1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004
|
<HTML>
<HEAD>
<TITLE>
EMBOSS: einverted
</TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">
<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="/images/emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
einverted
</font></b>
</td></tr>
</table>
<br>
<p>
<H2>
Wiki
</H2>
The master copies of EMBOSS documentation are available
at <a href="http://emboss.open-bio.org/wiki/Appdocs">
http://emboss.open-bio.org/wiki/Appdocs</a>
on the EMBOSS Wiki.
<p>
Please help by correcting and extending the Wiki pages.
<H2>
Function
</H2>
Find inverted repeats in nucleotide sequences
<H2>
Description
</H2>
<p><b>einverted</b> finds inverted repeats (stem loops) in nucleotide sequences. It identifies regions of local alignment of the input sequence and its reverse complement that exceed a threshold score. The alignments may include a proportion of mismatches and gaps, which correspond to bulges in the stem loop. One or more sequences are read and a file with the sequence(s) (without gap characters) of the inverted repeat regions is written. It can find multiple inverted repeats in a sequence. Only non-overlapping matches are reported.</p>
<H2>Algorithm</H2>
<p><b>einverted</b> uses dynamic programming and thus is guaranteed to find optimal, local alignments between the sequence and its reverse complement. Matched bases contribute positively to the score whereas gaps and mismatches are penalised. The score for a local alignment is the sum of the values of each match, minus penalties for mismatches and gap insertion. Any region whose score exceeds the threshold is reported. The gap penalty, match score and mismatch score, and the threshold score for reporting regions, are all user-specified.</p>
<H2>
Usage
</H2>
Here is a sample session with <b>einverted</b>
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>einverted tembl:d00596 </b>
Find inverted repeats in nucleotide sequences
Gap penalty [12]: <b></b>
Minimum score threshold [50]: <b></b>
Match score [3]: <b></b>
Mismatch score [-4]: <b></b>
Sanger Centre program inverted output file [d00596.inv]: <b></b>
File for sequence of regions of inverted repeats. [d00596.fasta]: <b></b>
</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>
<H2>
Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
Find inverted repeats in nucleotide sequences
Version: EMBOSS:6.6.0.0
Standard (Mandatory) qualifiers:
[-sequence] seqall Nucleotide sequence(s) filename and optional
format, or reference (input USA)
-gap integer [12] Gap penalty (Integer 0 or more)
-threshold integer [50] Minimum score threshold (Integer 0 or
more)
-match integer [3] Match score (Integer 0 or more)
-mismatch integer [-4] Mismatch score (Integer up to 0)
[-outfile] outfile [*.einverted] Sanger Centre program inverted
output file
[-outseq] seqout [<sequence>.<format>] The sequence of the
inverted repeat regions without gap
characters.
Additional (Optional) qualifiers:
-maxrepeat integer [2000] Maximum separation between the start
of repeat and the end of the inverted
repeat. (Integer 0 or more)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-scircular1 boolean Sequence is circular
-squick1 boolean Read id and sequence only
-sformat1 string Input sequence format
-iquery1 string Input query fields or ID list
-ioffset1 integer Input start position offset
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
"-outseq" associated qualifiers
-osformat3 string Output seq format
-osextension3 string File name extension
-osname3 string Base file name
-osdirectory3 string Output directory
-osdbname3 string Database name to add
-ossingle3 boolean Separate file for each entry
-oufo3 string UFO features
-offormat3 string Features format
-ofname3 string Features file name
-ofdirectory3 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left">Qualifier</th>
<th align="left">Type</th>
<th align="left">Description</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Standard (Mandatory) qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td>[-sequence]<br>(Parameter 1)</td>
<td>seqall</td>
<td>Nucleotide sequence(s) filename and optional format, or reference (input USA)</td>
<td>Readable sequence(s)</td>
<td><b>Required</b></td>
</tr>
<tr bgcolor="#FFFFCC">
<td>-gap</td>
<td>integer</td>
<td>Gap penalty</td>
<td>Integer 0 or more</td>
<td>12</td>
</tr>
<tr bgcolor="#FFFFCC">
<td>-threshold</td>
<td>integer</td>
<td>Minimum score threshold</td>
<td>Integer 0 or more</td>
<td>50</td>
</tr>
<tr bgcolor="#FFFFCC">
<td>-match</td>
<td>integer</td>
<td>Match score</td>
<td>Integer 0 or more</td>
<td>3</td>
</tr>
<tr bgcolor="#FFFFCC">
<td>-mismatch</td>
<td>integer</td>
<td>Mismatch score</td>
<td>Integer up to 0</td>
<td>-4</td>
</tr>
<tr bgcolor="#FFFFCC">
<td>[-outfile]<br>(Parameter 2)</td>
<td>outfile</td>
<td>Sanger Centre program inverted output file</td>
<td>Output file</td>
<td><i><*></i>.einverted</td>
</tr>
<tr bgcolor="#FFFFCC">
<td>[-outseq]<br>(Parameter 3)</td>
<td>seqout</td>
<td>The sequence of the inverted repeat regions without gap characters.</td>
<td>Writeable sequence</td>
<td><i><*></i>.<i>format</i></td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Additional (Optional) qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td>-maxrepeat</td>
<td>integer</td>
<td>Maximum separation between the start of repeat and the end of the inverted repeat.</td>
<td>Integer 0 or more</td>
<td>2000</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Advanced (Unprompted) qualifiers</th>
</tr>
<tr>
<td colspan=5>(none)</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Associated qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-sequence" associated seqall qualifiers
