File: fuzznuc.html

package info (click to toggle)
emboss 6.6.0%2Bdfsg-1
links: PTS, VCS
area: main
in suites: jessie, jessie-kfreebsd
size: 571,248 kB
ctags: 39,971
sloc: ansic: 460,578; java: 29,439; perl: 13,573; sh: 12,740; makefile: 3,275; csh: 706; asm: 351; xml: 239; pascal: 237; modula3: 8
file content (1224 lines) | stat: -rw-r--r-- 35,417 bytes
parent folder | download | duplicates (6)
HTML>

<HEAD>
  <TITLE>
  EMBOSS: fuzznuc
  </TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">

<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="/images/emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
fuzznuc
</font></b>
</td></tr>
</table>
<br>&nbsp;
<p>

<H2>
Wiki
</H2>

The master copies of EMBOSS documentation are available
at <a href="http://emboss.open-bio.org/wiki/Appdocs">
http://emboss.open-bio.org/wiki/Appdocs</a>
on the EMBOSS Wiki.

<p>
Please help by correcting and extending the Wiki pages.

<H2>
    Function
</H2>
Search for patterns in nucleotide sequences
<H2>
    Description
</H2>
<p><b>fuzznuc</b> searches for a specified PROSITE-style pattern in nucleotide sequences. Such patterns are specifications of a (typically short) length of sequence to be found. They can specify a search for an exact sequence or they can allow various ambiguities, matches to variable lengths of sequence and repeated subsections of the sequence. One or more nucleotide sequences are read from file.  The output is a standard EMBOSS report file that includes data such as location and score of any matches.</p>


<H2>
Algorithm
</H2>

<p><b>fuzznuc</b> intelligently selects the optimum searching algorithm to use, depending on the complexity of the search pattern specified.</p>

<H2>
    Usage
</H2>
Here is a sample session with <b>fuzznuc</b>
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>fuzznuc </b>
Search for patterns in nucleotide sequences
Input nucleotide sequence(s): <b>tembl:L46634</b>
Search pattern: <b>AAGCTT</b>
Output report [l46634.fuzznuc]: <b></b>

</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>
<p>
<b>Example 2</b>
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>fuzznuc </b>
Search for patterns in nucleotide sequences
Input nucleotide sequence(s): <b>tembl:L46634</b>
Search pattern: <b>@nucseq.pat</b>
Output report [l46634.fuzznuc]: <b></b>

</pre></td></tr></table><p>
<p>
<a href="#input.2">Go to the input files for this example</a><br><a href="#output.2">Go to the output files for this example</a><p><p>
<p>
<b>Example 3</b>
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>fuzznuc -pname test </b>
Search for patterns in nucleotide sequences
Input nucleotide sequence(s): <b>tembl:L46634</b>
Search pattern: <b>@nucsimple.pat</b>
Output report [l46634.fuzznuc]: <b></b>

</pre></td></tr></table><p>
<p>
<a href="#input.3">Go to the input files for this example</a><br><a href="#output.3">Go to the output files for this example</a><p><p>
<p>
<b>Example 4</b>
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>fuzznuc </b>
Search for patterns in nucleotide sequences
Input nucleotide sequence(s): <b>tembl:L46634</b>
Search pattern: <b>@nuc.pat</b>
Output report [l46634.fuzznuc]: <b></b>

</pre></td></tr></table><p>
<p>
<a href="#input.4">Go to the input files for this example</a><br><a href="#output.4">Go to the output files for this example</a><p><p>

