File: eprimer32.html

package info (click to toggle)
emboss 6.6.0%2Bdfsg-1
links: PTS, VCS
area: main
in suites: jessie, jessie-kfreebsd
size: 571,248 kB
ctags: 39,971
sloc: ansic: 460,578; java: 29,439; perl: 13,573; sh: 12,740; makefile: 3,275; csh: 706; asm: 351; xml: 239; pascal: 237; modula3: 8
file content (1989 lines) | stat: -rw-r--r-- 89,189 bytes
parent folder | download | duplicates (6)
<HTML>
<HEAD>
  <TITLE>
  EMBOSS: eprimer32
  </TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">

<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="/images/emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
eprimer32
</font></b>
</td></tr>
</table>
<br>&nbsp;
<p>

<H2>
Wiki
</H2>

The master copies of EMBOSS documentation are available
at <a href="http://emboss.open-bio.org/wiki/Appdocs">
http://emboss.open-bio.org/wiki/Appdocs</a>
on the EMBOSS Wiki.

<p>
Please help by correcting and extending the Wiki pages.

<H2>
    Function
</H2>
Pick PCR primers and hybridization oligos
<H2>
    Description
</H2>

<b>eprimer32</b> is an interface to the 'primer3' program (2.x series)
from the Whitehead Institute. 

<p>

The Whitehead program must be set up and on the path in order for
<b>eprimer32</b> to find and run it. The Whitehead executable must
be renamed to primer32_core (or a link added) to avoid conflict
with the <b>eprimer3</b> application.

<p>

Primer3 picks primers for PCR reactions, considering as criteria:
<p>

<UL>
<LI>oligonucleotide melting temperature, size, GC content,
  and primer-dimer possibilities

<LI>PCR product size

<LI>positional constraints within the source sequence

<LI>miscellaneous other constraints.
</UL>

<p>

All of these criteria are user-specifiable as constraints.

<p>

<b>eprimer32</b> can also pick hybridisation oligos that are internal to
the product. 


<H3>Advice for picking primers</H3>

We suggest referring to: Wojciech Rychlik, "Selection of Primers
for Polymerase Chain Reaction" in BA White, Ed., "Methods in
Molecular Biology, Vol. 15: PCR Protocols: Current Methods and
Applications", 1993, pp 31-40, Humana Press, Totowa NJ

<H4>Cautions</H4>

Some of the most important issues in primer picking can be
addressed only before using eprimer32.  These are sequence quality
(including making sure the sequence is not vector and not
chimeric) and avoiding repetitive elements.

<p>

Techniques for avoiding problems include a thorough understanding
of possible vector contaminants and cloning artifacts coupled
with database searches using blast, fasta, or other similarity
searching program to screen for vector contaminants and possible
repeats.  Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, and
others, 1995-1996, ftp://ncbi.nlm.nih.gov/repository/repbase)
is an excellent source of repeat sequences and pointers to the
literature.  eprimer32 now allows you to screen candidate oligos
against a Mispriming Library (or a Mishyb Library in the case
of internal oligos).

<p>

Sequence quality can be controlled by manual trace viewing and
quality clipping or automatic quality clipping programs.  Low-
quality bases should be changed to N's or can be made part of
Excluded Regions. The beginning of a sequencing read is often
problematic because of primer peaks, and the end of the read
often contains many low-quality or even meaningless called bases.
Therefore when picking primers from single-pass sequence it is
often best to use the INCLUDED_REGION parameter to ensure that
eprimer32 chooses primers in the high quality region of the read.

<p>

In addition, eprimer32 takes as input a Sequence Quality list for
use with those base calling programs 

<p>

(e.g. Phred, Bass/Grace, Trout) that output this information.

<H4>What to do if eprimer32 cannot find a primers?</H4>

Try relaxing various parameters, including the
self-complementarity parameters and max and min oligo melting
temperatures.  For example, for very A-T-rich regions you might
have to increase maximum primer size or decrease minimum melting
temperature.  It is usually unwise to reduce the minimum primer
size if your template is complex (e.g. a mammalian genome), since
small primers are more likely to be non-specific.  Make sure that
there are adequate stretches of non-Ns in the regions in which
you wish to pick primers.  If necessary you can also allow an N
in your primer and use an oligo mixture containing all four bases
at that position.

<p>

Try setting the '-explainflag' option.

<H2>
    Usage
</H2>
Here is a sample session with <b>eprimer32</b>
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>eprimer32 tembl:x65921 x65921.eprimer32 -explain </b>
Pick PCR primers and hybridization oligos

</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>


<H2>
    Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
Pick PCR primers and hybridization oligos
Version: EMBOSS:6.6.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     The sequence from which to choose primers.
                                  The sequence must be presented 5' to 3'
  [-outfile]           outfile    [*.eprimer32] Whitehead primer3_core program
                                  output file