</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sbegin1<br>-sbegin_sequence</td>
<td>integer</td>
<td>Start of each sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -send1<br>-send_sequence</td>
<td>integer</td>
<td>End of each sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sreverse1<br>-sreverse_sequence</td>
<td>boolean</td>
<td>Reverse (if DNA)</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sask1<br>-sask_sequence</td>
<td>boolean</td>
<td>Ask for begin/end/reverse</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -snucleotide1<br>-snucleotide_sequence</td>
<td>boolean</td>
<td>Sequence is nucleotide</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sprotein1<br>-sprotein_sequence</td>
<td>boolean</td>
<td>Sequence is protein</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -slower1<br>-slower_sequence</td>
<td>boolean</td>
<td>Make lower case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -supper1<br>-supper_sequence</td>
<td>boolean</td>
<td>Make upper case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -scircular1<br>-scircular_sequence</td>
<td>boolean</td>
<td>Sequence is circular</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -squick1<br>-squick_sequence</td>
<td>boolean</td>
<td>Read id and sequence only</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sformat1<br>-sformat_sequence</td>
<td>string</td>
<td>Input sequence format</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -iquery1<br>-iquery_sequence</td>
<td>string</td>
<td>Input query fields or ID list</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -ioffset1<br>-ioffset_sequence</td>
<td>integer</td>
<td>Input start position offset</td>
<td>Any integer value</td>
<td>0</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sdbname1<br>-sdbname_sequence</td>
<td>string</td>
<td>Database name</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sid1<br>-sid_sequence</td>
<td>string</td>
<td>Entryname</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -ufo1<br>-ufo_sequence</td>
<td>string</td>
<td>UFO features</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -fformat1<br>-fformat_sequence</td>
<td>string</td>
<td>Features format</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -fopenfile1<br>-fopenfile_sequence</td>
<td>string</td>
<td>Features file name</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-outfile" associated outfile qualifiers
</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -odirectory2<br>-odirectory_outfile</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-outseq" associated seqout qualifiers
</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -osformat3<br>-osformat_outseq</td>
<td>string</td>
<td>Output seq format</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -osextension3<br>-osextension_outseq</td>
<td>string</td>
<td>File name extension</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -osname3<br>-osname_outseq</td>
<td>string</td>
<td>Base file name</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -osdirectory3<br>-osdirectory_outseq</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -osdbname3<br>-osdbname_outseq</td>
<td>string</td>
<td>Database name to add</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -ossingle3<br>-ossingle_outseq</td>
<td>boolean</td>
<td>Separate file for each entry</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -oufo3<br>-oufo_outseq</td>
<td>string</td>
<td>UFO features</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -offormat3<br>-offormat_outseq</td>
<td>string</td>
<td>Features format</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -ofname3<br>-ofname_outseq</td>
<td>string</td>
<td>Features file name</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -ofdirectory3<br>-ofdirectory_outseq</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>General qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td> -auto</td>
<td>boolean</td>
<td>Turn off prompts</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -stdout</td>
<td>boolean</td>
<td>Write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -filter</td>
<td>boolean</td>
<td>Read first file from standard input, write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -options</td>
<td>boolean</td>
<td>Prompt for standard and additional values</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -debug</td>
<td>boolean</td>
<td>Write debug output to program.dbg</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -verbose</td>
<td>boolean</td>
<td>Report some/full command line options</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -help</td>
<td>boolean</td>
<td>Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -warning</td>
<td>boolean</td>
<td>Report warnings</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -error</td>
<td>boolean</td>
<td>Report errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -fatal</td>
<td>boolean</td>
<td>Report fatal errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -die</td>
<td>boolean</td>
<td>Report dying program messages</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -version</td>
<td>boolean</td>
<td>Report version number and exit</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
</table>
<H2>
Input file format
</H2>
The input for <b>einverted</b> is a nucleotide sequence
<p>
<a name="input.1"></a>
<h3>Input files for usage example </h3>
'tembl:d00596' is a sequence entry in the example nucleic acid database 'tembl'
<p>
<p><h3>Database entry: tembl:d00596</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
ID D00596; SV 1; linear; genomic DNA; STD; HUM; 18596 BP.