<H2>
    Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
Search for patterns in nucleotide sequences
Version: EMBOSS:6.6.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
   -pattern            pattern    The standard IUPAC one-letter codes for the
                                  nucleotides are used.
                                  The symbol 'n' is used for a position where
                                  any nucleotide is accepted.
                                  Ambiguities are indicated by listing the
                                  acceptable nucleotides for a given position,
                                  between square parentheses '[ ]'. For
                                  example: [ACG] stands for A or C or G.
                                  Ambiguities are also indicated by listing
                                  between a pair of curly brackets '{ }' the
                                  nucleotides that are not accepted at a given
                                  position. For example: {AG} stands for any
                                  nucleotides except A and G.
                                  Each element in a pattern is separated from
                                  its neighbor by a '-'. (Optional in
                                  fuzznuc).
                                  Repetition of an element of the pattern can
                                  be indicated by following that element with
                                  a numerical value or a numerical range
                                  between parenthesis. Examples: N(3)
                                  corresponds to N-N-N, N(2,4) corresponds to
                                  N-N or N-N-N or N-N-N-N.
                                  When a pattern is restricted to either the
                                  5' or 3' end of a sequence, that pattern
                                  either starts with a '<' symbol or
                                  respectively ends with a '>' symbol.
                                  A period ends the pattern. (Optional in
                                  fuzznuc).
                                  For example, [CG](5)TG{A}N(1,5)C
  [-outfile]           report     [*.fuzznuc] Output report file name (default
                                  -rformat seqtable)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -complement         boolean    [N] Search complementary strand

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -squick1            boolean    Read id and sequence only
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-pattern" associated qualifiers
   -pformat            string     File format
   -pmismatch          integer    Pattern mismatch
   -pname              string     Pattern base name

   "-outfile" associated qualifiers
   -rformat2           string     Report format
   -rname2             string     Base file name
   -rextension2        string     File name extension
   -rdirectory2        string     Output directory
   -raccshow2          boolean    Show accession number in the report
   -rdesshow2          boolean    Show description in the report
   -rscoreshow2        boolean    Show the score in the report
   -rstrandshow2       boolean    Show the nucleotide strand in the report
   -rusashow2          boolean    Show the full USA in the report
   -rmaxall2           integer    Maximum total hits to report
   -rmaxseq2           integer    Maximum hits to report for one sequence

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left">Qualifier</th>
<th align="left">Type</th>
<th align="left">Description</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Standard (Mandatory) qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td>[-sequence]<br>(Parameter 1)</td>
<td>seqall</td>
<td>Nucleotide sequence(s) filename and optional format, or reference (input USA)</td>
<td>Readable sequence(s)</td>
<td><b>Required</b></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-pattern</td>
<td>pattern</td>
<td>The standard IUPAC one-letter codes for the nucleotides are used.
The symbol 'n' is used for a position where any nucleotide is accepted.
Ambiguities are indicated by listing the acceptable nucleotides for a given position, between square parentheses '[ ]'. For example: [ACG] stands for A or C or G.
Ambiguities are also indicated by listing between a pair of curly brackets '{ }' the nucleotides that are not accepted at a given position. For example: {AG} stands for any nucleotides except A and G.
Each element in a pattern is separated from its neighbor by a '-'. (Optional in fuzznuc).
Repetition of an element of the pattern can be indicated by following that element with a numerical value or a numerical range between parenthesis. Examples: N(3) corresponds to N-N-N, N(2,4) corresponds to N-N or N-N-N or N-N-N-N.
When a pattern is restricted to either the 5' or 3' end of a sequence, that pattern either starts with a '&lt;' symbol or respectively ends with a '&gt;' symbol.
A period ends the pattern. (Optional in fuzznuc).
For example, [CG](5)TG{A}N(1,5)C</td>
<td>Property value(s)</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>[-outfile]<br>(Parameter 2)</td>
<td>report</td>
<td>Output report file name</td>
<td>(default -rformat seqtable)</td>
<td><i>&lt;*&gt;</i>.fuzznuc</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Additional (Optional) qualifiers</th>
</tr>