   Additional (Optional) qualifiers (* if not always prompted):
   -[no]primer         toggle     [Y] Tell Eprimer32 to pick primer(s)
*  -task               menu       [1] Tell Eprimer32 what task to perform.
                                  Legal values are 1: 'Pick PCR primers', 2:
                                  'Pick forward primer only', 3: 'Pick reverse
                                  primer only', 4: 'No primers needed'.
                                  (Values: 1 (Pick PCR primers); 2 (Pick
                                  forward primer only); 3 (Pick reverse primer
                                  only); 4 (No primers needed))
   -hybridprobe        toggle     [N] An 'internal oligo' is intended to be
                                  used as a hybridization probe (hyb probe) to
                                  detect the PCR product after amplification.
*  -mishyblibraryfile  infile     Similar to MISPRIMING-LIBRARY, except that
                                  the event we seek to avoid is hybridization
                                  of the internal oligo to sequences in this
                                  library rather than priming from them.
                                  The file must be in (a slightly restricted)
                                  FASTA format (W. B. Pearson and D.J. Lipman,
                                  PNAS 85:8 pp 2444-2448 [1988]); we briefly
                                  discuss the organization of this file below.
                                  If this parameter is specified then
                                  Eprimer32 locally aligns each candidate
                                  oligo against each library sequence and
                                  rejects those primers for which the local
                                  alignment score times a specified weight
                                  (see below) exceeds
                                  INTERNAL-OLIGO-MAX-MISHYB. (The maximum
                                  value of the weight is arbitrarily set to
                                  12.0.)
                                  Each sequence entry in the FASTA-format file
                                  must begin with an 'id line' that starts
                                  with '>'. The contents of the id line is
                                  'slightly restricted' in that Eprimer32
                                  parses everything after any optional
                                  asterisk ('*') as a floating point number to
                                  use as the weight mentioned above. If the
                                  id line contains no asterisk then the weight
                                  defaults to 1.0. The alignment scoring
                                  system used is the same as for calculating
                                  complementarity among oligos (e.g.
                                  SELF-ANY). The remainder of an entry
                                  contains the sequence as lines following the
                                  id line up until a line starting with '>'
                                  or the end of the file. Whitespace and
                                  newlines are ignored. Characters 'A', 'T',
                                  'G', 'C', 'a', 't', 'g', 'c' are retained
                                  and any other character is converted to 'N'
                                  (with the consequence that any IUB / IUPAC
                                  codes for ambiguous bases are converted to
                                  'N'). There are no restrictions on line
                                  length.
                                  An empty value for this parameter indicates
                                  that no library should be used.
   -numreturn          integer    [5] The maximum number of primer pairs to
                                  return. Primer pairs returned are sorted by
                                  their 'quality', in other words by the value
                                  of the objective function (where a lower
                                  number indicates a better primer pair).
                                  Caution: setting this parameter to a large
                                  value will increase running time. (Integer 0
                                  or more)
   -includedregion     range      [(full sequence)] A sub-region of the given
                                  sequence in which to pick primers. For
                                  example, often the first dozen or so bases
                                  of a sequence are vector, and should be
                                  excluded from consideration. The value for
                                  this parameter has the form
                                  (start),(end)
                                  where (start) is the index of the first base
                                  to consider, and (end) is the last in the
                                  primer-picking region.
   -targetregion       range      [(full sequence)] If one or more Targets is
                                  specified then a legal primer pair must
                                  flank at least one of them. A Target might
                                  be a simple sequence repeat site (for
                                  example a CA repeat) or a single-base-pair
                                  polymorphism. The value should be a
                                  space-separated list of
                                  (start),(end)
                                  pairs where (start) is the index of the
                                  first base of a Target, and (end) is the
                                  last
                                  E.g. 50,51 requires primers to surround the
                                  2 bases at positions 50 and 51.
   -excludedregion     range      [(full sequence)] Primer oligos may not
                                  overlap any region specified in this tag.
                                  The associated value must be a
                                  space-separated list of
                                  (start),(end)
                                  pairs where (start) is the index of the
                                  first base of the excluded region, and and
                                  (end) is the last. This tag is useful for
                                  tasks such as excluding regions of low
                                  sequence quality or for excluding regions
                                  containing repetitive elements such as ALUs
                                  or LINEs.
                                  E.g. 401,407 68,70 forbids selection of
                                  primers in the 7 bases starting at 401 and
                                  the 3 bases at 68.
   -forwardinput       string     The sequence of a forward primer to check
                                  and around which to design reverse primers
                                  and optional internal oligos. Must be a
                                  substring of SEQUENCE. (Any string)
   -reverseinput       string     The sequence of a reverse primer to check
                                  and around which to design forward primers
                                  and optional internal oligos. Must be a
                                  substring of the reverse strand of SEQUENCE.
                                  (Any string)
   -okleftregion       range      [(full sequence)] Possible left primer of
                                  pair location
   -okrightregion      range      [(full sequence)] Possible right primer of
                                  pair location
*  -gcclamp            integer    [0] Require the specified number of
                                  consecutive Gs and Cs at the 3' end of both
                                  the forward and reverse primer. (This
                                  parameter has no effect on the internal
                                  oligo if one is requested.) (Integer 0 or
                                  more)
*  -optsize            integer    [20] Optimum length (in bases) of a primer
                                  oligo. Eprimer32 will attempt to pick
                                  primers close to this length. (Integer 0 or
                                  more)
*  -minsize            integer    [18] Minimum acceptable length of a primer.
                                  Must be greater than 0 and less than or
                                  equal to MAX-SIZE. (Integer 1 or more)
*  -maxsize            integer    [27] Maximum acceptable length (in bases) of
                                  a primer. Currently this parameter cannot
                                  be larger than 35. This limit is governed by
                                  the maximum oligo size for which
                                  Eprimer32's melting-temperature is valid.
                                  (Integer up to 35)
*  -opttm              float      [60.0] Optimum melting temperature(Celsius)
                                  for a primer oligo. Eprimer32 will try to
                                  pick primers with melting temperatures are
                                  close to this temperature. The oligo melting
                                  temperature formula in Eprimer32 is that
                                  given in Rychlik, Spencer and Rhoads,
                                  Nucleic Acids Research, vol 18, num 21, pp
                                  6409-6412 and Breslauer, Frank, Bloecker and
                                  Marky, Proc. Natl. Acad. Sci. USA, vol 83,
                                  pp 3746-3750. Please refer to the former
                                  paper for background discussion. (Any
                                  numeric value)
*  -mintm              float      [57.0] Minimum acceptable melting
                                  temperature(Celsius) for a primer oligo.
                                  (Any numeric value)
*  -maxtm              float      [63.0] Maximum acceptable melting
                                  temperature(Celsius) for a primer oligo.
                                  (Any numeric value)
*  -maxdifftm          float      [100.0] Maximum acceptable (unsigned)
                                  difference between the melting temperatures
                                  of the forward and reverse primers. (Any
                                  numeric value)
*  -ogcpercent         float      [50.0] Primer optimum GC percent. (Any
                                  numeric value)
*  -mingc              float      [20.0] Minimum allowable percentage of Gs
                                  and Cs in any primer. (Any numeric value)
*  -maxgc              float      [80.0] Maximum allowable percentage of Gs
                                  and Cs in any primer generated by Primer.
                                  (Any numeric value)
*  -saltconc           float      [50.0] The millimolar concentration of salt
                                  (usually KCl) in the PCR. Eprimer32 uses
                                  this argument to calculate oligo melting
                                  temperatures. (Any numeric value)
*  -dnaconc            float      [50.0] The nanomolar concentration of
                                  annealing oligos in the PCR. Eprimer32 uses
                                  this argument to calculate oligo melting
                                  temperatures. The default (50nM) works well
                                  with the standard protocol used at the
                                  Whitehead/MIT Center for Genome
                                  Research--0.5 microliters of 20 micromolar
                                  concentration for each primer oligo in a 20
                                  microliter reaction with 10 nanograms
                                  template, 0.025 units/microliter Taq
                                  polymerase in 0.1 mM each dNTP, 1.5mM MgCl2,
                                  50mM KCl, 10mM Tris-HCL (pH 9.3) using 35
                                  cycles with an annealing temperature of 56
                                  degrees Celsius. This parameter corresponds
                                  to 'c' in Rychlik, Spencer and Rhoads'
                                  equation (ii) (Nucleic Acids Research, vol
                                  18, num 21) where a suitable value (for a
                                  lower initial concentration of template) is
                                  'empirically determined'. The value of this
                                  parameter is less than the actual
                                  concentration of oligos in the reaction
                                  because it is the concentration of annealing
                                  oligos, which in turn depends on the amount