XX
AC D00596;
XX
DT 17-JUL-1991 (Rel. 28, Created)
DT 07-DEC-2007 (Rel. 94, Last updated, Version 6)
XX
DE Homo sapiens gene for thymidylate synthase, complete cds.
XX
KW .
XX
OS Homo sapiens (human)
OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC Homo.
XX
RN [1]
RP 1-18596
RX PUBMED; 2243092.
RA Kaneda S., Nalbantoglu J., Takeishi K., Shimizu K., Gotoh O., Seno T.,
RA Ayusawa D.;
RT "Structural and functional analysis of the human thymidylate synthase
RT gene";
RL J Biol Chem 265(33):20277-20284(1990).
XX
DR Ensembl-Gn; ENSG00000176890; Homo_sapiens.
DR Ensembl-Tr; ENST00000323274; Homo_sapiens.
DR GDB; 163670.
DR GDB; 182340.
XX
CC These data kindly submitted in computer readable form by:
CC Sumiko Kaneda
CC National Institute of Genetics
CC 1111 Yata
CC Mishima 411
CC Japan
XX
FH Key Location/Qualifiers
FH
FT source 1..18596
FT /organism="Homo sapiens"
FT /chromosome="18"
FT /map="18p11.32"
FT /mol_type="genomic DNA"
FT /clone="lambdaHTS-1 and lambdaHTS-3"
FT /db_xref="taxon:9606"
FT repeat_region 1..148
FT /rpt_family="Alu"
FT repeat_region 202..477
FT /rpt_family="Alu"
<font color=red> [Part of this file has been deleted for brevity]</font>
ttttgttttt agcttcagcg agaacccaga cctttcccaa agctcaggat tcttcgaaaa 15660
gttgagaaaa ttgatgactt caaagctgaa gactttcaga ttgaagggta caatccgcat 15720
ccaactatta aaatggaaat ggctgtttag ggtgctttca aaggagctcg aaggatattg 15780
tcagtcttta ggggttgggc tggatgccga ggtaaaagtt ctttttgctc taaaagaaaa 15840
aggaactagg tcaaaaatct gtccgtgacc tatcagttat taatttttaa ggatgttgcc 15900
actggcaaat gtaactgtgc cagttctttc cataataaaa ggctttgagt taactcactg 15960
agggtatctg acaatgctga ggttatgaac aaagtgagga gaatgaaatg tatgtgctct 16020
tagcaaaaac atgtatgtgc atttcaatcc cacgtactta taaagaaggt tggtgaattt 16080
cacaagctat ttttggaata tttttagaat attttaagaa tttcacaagc tattccctca 16140
aatctgaggg agctgagtaa caccatcgat catgatgtag agtgtggtta tgaactttaa 16200
agttatagtt gttttatatg ttgctataat aaagaagtgt tctgcattcg tccacgcttt 16260
gttcattctg tactgccact tatctgctca gttccttcct aaaatagatt aaagaactct 16320
ccttaagtaa acatgtgctg tattctggtt tggatgctac ttaaaagagt atattttaga 16380
aataatagtg aatatatttt gccctatttt tctcatttta actgcatctt atcctcaaaa 16440
tataatgacc atttaggata gagttttttt tttttttttt taaactttta taaccttaaa 16500
gggttatttt aaaataatct atggactacc attttgccct cattagcttc agcatggtgt 16560
gacttctcta ataatatgct tagattaagc aaggaaaaga tgcaaaacca cttcggggtt 16620
aatcagtgaa atatttttcc cttcgttgca taccagatac ccccggtgtt gcacgactat 16680
ttttattctg ctaatttatg acaagtgtta aacagaacaa ggaattattc caacaagtta 16740
tgcaacatgt tgcttatttt caaattacag tttaatgtct aggtgccagc ccttgatata 16800
gctatttttg taagaacatc ctcctggact ttgggttagt taaatctaaa cttatttaag 16860
