
<td>boolean</td>
<td>Report fatal errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -die</td>
<td>boolean</td>
<td>Report dying program messages</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -version</td>
<td>boolean</td>
<td>Report version number and exit</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
</table>
<H2>
Input file format
</H2>
This reads in a standard ABI trace file.
<p>
<a name="input.1"></a>
<h3>Input files for usage example </h3>
<p><h3>File: abiview.abi</h3>
<p>This file contains non-printing characters and so cannot be displayed here.
<p><h3>File: abiview.abi</h3>
<p>This file contains non-printing characters and so cannot be displayed here.
<H2>
Output file format
</H2>
It outputs a file holding a normal nucleotide sequence.
<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: abiview.fasta</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
>abiview
GNNNNNNNNNGNGNNGGGGTTTNANNNTNNNAGAACCCCCCTTNGAAAANNNCCACCCCA
NNATAGTNGTANGAATAGTNCCCAGGCCANGCCTATCTGTGATGATTACATAGGCTAACA
CATGACAAACATTTAAAAACACTAAACAATTGTTATTTATTCTTTGTTCCTATAAACCAC
ACCCATTAAGCCCTTACTATATATAAGAGTTTTCAAGCCAAGAACCTGCTGCTTGGGAGG
CTGATGCAGGAGAATTGCCAAGTACAAACCCTGCCTGGACTGTAAAGTGAAACCAAGGCT
AGTTGTCTCACAATAAAAGATGAAGGGCAAGTGGGATCAATGCATAAAGGAGCTTGTGCC
CAAGCCTGTTAGCCTTAGTTCAATTCCTGAGTACCATGAAAAGGTAGAAGGAGAGAAATG
ATTTGGTACAATTTTTCTCTGTGCTGTGACACAGTACCACCCTCCTACTAATAACAAATA
AAATAATGTTTAAAACAAAATAAAATAAAAATGGACTGGGATGTAGCACAATGGTAGGGT
ACTTGCATAGCATGTACAAGGACCTGATTTCAATCCCCTGTGATAAAAGAAAATAAGGAA
GGGAGGAAGCGTTAGGAGGAAAAATGGAATACAGAAGACACAGTGCATGGGAAGGATATG
TATGTTATGAACACCAGAAATTCACTTGAAAATGAGTAAAATTTTTTTATTATTATATCA
TTATTATTGGGGGGGATGTGGGCGGGGCTTGCAGAGGTATCTTTTAGAGGANGATCATTT
TCCGGTTGTTGAGCAGGGCTCTGTTATGTAGGATATCTCAGANTAACAGACCCCAGGT
</pre>
</td></tr></table><p>
<p><h3>Graphics File: abiview.ps</h3>
<p><img src="abiview.1.abiview.gif" alt="[abiview results]">
<p>
The horizontal scale of the output image labelled 'Residue Position' is
only a very approximate indication of the spacing of residues in the
image. The real residue spacing is variable, as it relies on the speed
with which the oligo-nucleotides are eluted in the ABI sequencer. Do
not be surprised to see the nucleotide signals spaced at a much greater
distance than the horizontal scale might suggest.
<H2>
Data files
</H2>
None.
<H2>
Notes
</H2>
<p>An ABI file (<tt>*.abi</tt>) contains sequence trace data and base calls from a run of an ABI nucleotide sequencer machine. A trace data file is what you get back from having some DNA sequenced, for example, by a 3730XL sequencer. The files are in "binary" format and so cannot be viewed directly on screen. To inspect the sequencing data you must use a trace viewer such as <b>abiview</b>. Another good trace viewer is FinchTV (<a href="http://www.geospiza.com/finchtv/">http://www.geospiza.com/finchtv/</a>). It is a stand-alone program and is freely available.</p>
<H2>
References
</H2>
None.
<H2>
Warnings
</H2>
None.
<H2>
Diagnostic Error Messages
</H2>
None.