                                  of template (including PCR product) in a
                                  given cycle. This concentration increases a
                                  great deal during a PCR; fortunately PCR
                                  seems quite robust for a variety of oligo
                                  melting temperatures.
                                  See ADVICE FOR PICKING PRIMERS. (Any numeric
                                  value)
*  -maxpolyx           integer    [5] The maximum allowable length of a
                                  mononucleotide repeat in a primer, for
                                  example AAAAAA. (Integer 0 or more)
*  -psizeopt           integer    [200] The optimum size for the PCR product.
                                  0 indicates that there is no optimum product
                                  size. (Integer 0 or more)
*  -prange             range      [100-300] The associated values specify the
                                  lengths of the product that the user wants
                                  the primers to create, and is a space
                                  separated list of elements of the form
                                  (x)-(y)
                                  where an (x)-(y) pair is a legal range of
                                  lengths for the product. For example, if one
                                  wants PCR products to be between 100 to 150
                                  bases (inclusive) then one would set this
                                  parameter to 100-150. If one desires PCR
                                  products in either the range from 100 to 150
                                  bases or in the range from 200 to 250 bases
                                  then one would set this parameter to
                                  100-150 200-250.
                                  Eprimer32 favours ranges to the left side of
                                  the parameter string. Eprimer32 will return
                                  legal primers pairs in the first range
                                  regardless the value of the objective
                                  function for these pairs. Only if there are
                                  an insufficient number of primers in the
                                  first range will Eprimer32 return primers in
                                  a subsequent range.
*  -ptmopt             float      [0.0] The optimum melting temperature for
                                  the PCR product. 0 indicates that there is
                                  no optimum temperature. (Any numeric value)
*  -ptmmin             float      [-1000000.0] The minimum allowed melting
                                  temperature of the amplicon. Please see the
                                  documentation on the maximum melting
                                  temperature of the product for details. (Any
                                  numeric value)
*  -ptmmax             float      [1000000.0] The maximum allowed melting
                                  temperature of the amplicon. Product Tm is
                                  calculated using the formula from Bolton and
                                  McCarthy, PNAS 84:1390 (1962) as presented
                                  in Sambrook, Fritsch and Maniatis, Molecular
                                  Cloning, p 11.46 (1989, CSHL Press).
                                  Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) -
                                  600/length
                                  Where [Na+} is the molar sodium
                                  concentration, (%GC) is the percent of Gs
                                  and Cs in the sequence, and length is the
                                  length of the sequence.
                                  A similar formula is used by the prime
                                  primer selection program in GCG, which
                                  instead uses 675.0/length in the last term
                                  (after F. Baldino, Jr, M.-F. Chesselet, and
                                  M.E. Lewis, Methods in Enzymology 168:766
                                  (1989) eqn (1) on page 766 without the
                                  mismatch and formamide terms). The formulas
                                  here and in Baldino et al. assume Na+ rather
                                  than K+. According to J.G. Wetmur, Critical
                                  Reviews in BioChem. and Mol. Bio. 26:227
                                  (1991) 50 mM K+ should be equivalent in
                                  these formulae to .2 M Na+. Eprimer32 uses
                                  the same salt concentration value for
                                  calculating both the primer melting
                                  temperature and the oligo melting
                                  temperature. If you are planning to use the
                                  PCR product for hybridization later this
                                  behavior will not give you the Tm under
                                  hybridization conditions. (Any numeric
                                  value)
*  -oexcludedregion    range      [(full sequence)] Middle oligos may not
                                  overlap any region specified by this tag.
                                  The associated value must be a
                                  space-separated list of
                                  (start),(end)
                                  pairs, where (start) is the index of the
                                  first base of an excluded region, and (end)
                                  is the last. Often one would make Target
                                  regions excluded regions for internal
                                  oligos.
*  -oligoinput         string     The sequence of an internal oligo to check
                                  and around which to design forward and
                                  reverse primers. Must be a substring of
                                  SEQUENCE. (Any string)
*  -osizeopt           integer    [20] Optimum length (in bases) of an
                                  internal oligo. Eprimer32 will attempt to
                                  pick primers close to this length. (Integer
                                  0 or more)
*  -ominsize           integer    [18] Minimum acceptable length of an
                                  internal oligo. Must be greater than 0 and
                                  less than or equal to
                                  INTERNAL-OLIGO-MAX-SIZE. (Integer 0 or more)
*  -omaxsize           integer    [27] Maximum acceptable length (in bases) of
                                  an internal oligo. Currently this parameter
                                  cannot be larger than 35. This limit is
                                  governed by maximum oligo size for which
                                  Eprimer32's melting-temperature is valid.
                                  (Integer up to 35)
*  -otmopt             float      [60.0] Optimum melting temperature (Celsius)
                                  for an internal oligo. Eprimer32 will try
                                  to pick oligos with melting temperatures
                                  that are close to this temperature. The
                                  oligo melting temperature formula in
                                  Eprimer32 is that given in Rychlik, Spencer
                                  and Rhoads, Nucleic Acids Research, vol 18,
                                  num 21, pp 6409-6412 and Breslauer, Frank,
                                  Bloecker and Marky, Proc. Natl. Acad. Sci.
                                  USA, vol 83, pp 3746-3750. Please refer to
                                  the former paper for background discussion.
                                  (Any numeric value)
*  -otmmin             float      [57.0] Minimum acceptable melting
                                  temperature(Celsius) for an internal oligo.
                                  (Any numeric value)
*  -otmmax             float      [63.0] Maximum acceptable melting
                                  temperature (Celsius) for an internal oligo.
                                  (Any numeric value)
*  -ogcopt             float      [50.0] Internal oligo optimum GC percent.
                                  (Any numeric value)
*  -ogcmin             float      [20.0] Minimum allowable percentage of Gs
                                  and Cs in an internal oligo. (Any numeric
                                  value)
*  -ogcmax             float      [80.0] Maximum allowable percentage of Gs
                                  and Cs in any internal oligo generated by
                                  Primer. (Any numeric value)
*  -osaltconc          float      [50.0] The millimolar concentration of salt
                                  (usually KCl) in the hybridization.
                                  Eprimer32 uses this argument to calculate
                                  internal oligo melting temperatures. (Any
                                  numeric value)
*  -odnaconc           float      [50.0] The nanomolar concentration of
                                  annealing internal oligo in the
                                  hybridization. (Any numeric value)
*  -oanyself           float      [12.00] The maximum allowable local
                                  alignment score when testing an internal
                                  oligo for (local) self-complementarity.
                                  Local self-complementarity is taken to
                                  predict the tendency of oligos to anneal to
                                  themselves The scoring system gives 1.00 for
                                  complementary bases, -0.25 for a match of
                                  any base (or N) with an N, -1.00 for a
                                  mismatch, and -2.00 for a gap. Only
                                  single-base-pair gaps are allowed. For
                                  example, the alignment
                                  5' ATCGNA 3'
                                  || | |
                                  3' TA-CGT 5'
                                  is allowed (and yields a score of 1.75), but
                                  the alignment
                                  5' ATCCGNA 3'
                                  || | |
                                  3' TA--CGT 5'
                                  is not considered. Scores are non-negative,
                                  and a score of 0.00 indicates that there is
                                  no reasonable local alignment between two
                                  oligos. (Number up to 9999.990)
*  -oendself           float      [12.00] The maximum allowable 3'-anchored
                                  global alignment score when testing a single
                                  oligo for self-complementarity.
                                  The scoring system is as for the Maximum
                                  Complementarity argument. In the examples
                                  above the scores are 7.00 and 6.00
                                  respectively. Scores are non-negative, and a
                                  score of 0.00 indicates that there is no
                                  reasonable 3'-anchored global alignment
                                  between two oligos. In order to estimate
                                  3'-anchored global alignments for candidate
                                  oligos, Primer assumes that the sequence
                                  from which to choose oligos is presented 5'
                                  to 3'.
                                  INTERNAL-OLIGO-SELF-END is meaningless when
                                  applied to internal oligos used for
                                  hybridization-based detection, since
                                  primer-dimer will not occur. We recommend
                                  that INTERNAL-OLIGO-SELF-END be set at least
                                  as high as INTERNAL-OLIGO-SELF-ANY. (Number
                                  up to 9999.990)
*  -opolyxmax          integer    [5] The maximum allowable length of an
                                  internal oligo mononucleotide repeat, for
                                  example AAAAAA. (Integer 0 or more)
*  -omishybmax         float      [12.0] Similar to MAX-MISPRIMING except that
                                  this parameter applies to the similarity of
                                  candidate internal oligos to the library
                                  specified in INTERNAL-OLIGO-MISHYB-LIBRARY.
                                  (Number up to 9999.990)