<tr>
<td colspan=5>(none)</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Advanced (Unprompted) qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td>-complement</td>
<td>boolean</td>
<td>Search complementary strand</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Associated qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-sequence" associated seqall qualifiers
</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sbegin1<br>-sbegin_sequence</td>
<td>integer</td>
<td>Start of each sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -send1<br>-send_sequence</td>
<td>integer</td>
<td>End of each sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sreverse1<br>-sreverse_sequence</td>
<td>boolean</td>
<td>Reverse (if DNA)</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sask1<br>-sask_sequence</td>
<td>boolean</td>
<td>Ask for begin/end/reverse</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -snucleotide1<br>-snucleotide_sequence</td>
<td>boolean</td>
<td>Sequence is nucleotide</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sprotein1<br>-sprotein_sequence</td>
<td>boolean</td>
<td>Sequence is protein</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -slower1<br>-slower_sequence</td>
<td>boolean</td>
<td>Make lower case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -supper1<br>-supper_sequence</td>
<td>boolean</td>
<td>Make upper case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -scircular1<br>-scircular_sequence</td>
<td>boolean</td>
<td>Sequence is circular</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -squick1<br>-squick_sequence</td>
<td>boolean</td>
<td>Read id and sequence only</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sformat1<br>-sformat_sequence</td>
<td>string</td>
<td>Input sequence format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -iquery1<br>-iquery_sequence</td>
<td>string</td>
<td>Input query fields or ID list</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ioffset1<br>-ioffset_sequence</td>
<td>integer</td>
<td>Input start position offset</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sdbname1<br>-sdbname_sequence</td>
<td>string</td>
<td>Database name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sid1<br>-sid_sequence</td>
<td>string</td>
<td>Entryname</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ufo1<br>-ufo_sequence</td>
<td>string</td>
<td>UFO features</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fformat1<br>-fformat_sequence</td>
<td>string</td>
<td>Features format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fopenfile1<br>-fopenfile_sequence</td>
<td>string</td>
<td>Features file name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-pattern" associated pattern qualifiers
</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -pformat</td>
<td>string</td>
<td>File format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -pmismatch</td>
<td>integer</td>
<td>Pattern mismatch</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -pname</td>
<td>string</td>
<td>Pattern base name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-outfile" associated report qualifiers
</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -rformat2<br>-rformat_outfile</td>
<td>string</td>
<td>Report format</td>
<td>Any string</td>
<td>seqtable</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -rname2<br>-rname_outfile</td>
<td>string</td>
<td>Base file name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -rextension2<br>-rextension_outfile</td>
<td>string</td>
<td>File name extension</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -rdirectory2<br>-rdirectory_outfile</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -raccshow2<br>-raccshow_outfile</td>
<td>boolean</td>
<td>Show accession number in the report</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -rdesshow2<br>-rdesshow_outfile</td>
<td>boolean</td>
<td>Show description in the report</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -rscoreshow2<br>-rscoreshow_outfile</td>
<td>boolean</td>
<td>Show the score in the report</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -rstrandshow2<br>-rstrandshow_outfile</td>
<td>boolean</td>
<td>Show the nucleotide strand in the report</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -rusashow2<br>-rusashow_outfile</td>
<td>boolean</td>
<td>Show the full USA in the report</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -rmaxall2<br>-rmaxall_outfile</td>
<td>integer</td>
<td>Maximum total hits to report</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -rmaxseq2<br>-rmaxseq_outfile</td>
<td>integer</td>
<td>Maximum hits to report for one sequence</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>General qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td> -auto</td>
<td>boolean</td>
<td>Turn off prompts</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -stdout</td>
<td>boolean</td>
<td>Write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -filter</td>
<td>boolean</td>
<td>Read first file from standard input, write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -options</td>
<td>boolean</td>
<td>Prompt for standard and additional values</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -debug</td>
<td>boolean</td>
<td>Write debug output to program.dbg</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -verbose</td>
<td>boolean</td>
<td>Report some/full command line options</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -help</td>
<td>boolean</td>
<td>Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -warning</td>
<td>boolean</td>
<td>Report warnings</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -error</td>
<td>boolean</td>
<td>Report errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fatal</td>
<td>boolean</td>
<td>Report fatal errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -die</td>
<td>boolean</td>
<td>Report dying program messages</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -version</td>
<td>boolean</td>
<td>Report version number and exit</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

</table>


<H2>
    Input file format
</H2>

<b>fuzznuc</b> reads in one or more nucleotide sequences.