<H2>
Exit status
</H2>
It always exits with status 0.
<H2>
Known bugs
</H2>
None.
<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th>
<th>Description</th></tr>
<tr>
<td><a href="cirdna.html">cirdna</a></td>
<td>Draw circular map of DNA constructs</td>
</tr>
<tr>
<td><a href="coderet.html">coderet</a></td>
<td>Extract CDS, mRNA and translations from feature tables</td>
</tr>
<tr>
<td><a href="entret.html">entret</a></td>
<td>Retrieve sequence entries from flatfile databases and files</td>
</tr>
<tr>
<td><a href="extractalign.html">extractalign</a></td>
<td>Extract regions from a sequence alignment</td>
</tr>
<tr>
<td><a href="iep.html">iep</a></td>
<td>Calculate the isoelectric point of proteins</td>
</tr>
<tr>
<td><a href="infoalign.html">infoalign</a></td>
<td>Display basic information about a multiple sequence alignment</td>
</tr>
<tr>
<td><a href="infoseq.html">infoseq</a></td>
<td>Display basic information about sequences</td>
</tr>
<tr>
<td><a href="lindna.html">lindna</a></td>
<td>Draw linear maps of DNA constructs</td>
</tr>
<tr>
<td><a href="pepinfo.html">pepinfo</a></td>
<td>Plot amino acid properties of a protein sequence in parallel</td>
</tr>
<tr>
<td><a href="pepnet.html">pepnet</a></td>
<td>Draw a helical net for a protein sequence</td>
</tr>
<tr>
<td><a href="pepwheel.html">pepwheel</a></td>
<td>Draw a helical wheel diagram for a protein sequence</td>
</tr>
<tr>
<td><a href="plotorf.html">plotorf</a></td>
<td>Plot potential open reading frames in a nucleotide sequence</td>
</tr>
<tr>
<td><a href="prettyplot.html">prettyplot</a></td>
<td>Draw a sequence alignment with pretty formatting</td>
</tr>
<tr>
<td><a href="prettyseq.html">prettyseq</a></td>
<td>Write a nucleotide sequence and its translation to file</td>
</tr>
<tr>
<td><a href="refseqget.html">refseqget</a></td>
<td>Get reference sequence</td>
</tr>
<tr>
<td><a href="remap.html">remap</a></td>
<td>Display restriction enzyme binding sites in a nucleotide sequence</td>
</tr>
<tr>
<td><a href="seqxref.html">seqxref</a></td>
<td>Retrieve all database cross-references for a sequence entry</td>
</tr>
<tr>
<td><a href="seqxrefget.html">seqxrefget</a></td>
<td>Retrieve all cross-referenced data for a sequence entry</td>
</tr>
<tr>
<td><a href="showalign.html">showalign</a></td>
<td>Display a multiple sequence alignment in pretty format</td>
</tr>
<tr>
<td><a href="showfeat.html">showfeat</a></td>
<td>Display features of a sequence in pretty format</td>
</tr>
<tr>
<td><a href="showpep.html">showpep</a></td>
<td>Display protein sequences with features in pretty format</td>
</tr>
<tr>
<td><a href="sixpack.html">sixpack</a></td>
<td>Display a DNA sequence with 6-frame translation and ORFs</td>
</tr>
<tr>
<td><a href="variationget.html">variationget</a></td>
<td>Get sequence variations</td>
</tr>
<tr>
<td><a href="whichdb.html">whichdb</a></td>
<td>Search all sequence databases for an entry and retrieve it</td>
</tr>
</table>
<H2>
Author(s)
</H2>
Tim Carver formerly at:
<br>
MRC Rosalind Franklin Centre for Genomics Research
Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK
<p>
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.
<H2>
History
</H2>
Written (January 2001) - Tim Carver
<H2>
Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.
<H2>
Comments
</H2>
None
</BODY>
</HTML>
|