   Advanced (Unprompted) qualifiers:
   -mispriminglibraryfile infile     The name of a file containing a nucleotide
                                  sequence library of sequences to avoid
                                  amplifying (for example repetitive
                                  sequences, or possibly the sequences of
                                  genes in a gene family that should not be
                                  amplified.) The file must be in (a slightly
                                  restricted) FASTA format (W. B. Pearson and
                                  D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]);
                                  we briefly discuss the organization of this
                                  file below. If this parameter is specified
                                  then Eprimer32 locally aligns each candidate
                                  primer against each library sequence and
                                  rejects those primers for which the local
                                  alignment score times a specified weight
                                  (see below) exceeds MAX-MISPRIMING. (The
                                  maximum value of the weight is arbitrarily
                                  set to 100.0.)
                                  Each sequence entry in the FASTA-format file
                                  must begin with an 'id line' that starts
                                  with '>'. The contents of the id line is
                                  'slightly restricted' in that Eprimer32
                                  parses everything after any optional
                                  asterisk ('*') as a floating point number to
                                  use as the weight mentioned above. If the
                                  id line contains no asterisk then the weight
                                  defaults to 1.0. The alignment scoring
                                  system used is the same as for calculating
                                  complementarity among oligos (e.g.
                                  SELF-ANY). The remainder of an entry
                                  contains the sequence as lines following the
                                  id line up until a line starting with '>'
                                  or the end of the file. Whitespace and
                                  newlines are ignored. Characters 'A', 'T',
                                  'G', 'C', 'a', 't', 'g', 'c' are retained
                                  and any other character is converted to 'N'
                                  (with the consequence that any IUB / IUPAC
                                  codes for ambiguous bases are converted to
                                  'N'). There are no restrictions on line
                                  length.
                                  An empty value for this parameter indicates
                                  that no repeat library should be used.
   -explainflag        boolean    [N] If this flag is true, produce
                                  LEFT-EXPLAIN, RIGHT-EXPLAIN, and
                                  INTERNAL-OLIGO-EXPLAIN output tags, which
                                  are intended to provide information on the
                                  number of oligos and primer pairs that
                                  Eprimer32 examined, and statistics on the
                                  number discarded for various reasons.
   -fileflag           boolean    [N] If the associated value is true, then
                                  Eprimer32 creates two output files for each
                                  input SEQUENCE. File (sequence-id).for lists
                                  all acceptable forward primers for
                                  (sequence-id), and (sequence-id).rev lists
                                  all acceptable reverse primers for
                                  (sequence-id), where (sequence-id) is the
                                  value of the SEQUENCE-ID tag (which must be
                                  supplied). In addition, if the input tag
                                  TASK is 1 or 4, Eprimer32 produces a file
                                  (sequence-id).int, which lists all
                                  acceptable internal oligos.
   -pickanyway         boolean    [N] If true pick a primer pair even if
                                  LEFT-INPUT, RIGHT-INPUT, or
                                  INTERNAL-OLIGO-INPUT violates specific
                                  constraints.
   -maxmispriming      float      [12.00] The maximum allowed weighted
                                  similarity with any sequence in
                                  MISPRIMING-LIBRARY. (Number up to 9999.990)
   -pairmaxmispriming  float      [24.00] The maximum allowed sum of weighted
                                  similarities of a primer pair (one
                                  similarity for each primer) with any single
                                  sequence in MISPRIMING-LIBRARY. (Number up
                                  to 9999.990)
   -numnsaccepted      integer    [0] Maximum number of unknown bases (N)
                                  allowable in any primer. (Integer 0 or more)
   -selfany            float      [8.00] The maximum allowable local alignment
                                  score when testing a single primer for
                                  (local) self-complementarity and the maximum
                                  allowable local alignment score when
                                  testing for complementarity between forward
                                  and reverse primers. Local
                                  self-complementarity is taken to predict the
                                  tendency of primers to anneal to each other
                                  without necessarily causing self-priming in
                                  the PCR. The scoring system gives 1.00 for
                                  complementary bases, -0.25 for a match of
                                  any base (or N) with an N, -1.00 for a
                                  mismatch, and -2.00 for a gap. Only
                                  single-base-pair gaps are allowed. For
                                  example, the alignment
                                  5' ATCGNA 3'
                                  ...|| | |
                                  3' TA-CGT 5'
                                  is allowed (and yields a score of 1.75), but
                                  the alignment
                                  5' ATCCGNA 3'
                                  ...|| | |
                                  3' TA--CGT 5'
                                  is not considered. Scores are non-negative,
                                  and a score of 0.00 indicates that there is
                                  no reasonable local alignment between two
                                  oligos. (Number from 0.000 to 9999.990)
   -selfend            float      [3.00] The maximum allowable 3'-anchored
                                  global alignment score when testing a single
                                  primer for self-complementarity, and the
                                  maximum allowable 3'-anchored global
                                  alignment score when testing for
                                  complementarity between forward and reverse
                                  primers. The 3'-anchored global alignment
                                  score is taken to predict the likelihood of
                                  PCR-priming primer-dimers, for example
                                  5' ATGCCCTAGCTTCCGGATG 3'
                                  .............||| |||||
                                  ..........3' AAGTCCTACATTTAGCCTAGT 5'
                                  or
                                  5' AGGCTATGGGCCTCGCGA 3'
                                  ...............||||||
                                  ............3' AGCGCTCCGGGTATCGGA 5'
                                  The scoring system is as for the Maximum
                                  Complementarity argument. In the examples
                                  above the scores are 7.00 and 6.00
                                  respectively. Scores are non-negative, and a
                                  score of 0.00 indicates that there is no
                                  reasonable 3'-anchored global alignment
                                  between two oligos. In order to estimate
                                  3'-anchored global alignments for candidate
                                  primers and primer pairs, Primer assumes
                                  that the sequence from which to choose
                                  primers is presented 5' to 3'. It is
                                  nonsensical to provide a larger value for
                                  this parameter than for the Maximum (local)
                                  Complementarity parameter because the score
                                  of a local alignment will always be at least
                                  as great as the score of a global
                                  alignment. (Number 0.000 or more)
   -scorrection        menu       [1] Specifies the salt correction formula
                                  for the melting temperature calculation.
                                  (Values: 0 (Schildkraut & Lifson); 1
                                  (SantaLucia); 2 (Owczarzy et al))
   -tmformula          menu       [1] Specifies details of melting temperature
                                  calculation. (Values: 0 (Breslauer et al);
                                  1 (SantaLucia))
   -maxendstability    float      [9.0] The maximum stability for the five 3'
                                  bases of a forward or reverse primer. Bigger
                                  numbers mean more stable 3' ends. The value
                                  is the maximum delta G for duplex
                                  disruption for the five 3' bases as
                                  calculated using the nearest neighbor
                                  parameters published in Breslauer, Frank,
                                  Bloecker and Marky, Proc. Natl. Acad. Sci.
                                  USA, vol 83, pp 3746-3750. Eprimer32 uses a
                                  completely permissive default value for
                                  backward compatibility (which we may change
                                  in the next release). Rychlik recommends a
                                  maximum value of 9 (Wojciech Rychlik,
                                  'Selection of Primers for Polymerase Chain
                                  Reaction' in BA White, Ed., 'Methods in
                                  Molecular Biology, Vol. 15: PCR Protocols:
                                  Current Methods and Applications', 1993, pp
                                  31-40, Humana Press, Totowa NJ). (Number up
                                  to 1000.000)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -squick1            boolean    Read id and sequence only