<p>
<p>

The input is a standard EMBOSS sequence query (also known as a 'USA').

<p>
Major sequence database sources defined as standard in EMBOSS
installations include srs:embl, srs:uniprot and ensembl

<p>

Data can also be read from sequence output in any supported format
written by an EMBOSS or third-party application.

<p>
The input format can be specified by using the
command-line qualifier <tt>-sformat xxx</tt>, where 'xxx' is replaced
by the name of the required format.  The available format names are:
gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir
(nbrf), swissprot (swiss, sw), dasgff and debug.

<p>

See:
<A href="http://emboss.sf.net/docs/themes/SequenceFormats.html">
http://emboss.sf.net/docs/themes/SequenceFormats.html</A>
for further information on sequence formats.
<p>

<a name="input.1"></a>
<h3>Input files for usage example </h3>

'tembl:L46634' is a sequence entry in the example nucleic acid database 'tembl'
<p>
<p><h3>Database entry: tembl:L46634</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
ID   L46634; SV 1; linear; genomic DNA; STD; VRL; 1272 BP.
XX
AC   L46634; L46689;
XX
DT   06-NOV-1995 (Rel. 45, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 3)
XX
DE   Human herpesvirus 7 (clone ED132'1.2) telomeric repeat region.
XX
KW   telomeric repeat.
XX
OS   Human herpesvirus 7
OC   Viruses; dsDNA viruses, no RNA stage; Herpesvirales; Herpesviridae;
OC   Betaherpesvirinae; Roseolovirus.
XX
RN   [1]
RP   1-1272
RX   PUBMED; 7494318.
RA   Secchiero P., Nicholas J., Deng H., Xiaopeng T., van Loon N., Ruvolo V.R.,
RA   Berneman Z.N., Reitz M.S.Jr., Dewhurst S.;
RT   "Identification of human telomeric repeat motifs at the genome termini of
RT   human herpesvirus 7: structural analysis and heterogeneity";
RL   J. Virol. 69(12):8041-8045(1995).
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..1272
FT                   /organism="Human herpesvirus 7"
FT                   /strain="JI"
FT                   /mol_type="genomic DNA"
FT                   /clone="ED132'1.2"
FT                   /db_xref="taxon:10372"
FT   repeat_region   207..928
FT                   /note="long and complex repeat region composed of various
FT                   direct repeats, including TAACCC (TRS), degenerate copies
FT                   of TRS motifs and a 14-bp repeat, TAGGGCTGCGGCCC"
FT   misc_signal     938..998
FT                   /note="pac2 motif"
FT   misc_feature    1009
FT                   /note="right genome terminus (...ACA)"
XX
SQ   Sequence 1272 BP; 346 A; 455 C; 222 G; 249 T; 0 other;
     aagcttaaac tgaggtcaca cacgacttta attacggcaa cgcaacagct gtaagctgca        60
     ggaaagatac gatcgtaagc aaatgtagtc ctacaatcaa gcgaggttgt agacgttacc       120
     tacaatgaac tacacctcta agcataacct gtcgggcaca gtgagacacg cagccgtaaa       180
     ttcaaaactc aacccaaacc gaagtctaag tctcacccta atcgtaacag taaccctaca       240
     actctaatcc tagtccgtaa ccgtaacccc aatcctagcc cttagcccta accctagccc       300
     taaccctagc tctaacctta gctctaactc tgaccctagg cctaacccta agcctaaccc       360
     taaccgtagc tctaagttta accctaaccc taaccctaac catgaccctg accctaaccc       420
     tagggctgcg gccctaaccc tagccctaac cctaacccta atcctaatcc tagccctaac       480
     cctagggctg cggccctaac cctagcccta accctaaccc taaccctagg gctgcggccc       540
     taaccctaac cctagggctg cggcccgaac cctaacccta accctaaccc taaccctagg       600
     gctgcggccc taaccctaac cctagggctg cggccctaac cctaacccta gggctgcggc       660
     ccgaacccta accctaaccc taaccctagg gctgcggccc taaccctaac cctagggctg       720
     cggccctaac cctaacccta actctagggc tgcggcccta accctaaccc taaccctaac       780
     cctagggctg cggcccgaac cctagcccta accctaaccc tgaccctgac cctaacccta       840
     accctaaccc taaccctaac cctaacccta accctaaccc taaccctaac cctaacccta       900
     accctaaccc taaccctaac cctaaccccg cccccactgg cagccaatgt cttgtaatgc       960
     cttcaaggca ctttttctgc gagccgcgcg cagcactcag tgaaaaacaa gtttgtgcac      1020
     gagaaagacg ctgccaaacc gcagctgcag catgaaggct gagtgcacaa ttttggcttt      1080
     agtcccataa aggcgcggct tcccgtagag tagaaaaccg cagcgcggcg cacagagcga      1140
     aggcagcggc tttcagactg tttgccaagc gcagtctgca tcttaccaat gatgatcgca      1200
     agcaagaaaa atgttctttc ttagcatatg cgtggttaat cctgttgtgg tcatcactaa      1260
     gttttcaagc tt                                                          1272
//
</pre>
</td></tr></table><p>