gattaagtag gataacgtgc attgatttgc taaaagaatc aagtaataat tacttagctg 16920
attcctgagg gtggtatgac ttctagctga actcatcttg atcggtagga ttttttaaat 16980
ccatttttgt aaaactattt ccaagaaatt ttaagccctt tcacttcaga aagaaaaaag 17040
ttgttggggc tgagcactta attttcttga gcaggaagga gtttcttcca aacttcacca 17100
tctggagact ggtgtttctt tacagattcc tccttcattt ctgttgagta gccgggatcc 17160
tatcaaagac caaaaaaatg agtcctgtta acaaccacct ggaacaaaaa cagattttat 17220
gcatttatgc tgctccaaga aatgctttta cgtctaagcc agaggcaatt aattaatttt 17280
tttttttttg acatggagtc actgtccgtt gcccaggctg cagtgcagtg gcgcaatctt 17340
ggctcactgc aacctccacc tcccaggttc aagtgattct cctgcctcag cctcccatgt 17400
agctgggatc acaggcacct gccaccatgc ccggctaatt ttttgtattt tttgtagaga 17460
cagggtttca ccatgttggc caggctggtc tcaaacacct gacctcaaat gatccacctg 17520
cctcagcctc ccaaagtgtt gggattacag gcgtaagcca ccatgcccag ccctgaatta 17580
atatttttaa aataagtttg gagactgttg gaaataatag ggcagaggaa catattttac 17640
tggctacttg ccagagttag ttaactcatc aaactctttg ataatagttt gacctctgtt 17700
ggtgaaaatg agccatgatc tcttgaacat gatcagaata aatgccccag ccacacaatt 17760
gtagtccaaa ctttttaggt cactaacttg ctagatggtg ccaggttttt ttgcacaagg 17820
agtgcaaatg ttaagatctc cactagtgag gaaaggctag tattacagaa gccttgtcag 17880
aggcaattga acctccaagc cctggccctc aggcctgagg attttgatac agacaaactg 17940
aagaaccgtt tgttagtgga tattgcaaac aaacaggagt caaagcttgg tgctccacag 18000
tctagttcac gagacaggcg tggcagtggc tggcagcatc tcttctcaca ggggccctca 18060
ggcacagctt accttgggag gcatgtagga agcccgctgg atcatcacgg gatacttgaa 18120
atgctcatgc aggtggtcaa catactcaca caccctagga ggagggaatc agatcggggc 18180
aatgatgcct gaagtcagat tattcacgtg gtgctaactt aaagcagaag gagcgagtac 18240
cactcaattg acagtgttgg ccaaggctta gctgtgttac catgcgtttc taggcaagtc 18300
cctaaacctc tgtgcctcag gtccttttct tctaaaatat agcaatgtga ggtggggact 18360
ttgatgacat gaacacacga agtccctctg agaggttttg tggtgccctt taaaagggat 18420
caattcagac tctgtaaata tccagaatta tttgggttcc tctggtcaaa agtcagatga 18480
atagattaaa atcaccacat tttgtgatct atttttcaag aagcgtttgt attttttcat 18540
atggctgcag cagctgccag gggcttgggg tttttttggc aggtagggtt gggagg 18596
//
</pre>
</td></tr></table><p>
<H2>
Output file format
</H2>
<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: d00596.fasta</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
>D00596_13_142
gctacgcgagaggctgaggcagcagaattacttgaacccaggaggcggaggttgcagtga
gccgagatcgcgccactgcactccagcctgggtgagagagcgagactctgtctcaaaaaa
aaaaaaaaaa
>D00596_199_328
ttttttttttttttttttgggacagtcttgctctgtcgcccaggctggagtacaatggtc
ggatcttggctcactgcaacctctgcctcccaggttcaagcaattcttctgcctcagcct
cccaagtagc
>D00596_12128_12301
agaggatttttttttttttttttttttttgagacagagttttgctctgttgcccaggctg
gaatgcaacggcgtgatcttggctcactgtaacctctgcctcctgggttcgagtgattct
cctgcctcagcctccaagtagctgggattacagcatgtgccaccatgcctggct