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left">Qualifier</th>
<th align="left">Type</th>
<th align="left">Description</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Standard (Mandatory) qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td>[-sequence]<br>(Parameter 1)</td>
<td>seqall</td>
<td>The sequence from which to choose primers. The sequence must be presented 5' to 3'</td>
<td>Readable sequence(s)</td>
<td><b>Required</b></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>[-outfile]<br>(Parameter 2)</td>
<td>outfile</td>
<td>Whitehead primer3_core program output file</td>
<td>Output file</td>
<td><i>&lt;*&gt;</i>.eprimer32</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Additional (Optional) qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td>-[no]primer</td>
<td>toggle</td>
<td>Tell Eprimer32 to pick primer(s)</td>
<td>Toggle value Yes/No</td>
<td>Yes</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-task</td>
<td>list</td>
<td>Tell Eprimer32 what task to perform. Legal values are 1: 'Pick PCR primers', 2: 'Pick forward primer only', 3: 'Pick reverse primer only', 4: 'No primers needed'.</td>
<td><table><tr><td>1</td> <td><i>(Pick PCR primers)</i></td></tr><tr><td>2</td> <td><i>(Pick forward primer only)</i></td></tr><tr><td>3</td> <td><i>(Pick reverse primer only)</i></td></tr><tr><td>4</td> <td><i>(No primers needed)</i></td></tr></table></td>
<td>1</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-hybridprobe</td>
<td>toggle</td>
<td>An 'internal oligo' is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification.</td>
<td>Toggle value Yes/No</td>
<td>No</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-mishyblibraryfile</td>
<td>infile</td>
<td>Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them.
The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then Eprimer32 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL-OLIGO-MAX-MISHYB. (The maximum value of the weight is arbitrarily set to 12.0.)
Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '&gt;'. The contents of the id line is 'slightly restricted' in that Eprimer32 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '&gt;' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length.
An empty value for this parameter indicates that no library should be used.</td>
<td>Input file</td>
<td><b>Required</b></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-numreturn</td>
<td>integer</td>
<td>The maximum number of primer pairs to return. Primer pairs returned are sorted by their 'quality', in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time.</td>
<td>Integer 0 or more</td>
<td>5</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-includedregion</td>
<td>range</td>
<td>A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form
(start),(end)
where (start) is the index of the first base to consider, and (end) is the last in the primer-picking region.</td>
<td>Sequence range</td>
<td><i>full sequence</i></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-targetregion</td>
<td>range</td>
<td>If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of
(start),(end)
pairs where (start) is the index of the first base of a Target, and (end) is the last
E.g. 50,51 requires primers to surround the 2 bases at positions 50 and 51.</td>
<td>Sequence range</td>
<td><i>full sequence</i></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-excludedregion</td>
<td>range</td>
<td>Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of
(start),(end)
pairs where (start) is the index of the first base of the excluded region, and and (end) is the last. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs.
E.g. 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68.</td>
<td>Sequence range</td>
<td><i>full sequence</i></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-forwardinput</td>
<td>string</td>
<td>The sequence of a forward primer to check and around which to design reverse primers and optional internal oligos. Must be a substring of SEQUENCE.</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-reverseinput</td>
<td>string</td>
<td>The sequence of a reverse primer to check and around which to design forward primers and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE.</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-okleftregion</td>
<td>range</td>
<td>Possible left primer of pair location</td>
<td>Sequence range</td>
<td><i>full sequence</i></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-okrightregion</td>
<td>range</td>
<td>Possible right primer of pair location</td>
<td>Sequence range</td>
<td><i>full sequence</i></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-gcclamp</td>
<td>integer</td>
<td>Require the specified number of consecutive Gs and Cs at the 3' end of both the forward and reverse primer. (This parameter has no effect on the internal oligo if one is requested.)</td>
<td>Integer 0 or more</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-optsize</td>
<td>integer</td>
<td>Optimum length (in bases) of a primer oligo. Eprimer32 will attempt to pick primers close to this length.</td>
<td>Integer 0 or more</td>
<td>20</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-minsize</td>
<td>integer</td>
<td>Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX-SIZE.</td>
<td>Integer 1 or more</td>
<td>18</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-maxsize</td>
<td>integer</td>
<td>Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which Eprimer32's melting-temperature is valid.</td>
<td>Integer up to 35</td>
<td>27</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-opttm</td>
<td>float</td>
<td>Optimum melting temperature(Celsius) for a primer oligo. Eprimer32 will try to pick primers with melting temperatures are close to this temperature. The oligo melting temperature formula in Eprimer32 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.</td>
<td>Any numeric value</td>
<td>60.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-mintm</td>
<td>float</td>
<td>Minimum acceptable melting temperature(Celsius) for a primer oligo.</td>
<td>Any numeric value</td>
<td>57.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-maxtm</td>
<td>float</td>
<td>Maximum acceptable melting temperature(Celsius) for a primer oligo.</td>
<td>Any numeric value</td>
<td>63.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-maxdifftm</td>
<td>float</td>
<td>Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers.</td>
<td>Any numeric value</td>
<td>100.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-ogcpercent</td>
<td>float</td>
<td>Primer optimum GC percent.</td>
<td>Any numeric value</td>
<td>50.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-mingc</td>
<td>float</td>
<td>Minimum allowable percentage of Gs and Cs in any primer.</td>
<td>Any numeric value</td>
<td>20.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-maxgc</td>
<td>float</td>
<td>Maximum allowable percentage of Gs and Cs in any primer generated by Primer.</td>
<td>Any numeric value</td>
<td>80.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-saltconc</td>
<td>float</td>
<td>The millimolar concentration of salt (usually KCl) in the PCR. Eprimer32 uses this argument to calculate oligo melting temperatures.</td>
<td>Any numeric value</td>
<td>50.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-dnaconc</td>
<td>float</td>
<td>The nanomolar concentration of annealing oligos in the PCR. Eprimer32 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 21) where a suitable value (for a lower initial concentration of template) is 'empirically determined'. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures.
See ADVICE FOR PICKING PRIMERS.</td>
<td>Any numeric value</td>
<td>50.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-maxpolyx</td>
<td>integer</td>
<td>The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA.</td>
<td>Integer 0 or more</td>
<td>5</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-psizeopt</td>
<td>integer</td>
<td>The optimum size for the PCR product. 0 indicates that there is no optimum product size.</td>
<td>Integer 0 or more</td>
<td>200</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-prange</td>
<td>range</td>
<td>The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form
(x)-(y)
where an (x)-(y) pair is a legal range of lengths for the product. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100-150. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100-150 200-250.
Eprimer32 favours ranges to the left side of the parameter string. Eprimer32 will return legal primers pairs in the first range regardless the value of the objective function for these pairs. Only if there are an insufficient number of primers in the first range will Eprimer32 return primers in a subsequent range.</td>
<td>Sequence range</td>
<td>100-300</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-ptmopt</td>
<td>float</td>
<td>The optimum melting temperature for the PCR product. 0 indicates that there is no optimum temperature.</td>
<td>Any numeric value</td>
<td>0.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-ptmmin</td>
<td>float</td>
<td>The minimum allowed melting temperature of the amplicon. Please see the documentation on the maximum melting temperature of the product for details.</td>
<td>Any numeric value</td>
<td>-1000000.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-ptmmax</td>
<td>float</td>
<td>The maximum allowed melting temperature of the amplicon. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press).
Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length
Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence.
A similar formula is used by the prime primer selection program in GCG, which instead uses 675.0/length in the last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms). The formulas here and in Baldino et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to .2 M Na+. Eprimer32 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions.</td>
<td>Any numeric value</td>
<td>1000000.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-oexcludedregion</td>
<td>range</td>
<td>Middle oligos may not overlap any region specified by this tag. The associated value must be a space-separated list of
(start),(end)
pairs, where (start) is the index of the first base of an excluded region, and (end) is the last. Often one would make Target regions excluded regions for internal oligos.</td>
<td>Sequence range</td>
<td><i>full sequence</i></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-oligoinput</td>
<td>string</td>
<td>The sequence of an internal oligo to check and around which to design forward and reverse primers. Must be a substring of SEQUENCE.</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-osizeopt</td>
<td>integer</td>
<td>Optimum length (in bases) of an internal oligo. Eprimer32 will attempt to pick primers close to this length.</td>
<td>Integer 0 or more</td>
<td>20</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-ominsize</td>
<td>integer</td>
<td>Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE.</td>
<td>Integer 0 or more</td>
<td>18</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-omaxsize</td>
<td>integer</td>
<td>Maximum acceptable length (in bases) of an internal oligo. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which Eprimer32's melting-temperature is valid.</td>
<td>Integer up to 35</td>
<td>27</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-otmopt</td>
<td>float</td>