<a name="input.2"></a>
<h3>Input files for usage example 2</h3>
<p><h3>File: nucseq.pat</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
&gt;targetseq
cg(2)c(3)taac
cctagc(3)ta
</pre>
</td></tr></table><p>

<a name="input.3"></a>
<h3>Input files for usage example 3</h3>
<p><h3>File: nucsimple.pat</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
cg(2)c(3)taac
cctagc(3)ta
</pre>
</td></tr></table><p>

<a name="input.4"></a>
<h3>Input files for usage example 4</h3>
<p><h3>File: nuc.pat</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
&gt;pat1
cggccctaaccctagcccta
&gt;pat2 &lt;mismatch=1&gt;
cg(2)c(3)taac
cctagc(3)ta
&gt;pat3
cggc(2,4)taac(2,5)

</pre>
</td></tr></table><p>


<h3>Pattern specification</h3>

Patterns for fuzznuc are based on the format of pattern used in the
PROSITE database, with the difference that the terminating dot '.' and
the hyphens, '-', between the characters are optional. 

<p>
The PROSITE pattern definition from the PROSITE documentation (amended
to refer to nucleic acid sequences, not proteins) follows. 

<ul>

<li>The standard IUPAC one-letter codes for the nucleotides are used. 

<li>The symbol `n' is used for a position where any nucleotide is
accepted. 

<li>Ambiguities are indicated by listing the acceptable nucleotides for a
given position, between square parentheses `[ ]'.  For example: [ACG]
stands for A or C or G. 

<li>Ambiguities are also indicated by listing between a pair of curly
brackets `{ }' the nucleotides that are not accepted at a given
position.  For example: {AG} stands for any nucleotides except A and G. 

<li>Each element in a pattern is separated from its neighbour by a `-'. 
(Optional in fuzznuc). 

<li>Repetition of an element of the pattern can be indicated by following
that element with a numerical value or a numerical range between
parenthesis.  Examples: N(3) corresponds to N-N-N, N(2,4) corresponds to
N-N or N-N-N or N-N-N-N. 

<li>When a pattern is restricted to either the 5' or 3' end of a
sequence, that pattern either starts with a `&lt;' symbol or respectively
ends with a `&gt;' symbol. 

<li>A period ends the pattern.  (Optional in fuzznuc). 

<li>All other characters, including spaces are not allowed.

</ul>

<p>
For example, in the EMBL entry J01636 you can look for the pattern:

<pre>

[CG](5)TG{A}N(1,5)C

</pre>

<p>
This searches for "C or G" 5 times, followed by T and G, then anything
except A, then any base (1 to 5 times) before a C. 

<p>
You can use ambiguity codes for nucleic acid searches but not within
[] or {} as they expand to bracketed counterparts.  For example, "s"
is expanded to "[GC]" therefore [S] would be expanded with a double
set of brackets which is illegal.