>D00596_12573_12749
agccaggtgtggtggctcacacctgtaattccaacaactccagaggccaaggcgagagga
tcatttgaacccacggaatttgaggctgtagtgagtcatgatcacgccattgcactccat
cctgggcaacagagtgagaccctgaatatttaaaaacaacaacaacaacaaaactct
>D00596_12246_12296
ctcctgcctcagcctccaagtagctgggattacagcatgtgccaccatgcc
>D00596_13886_13938
ggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggag
>D00596_13884_13949
tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaatt
gcttga
>D00596_14628_14692
tcaagcaattcttctgcctcagcctcccaggtagctgggattacaggcacatgccaccac
accca
</pre>
</td></tr></table><p>
<p><h3>File: d00596.inv</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
D00596: Score 236: 108/130 ( 83%) matches, 0 gaps
13 gctacgcgagaggctgaggcagcagaattacttgaacccaggaggcggaggttgcagtgagccgagatcgcgccactgcactccagcctgggtgagagagcgagactctgtctcaaaaaaaaaaaaaaaa 142
||||| | ||||||||||||| |||||| |||||||| |||||| |||||||||||||||| ||||| ||| || ||||||||||||| || ||||| ||||| | | ||||||||||||||||
328 cgatgaaccctccgactccgtcttcttaacgaacttggaccctccgtctccaacgtcactcggttctaggctggtaacatgaggtcggacccgctgtctcgttctgacagggtttttttttttttttttt 199
D00596: Score 164: 128/174 ( 73%) matches, 3 gaps
12128 agaggatttttttttttttttttttttttgagacagagttttgctctgttgcccaggctggaatgcaacggcgtgatcttggctcactgtaacctctgcctcc-tgggttcgagtgattctcctgcctcagcctc-caagtagctgggattaca-gcatgtgccaccatgcctggct 12301
|||| || || || || || ||||| | ||| || | |||||||||||||| |||| ||||| ||||||||| || |||||| | |||| ||| ||||||| | |||| ||| |||| ||||| ||| | ||| |||||| | || ||||||| |||||||
12749 tctcaaaacaacaacaacaacaaaaatttataagtcccagagtgagacaacgggtcctacctcacgttaccgcactagtactgagtgatgtcggagtttaaggcacccaagtttactaggagagcggaaccggagacctcaacaaccttaatgtccacactcggtggtgtggaccga 12573
D00596: Score 80: 44/51 ( 86%) matches, 2 gaps
12246 ctcctgcctcag-cctccaagtagctgggattaca-gcatgtgccaccatgcc 12296
|||||| ||||| | ||||| |||||||||||| ||||| |||||||| ||
13938 gaggacagagtcagaaggtttcacgaccctaatgtccgtactcggtggtatgg 13886
D00596: Score 99: 53/65 ( 81%) matches, 1 gaps
13884 tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaattgcttga 13949
||||| ||||||| |||||||||||||||| ||| || ||||| ||| || ||||||||||
14692 acccacaccaccgtacacggacattagggtcgatggaccctccgactccgtcttc-ttaacgaact 14628
</pre>
</td></tr></table><p>
<H2>
Data files
</H2>
None.
<H2>
Notes
</H2>
<p>The original "inverted" program (from which <b>einverted</b> was derived) was used to annotate the nematode genome. Excluding overlapping repeats saved problems with simple repeat sequences in this genome. </p>
<p><b>einverted</b> will find optimal alignments but is slower than heuristic methods such as BLAST.</p>
Sometimes you can find repeats using the program <b>palindrome</b> that
you can't find with <b>einverted</b> using the default parameters.