<td>Optimum melting temperature (Celsius) for an internal oligo. Eprimer32 will try to pick oligos with melting temperatures that are close to this temperature. The oligo melting temperature formula in Eprimer32 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 21, pp 6409-6412 and Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.</td>
<td>Any numeric value</td>
<td>60.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-otmmin</td>
<td>float</td>
<td>Minimum acceptable melting temperature(Celsius) for an internal oligo.</td>
<td>Any numeric value</td>
<td>57.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-otmmax</td>
<td>float</td>
<td>Maximum acceptable melting temperature (Celsius) for an internal oligo.</td>
<td>Any numeric value</td>
<td>63.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-ogcopt</td>
<td>float</td>
<td>Internal oligo optimum GC percent.</td>
<td>Any numeric value</td>
<td>50.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-ogcmin</td>
<td>float</td>
<td>Minimum allowable percentage of Gs and Cs in an internal oligo.</td>
<td>Any numeric value</td>
<td>20.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-ogcmax</td>
<td>float</td>
<td>Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer.</td>
<td>Any numeric value</td>
<td>80.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-osaltconc</td>
<td>float</td>
<td>The millimolar concentration of salt (usually KCl) in the hybridization. Eprimer32 uses this argument to calculate internal oligo melting temperatures.</td>
<td>Any numeric value</td>
<td>50.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-odnaconc</td>
<td>float</td>
<td>The nanomolar concentration of annealing internal oligo in the hybridization.</td>
<td>Any numeric value</td>
<td>50.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-oanyself</td>
<td>float</td>
<td>The maximum allowable local alignment score when testing an internal oligo for (local) self-complementarity. Local self-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment
5' ATCGNA 3'
|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment
5' ATCCGNA 3'
|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.</td>
<td>Number up to 9999.990</td>
<td>12.00</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-oendself</td>
<td>float</td>
<td>The maximum allowable 3'-anchored global alignment score when testing a single oligo for self-complementarity.
The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5' to 3'.
INTERNAL-OLIGO-SELF-END is meaningless when applied to internal oligos used for hybridization-based detection, since primer-dimer will not occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as high as INTERNAL-OLIGO-SELF-ANY.</td>
<td>Number up to 9999.990</td>
<td>12.00</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-opolyxmax</td>
<td>integer</td>
<td>The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA.</td>
<td>Integer 0 or more</td>
<td>5</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-omishybmax</td>
<td>float</td>
<td>Similar to MAX-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY.</td>
<td>Number up to 9999.990</td>
<td>12.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Advanced (Unprompted) qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td>-mispriminglibraryfile</td>
<td>infile</td>
<td>The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified.) The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then Eprimer32 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX-MISPRIMING. (The maximum value of the weight is arbitrarily set to 100.0.)
Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '&gt;'. The contents of the id line is 'slightly restricted' in that Eprimer32 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '&gt;' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length.
An empty value for this parameter indicates that no repeat library should be used.</td>
<td>Input file</td>
<td><b>Required</b></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-explainflag</td>
<td>boolean</td>
<td>If this flag is true, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that Eprimer32 examined, and statistics on the number discarded for various reasons.</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-fileflag</td>
<td>boolean</td>
<td>If the associated value is true, then Eprimer32 creates two output files for each input SEQUENCE. File (sequence-id).for lists all acceptable forward primers for (sequence-id), and (sequence-id).rev lists all acceptable reverse primers for (sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, Eprimer32 produces a file (sequence-id).int, which lists all acceptable internal oligos.</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-pickanyway</td>
<td>boolean</td>
<td>If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violates specific constraints.</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-maxmispriming</td>
<td>float</td>
<td>The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY.</td>
<td>Number up to 9999.990</td>
<td>12.00</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-pairmaxmispriming</td>
<td>float</td>
<td>The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING-LIBRARY.</td>
<td>Number up to 9999.990</td>
<td>24.00</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-numnsaccepted</td>
<td>integer</td>
<td>Maximum number of unknown bases (N) allowable in any primer.</td>
<td>Integer 0 or more</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-selfany</td>
<td>float</td>
<td>The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment
5' ATCGNA 3'
...|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but the alignment
5' ATCCGNA 3'
...|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.</td>
<td>Number from 0.000 to 9999.990</td>
<td>8.00</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-selfend</td>
<td>float</td>
<td>The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example
5' ATGCCCTAGCTTCCGGATG 3'
.............||| |||||
..........3' AAGTCCTACATTTAGCCTAGT 5'
or
5' AGGCTATGGGCCTCGCGA 3'
...............||||||
............3' AGCGCTCCGGGTATCGGA 5'
The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5' to 3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment.</td>
<td>Number 0.000 or more</td>
<td>3.00</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-scorrection</td>
<td>list</td>
<td>Specifies the salt correction formula for the melting temperature calculation.</td>
<td><table><tr><td>0</td> <td><i>(Schildkraut & Lifson)</i></td></tr><tr><td>1</td> <td><i>(SantaLucia)</i></td></tr><tr><td>2</td> <td><i>(Owczarzy et al)</i></td></tr></table></td>
<td>1</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-tmformula</td>
<td>list</td>
<td>Specifies details of melting temperature calculation.</td>
<td><table><tr><td>0</td> <td><i>(Breslauer et al)</i></td></tr><tr><td>1</td> <td><i>(SantaLucia)</i></td></tr></table></td>
<td>1</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-maxendstability</td>
<td>float</td>
<td>The maximum stability for the five 3' bases of a forward or reverse primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloecker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Eprimer32 uses a completely permissive default value for backward compatibility (which we may change in the next release). Rychlik recommends a maximum value of 9 (Wojciech Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in BA White, Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications', 1993, pp 31-40, Humana Press, Totowa NJ).</td>
<td>Number up to 1000.000</td>
<td>9.0</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Associated qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-sequence" associated seqall qualifiers
</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sbegin1<br>-sbegin_sequence</td>
<td>integer</td>
<td>Start of each sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -send1<br>-send_sequence</td>
<td>integer</td>
<td>End of each sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sreverse1<br>-sreverse_sequence</td>
<td>boolean</td>
<td>Reverse (if DNA)</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sask1<br>-sask_sequence</td>
<td>boolean</td>
<td>Ask for begin/end/reverse</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -snucleotide1<br>-snucleotide_sequence</td>
<td>boolean</td>
<td>Sequence is nucleotide</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sprotein1<br>-sprotein_sequence</td>
<td>boolean</td>
<td>Sequence is protein</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -slower1<br>-slower_sequence</td>
<td>boolean</td>
<td>Make lower case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -supper1<br>-supper_sequence</td>
<td>boolean</td>
<td>Make upper case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -scircular1<br>-scircular_sequence</td>
<td>boolean</td>
<td>Sequence is circular</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -squick1<br>-squick_sequence</td>
<td>boolean</td>
<td>Read id and sequence only</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sformat1<br>-sformat_sequence</td>
<td>string</td>
<td>Input sequence format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -iquery1<br>-iquery_sequence</td>
<td>string</td>
<td>Input query fields or ID list</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ioffset1<br>-ioffset_sequence</td>
<td>integer</td>
<td>Input start position offset</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sdbname1<br>-sdbname_sequence</td>
<td>string</td>
<td>Database name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sid1<br>-sid_sequence</td>
<td>string</td>
<td>Entryname</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ufo1<br>-ufo_sequence</td>
<td>string</td>
<td>UFO features</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fformat1<br>-fformat_sequence</td>
<td>string</td>
<td>Features format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fopenfile1<br>-fopenfile_sequence</td>
<td>string</td>
<td>Features file name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-outfile" associated outfile qualifiers
</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -odirectory2<br>-odirectory_outfile</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>General qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td> -auto</td>
<td>boolean</td>
<td>Turn off prompts</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -stdout</td>
<td>boolean</td>
<td>Write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -filter</td>
<td>boolean</td>
<td>Read first file from standard input, write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -options</td>
<td>boolean</td>
<td>Prompt for standard and additional values</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -debug</td>
<td>boolean</td>
<td>Write debug output to program.dbg</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -verbose</td>
<td>boolean</td>
<td>Report some/full command line options</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -help</td>
<td>boolean</td>
<td>Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -warning</td>
<td>boolean</td>
<td>Report warnings</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -error</td>
<td>boolean</td>
<td>Report errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fatal</td>
<td>boolean</td>
<td>Report fatal errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -die</td>
<td>boolean</td>
<td>Report dying program messages</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -version</td>
<td>boolean</td>
<td>Report version number and exit</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