<p>
This is not due to a problem with either program. It is simply because
some of the shortest repeats that you find with <b>palindrome</b>'s
default parameter values are below <b>einverted</b>'s default cutoff
score - you should decrease the 'Minimum score threshold' to see them.
<p>
For example, when <b>palindrome</b> is run with 'em:x65921',
it finds the repeat:
<p>
<pre>
64 aaaactaaggc 74
|||||||||||
98 ttttgattccg 88
</pre>
<p>
<b>einverted</b> will not report this as its score is 33 (11 bases
scoring 3 each, no mismatches or gaps) which is below the default score
cutoff of 50.
<p>
If <b>einverted</b> is run as:
<p>
% einverted em:x65921 -threshold 30
<p>
then it will find it:
<p>
<pre>
Score 33: 11/11 (100%) matches, 0 gaps
64 aaaactaaggc 74
|||||||||||
98 ttttgattccg 88
</pre>
<p>
Anything can be considered to be a repeat if you set the score
threshold low enough!
<p>
<b>einverted</b> does not report overlapping matches.
<H2>
References
</H2>
Some useful references on inverted repeats:
<p>
<ol>
<li>
Pearson CE, Zorbas H, Price GB, Zannis-Hadjopoulos M Inverted repeats,
stem-loops, and cruciforms: significance for initiation of DNA
replication. J Cell Biochem 1996 Oct;63(1):1-22
<li>
Waldman AS, Tran H, Goldsmith EC, Resnick MA. q Long inverted repeats
are an at-risk motif for recombination in mammalian cells.
Genetics. 1999 Dec;153(4):1873-83. PMID: 10581292; UI: 20050682
<li>
Jacobsen SE
Gene silencing: Maintaining methylation patterns.
Curr Biol 1999 Aug 26;9(16):R617-9
<li>
Lewis S, Akgun E, Jasin M.
Palindromic DNA and genome stability. Further studies.
Ann N Y Acad Sci. 1999 May 18;870:45-57.
PMID: 10415472; UI: 99343961
<li>
Dai X, Greizerstein MB, Nadas-Chinni K, Rothman-Denes LB
Supercoil-induced extrusion of a regulatory DNA hairpin. Proc Natl
Acad Sci U S A 1997 Mar 18;94(6):2174-9
</ol>
<H2>
Warnings
</H2>
None.
<H2>
Diagnostic Error Messages
</H2>
None.
<H2>
Exit status
</H2>
It always exits with a status of 0.
<H2>
Known bugs
</H2>
None.
<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th>
<th>Description</th></tr>
<tr>
<td><a href="banana.html">banana</a></td>
<td>Plot bending and curvature data for B-DNA</td>
</tr>
<tr>
<td><a href="btwisted.html">btwisted</a></td>
<td>Calculate the twisting in a B-DNA sequence</td>
</tr>
<tr>
<td><a href="equicktandem.html">equicktandem</a></td>
<td>Find tandem repeats in nucleotide sequences</td>
</tr>
<tr>
<td><a href="etandem.html">etandem</a></td>
<td>Find tandem repeats in a nucleotide sequence</td>
</tr>
<tr>
<td><a href="palindrome.html">palindrome</a></td>
<td>Find inverted repeats in nucleotide sequence(s)</td>
</tr>
<tr>
<td><a href="sirna.html">sirna</a></td>
<td>Find siRNA duplexes in mRNA</td>
</tr>
</table>
<b>palindrome</b> also looks for inverted repeats but is much faster
and less sensitive, as it looks for near-perfect repeats.
<H2>
Author(s)
</H2>
This program was originally written by
Richard Durbin
<br>
Sanger Institute, Wellcome Trust Genome Campus, Hinxton,
Cambridge, CB10 1SA, UK.
<p>
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.
<p>
This application was modified for inclusion in EMBOSS by
Peter Rice
<br>
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK
<p>
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.
<H2>
History
</H2>
Written (1999) - Peter Rice
<H2>
Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.
<H2>
Comments
</H2>
None
</BODY>
</HTML>
|