</table>


<H2>
    Input file format
</H2>

<b>eprimer32</b> reads one or more nucleotide sequences.
<p>
<p>

The input is a standard EMBOSS sequence query (also known as a 'USA').

<p>
Major sequence database sources defined as standard in EMBOSS
installations include srs:embl, srs:uniprot and ensembl

<p>

Data can also be read from sequence output in any supported format
written by an EMBOSS or third-party application.

<p>
The input format can be specified by using the
command-line qualifier <tt>-sformat xxx</tt>, where 'xxx' is replaced
by the name of the required format.  The available format names are:
gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir
(nbrf), swissprot (swiss, sw), dasgff and debug.

<p>

See:
<A href="http://emboss.sf.net/docs/themes/SequenceFormats.html">
http://emboss.sf.net/docs/themes/SequenceFormats.html</A>
for further information on sequence formats.

<p>

<a name="input.1"></a>
<h3>Input files for usage example </h3>

'tembl:x65921' is a sequence entry in the example nucleic acid database 'tembl'
<p>
<p><h3>Database entry: tembl:x65921</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
ID   X65921; SV 1; linear; genomic DNA; STD; HUM; 2016 BP.
XX
AC   X65921; S45242;
XX
DT   13-MAY-1992 (Rel. 31, Created)
DT   14-NOV-2006 (Rel. 89, Last updated, Version 7)
XX
DE   H.sapiens fau 1 gene
XX
KW   fau 1 gene.
XX
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
XX
RN   [1]
RP   1-2016
RA   Kas K.;
RT   ;
RL   Submitted (29-APR-1992) to the INSDC.
RL   K. Kas, University of Antwerp, Dept of Biochemistry T3.22,
RL   Universiteitsplein 1, 2610 Wilrijk, BELGIUM
XX
RN   [2]
RP   1-2016
RX   DOI; 10.1016/0006-291X(92)91286-Y.
RX   PUBMED; 1326960.
RA   Kas K., Michiels L., Merregaert J.;
RT   "Genomic structure and expression of the human fau gene: encoding the
RT   ribosomal protein S30 fused to a ubiquitin-like protein";
RL   Biochem. Biophys. Res. Commun. 187(2):927-933(1992).
XX
DR   Ensembl-Gn; ENSG00000149806; Homo_sapiens.
DR   Ensembl-Tr; ENST00000279259; Homo_sapiens.
DR   Ensembl-Tr; ENST00000434372; Homo_sapiens.
DR   Ensembl-Tr; ENST00000525297; Homo_sapiens.
DR   Ensembl-Tr; ENST00000526555; Homo_sapiens.
DR   Ensembl-Tr; ENST00000527548; Homo_sapiens.
DR   Ensembl-Tr; ENST00000529259; Homo_sapiens.
DR   Ensembl-Tr; ENST00000529639; Homo_sapiens.
DR   Ensembl-Tr; ENST00000531743; Homo_sapiens.
DR   GDB; 191789.
DR   GDB; 191790.
DR   GDB; 354872.
DR   GDB; 4590236.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..2016


<font color=red>  [Part of this file has been deleted for brevity]</font>

FT                   RAKRRMQYNRRFVNVVPTFGKKKGPNANS"
FT   intron          857..950
FT                   /number=2
FT   exon            951..1095
FT                   /number=3
FT   intron          1096..1556
FT                   /number=3
FT   exon            1557..1612
FT                   /number=4
FT   intron          1613..1786
FT                   /number=4
FT   exon            1787..&gt;1912
FT                   /number=5
FT   polyA_signal    1938..1943
XX
SQ   Sequence 2016 BP; 421 A; 562 C; 538 G; 495 T; 0 other;
     ctaccatttt ccctctcgat tctatatgta cactcgggac aagttctcct gatcgaaaac        60
     ggcaaaacta aggccccaag taggaatgcc ttagttttcg gggttaacaa tgattaacac       120
     tgagcctcac acccacgcga tgccctcagc tcctcgctca gcgctctcac caacagccgt       180
     agcccgcagc cccgctggac accggttctc catccccgca gcgtagcccg gaacatggta       240
     gctgccatct ttacctgcta cgccagcctt ctgtgcgcgc aactgtctgg tcccgccccg       300
     tcctgcgcga gctgctgccc aggcaggttc gccggtgcga gcgtaaaggg gcggagctag       360
     gactgccttg ggcggtacaa atagcaggga accgcgcggt cgctcagcag tgacgtgaca       420
     cgcagcccac ggtctgtact gacgcgccct cgcttcttcc tctttctcga ctccatcttc       480
     gcggtagctg ggaccgccgt tcaggtaaga atggggcctt ggctggatcc gaagggcttg       540
     tagcaggttg gctgcggggt cagaaggcgc ggggggaacc gaagaacggg gcctgctccg       600
     tggccctgct ccagtcccta tccgaactcc ttgggaggca ctggccttcc gcacgtgagc       660
     cgccgcgacc accatcccgt cgcgatcgtt tctggaccgc tttccactcc caaatctcct       720
     ttatcccaga gcatttcttg gcttctctta caagccgtct tttctttact cagtcgccaa       780
     tatgcagctc tttgtccgcg cccaggagct acacaccttc gaggtgaccg gccaggaaac       840
     ggtcgcccag atcaaggtaa ggctgcttgg tgcgccctgg gttccatttt cttgtgctct       900
     tcactctcgc ggcccgaggg aacgcttacg agccttatct ttccctgtag gctcatgtag       960
     cctcactgga gggcattgcc ccggaagatc aagtcgtgct cctggcaggc gcgcccctgg      1020
     aggatgaggc cactctgggc cagtgcgggg tggaggccct gactaccctg gaagtagcag      1080
     gccgcatgct tggaggtgag tgagagagga atgttctttg aagtaccggt aagcgtctag      1140
     tgagtgtggg gtgcatagtc ctgacagctg agtgtcacac ctatggtaat agagtacttc      1200
     tcactgtctt cagttcagag tgattcttcc tgtttacatc cctcatgttg aacacagacg      1260
     tccatgggag actgagccag agtgtagttg tatttcagtc acatcacgag atcctagtct      1320
     ggttatcagc ttccacacta aaaattaggt cagaccaggc cccaaagtgc tctataaatt      1380
     agaagctgga agatcctgaa atgaaactta agatttcaag gtcaaatatc tgcaactttg      1440
     ttctcattac ctattgggcg cagcttctct ttaaaggctt gaattgagaa aagaggggtt      1500
     ctgctgggtg gcaccttctt gctcttacct gctggtgcct tcctttccca ctacaggtaa      1560
     agtccatggt tccctggccc gtgctggaaa agtgagaggt cagactccta aggtgagtga      1620
     gagtattagt ggtcatggtg ttaggacttt ttttcctttc acagctaaac caagtccctg      1680
     ggctcttact cggtttgcct tctccctccc tggagatgag cctgagggaa gggatgctag      1740
     gtgtggaaga caggaaccag ggcctgatta accttccctt ctccaggtgg ccaaacagga      1800
     gaagaagaag aagaagacag gtcgggctaa gcggcggatg cagtacaacc ggcgctttgt      1860
     caacgttgtg cccacctttg gcaagaagaa gggccccaat gccaactctt aagtcttttg      1920
     taattctggc tttctctaat aaaaaagcca cttagttcag tcatcgcatt gtttcatctt      1980
     tacttgcaag gcctcaggga gaggtgtgct tctcgg                                2016
//
</pre>
</td></tr></table><p>

<H2>
    Output file format
</H2>



<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: x65921.eprimer32</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>

# EPRIMER32 RESULTS FOR X65921

# FORWARD PRIMER STATISTICS:
# considered 18855
# GC content failed 156
# low tm 3890
# high tm 9325
# high hairpin stability 23
# long poly-x seq 45
# ok 5416

# REVERSE PRIMER STATISTICS:
# considered 18706
# GC content failed 161
# low tm 3834
# high tm 9289
# high hairpin stability 8
# long poly-x seq 66
# ok 5348

# PRIMER PAIR STATISTICS:
# considered 3726
# unacceptable product size 3429
# ok 297

#                      Start  Len   Tm     GC%   Sequence

   1 PRODUCT SIZE: 201
     FORWARD PRIMER     981   20  60.11  55.00  CCGGAAGATCAAGTCGTGCT

     REVERSE PRIMER    1162   20  59.90  55.00  GGTGTGACACTCAGCTGTCA


   2 PRODUCT SIZE: 199
     FORWARD PRIMER     802   20  60.11  60.00  CCAGGAGCTACACACCTTCG

     REVERSE PRIMER     981   20  60.11  55.00  AGCACGACTTGATCTTCCGG


   3 PRODUCT SIZE: 200
     FORWARD PRIMER    1489   20  59.89  55.00  AAAAGAGGGGTTCTGCTGGG

     REVERSE PRIMER    1669   20  60.18  55.00  TAAGAGCCCAGGGACTTGGT


   4 PRODUCT SIZE: 200
     FORWARD PRIMER     801   20  59.75  60.00  CCCAGGAGCTACACACCTTC

     REVERSE PRIMER     981   20  60.11  55.00  AGCACGACTTGATCTTCCGG


   5 PRODUCT SIZE: 200
     FORWARD PRIMER    1084   20  60.32  55.00  GCATGCTTGGAGGTGAGTGA

     REVERSE PRIMER    1264   20  59.96  55.00  ACTCTGGCTCAGTCTCCCAT



</pre>
</td></tr></table><p>
<p>

If the '-explain' flag has been used, as in the example, then statistics
are output describing the number of primers that were considered and
rejected for various reasons. 

<p>

Headers describing the input file name and the names of the output
columns are displayed.

<p>

The best 5 primer pairs are displayed with the product size.

<p>

The reverse sequence is displayed as the reverse complement to the input
forward sense sequence. 

<p>

The 'Start' positions are given counting from the start of the sequence
for both the forward and reverse primer (and for the internal oligos). 

<p>

Note that if you compare the results to the output from the public
Primer3 web site you will see a difference in the reverse primer
positions - this is because the original Primer3 program reports the
reverse primer positions as counted from the 3' end.  The convention in
EMBOSS is to report both forward and reverse features as counted from
the 5' end, so the reverse primer positions are given counted from the
5' start of the sequence. 

<H2>
    Data files
</H2>

None.

<H2>
    Notes
</H2>

The Whitehead Institute's primer3 program is not part of this program,
but it must be set up on your system and on your path. 

<p>
The Whitehead Institute program that is run by this program is available from:
http://primer3.sourceforge.net/
<br>
(Then see the link Download and then 'Release 1.1.4')
<p>

Earlier versions are also supported. We expect later versions to also
work - please contact the EMBOSS team if you find any problems.

<p>

The Whitehead Institute's primer3 program states:
<br>

We request but do not require that use of this software be cited in
publications as:
<p>

Steve Rozen and Helen J. Skaletsky (2000)
Primer3 on the WWW for general users and for biologist programmers.
In: Krawetz S, Misener S (eds)
Bioinformatics Methods and Protocols: Methods in Molecular Biology.
Humana Press, Totowa, NJ, pp 365-386
<p>

Source code available at http://fokker.wi.mit.edu/primer3/.
The paper above is available at
http://jura.wi.mit.edu/rozen/papers/rozen-and-skaletsky-2000-primer3.pdf

<H2>
    References
</H2>

None.

<H2>
    Warnings
</H2>

None.

<H2>
    Diagnostic Error Messages
</H2>

The message: "EMBOSS An error in eprimer32.c at line 346: The program
'primer32_core' must be on the path.  It is part of the 'primer3'
package, available from the Whitehead Institute.  See:
http://primer3.sourceforge.net/" is output if you do not have the
Whitehead Institute's primer3 program set up and on your path.
Note that compiling the primer3 package will produce an executable
called primer3_core. This must be renamed to primer32_core (or a link
of that name added) for eprimer32 to work. This is to avoid conflict
with the primer3 version 1.x series primer3_core executables required
by the EMBOOS application eprimer3. 

<H2>
    Exit status
</H2>

It always exits with status 0.

<H2>
    Known bugs
</H2>
None.

<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th>
<th>Description</th></tr>
<tr>
<td><a href="eprimer3.html">eprimer3</a></td>
<td>Pick PCR primers and hybridization oligos</td>
</tr>

<tr>
<td><a href="primersearch.html">primersearch</a></td>
<td>Search DNA sequences for matches with primer pairs</td>
</tr>

<tr>
<td><a href="stssearch.html">stssearch</a></td>
<td>Search a DNA database for matches with a set of STS primers</td>
</tr>

</table>


<H2>
    History
</H2>


<H2>
    Author(s)
</H2>

Gary Williams formerly at:
<br>
MRC Rosalind Franklin Centre for Genomics Research
Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

<p>
Please report all bugs to the EMBOSS bug team (emboss-bug&nbsp;&copy;&nbsp;emboss.open-bio.org) not to the original author.

<H2>
    History
</H2>


<H2>
    Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.

<H2>
    Comments
</H2>
None


</BODY>
</HTML>