<p>
Note the use of X is reserved for proteins.  You must use N for nucleic
acids to refer to any base. 

<p>
The search is case-independent, so 'AAA' matches 'aaa'. 

<H2>
    Output file format
</H2>


<p>

The output is a standard EMBOSS report file. 

<p>

The results can be output in one of several styles by using the
command-line qualifier <tt>-rformat xxx</tt>, where 'xxx' is replaced
by the name of the required format.  The available format names are:
embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif,
diffseq, draw, restrict, excel, feattable, motif, nametable, regions,
seqtable, simple, srs, table, tagseq.

<p>

See:
<A href="http://emboss.sf.net/docs/themes/ReportFormats.html">
http://emboss.sf.net/docs/themes/ReportFormats.html</A>
for further information on report formats.

<p>
<p>

By default <b>fuzznuc</b> writes a 'seqtable' report file.

<p>

<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: l46634.fuzznuc</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
########################################
# Program: fuzznuc
# Rundate: Mon 15 Jul 2013 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:L46634
#    -pattern AAGCTT
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################

#=======================================
#
# Sequence: L46634     from: 1   to: 1272
# HitCount: 2
#
# Pattern_name Mismatch Pattern
# pattern             0 AAGCTT
# 
# Complement: No
#
#=======================================

  Start     End  Strand Pattern        Mismatch Sequence
      1       6       + pattern:AAGCTT        . aagctt
   1267    1272       + pattern:AAGCTT        . aagctt

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 2
#---------------------------------------
</pre>
</td></tr></table><p>

<a name="output.2"></a>
<h3>Output files for usage example 2</h3>
<p><h3>File: l46634.fuzznuc</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
########################################
# Program: fuzznuc
# Rundate: Mon 15 Jul 2013 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:L46634
#    -pattern @../../data/nucseq.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################

#=======================================
#
# Sequence: L46634     from: 1   to: 1272
# HitCount: 2
#
# Pattern_name Mismatch Pattern
# targetseq           0 cg(2)c(3)taaccctagc(3)ta
# 
# Complement: No
#
#=======================================

  Start     End  Strand Pattern                            Mismatch Sequence
    429     448       + targetseq:cg(2)c(3)taaccctagc(3)ta        . cggccctaaccctagcccta
    491     510       + targetseq:cg(2)c(3)taaccctagc(3)ta        . cggccctaaccctagcccta

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 2
#---------------------------------------
</pre>
</td></tr></table><p>

<a name="output.3"></a>
<h3>Output files for usage example 3</h3>
<p><h3>File: l46634.fuzznuc</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
########################################
# Program: fuzznuc
# Rundate: Mon 15 Jul 2013 12:00:00
# Commandline: fuzznuc
#    -pname test
#    -sequence tembl:L46634
#    -pattern @../../data/nucsimple.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################

#=======================================
#
# Sequence: L46634     from: 1   to: 1272
# HitCount: 13
#
# Pattern_name Mismatch Pattern
# test1               0 cg(2)c(3)taac
# test2               0 cctagc(3)ta
# 
# Complement: No
#
#=======================================

  Start     End  Strand Pattern             Mismatch Sequence
    429     438       + test1:cg(2)c(3)taac        . cggccctaac
    491     500       + test1:cg(2)c(3)taac        . cggccctaac
    535     544       + test1:cg(2)c(3)taac        . cggccctaac
    605     614       + test1:cg(2)c(3)taac        . cggccctaac
    631     640       + test1:cg(2)c(3)taac        . cggccctaac
    695     704       + test1:cg(2)c(3)taac        . cggccctaac
    721     730       + test1:cg(2)c(3)taac        . cggccctaac
    753     762       + test1:cg(2)c(3)taac        . cggccctaac
    293     302       + test2:cctagc(3)ta          . cctagcccta
    439     448       + test2:cctagc(3)ta          . cctagcccta
    469     478       + test2:cctagc(3)ta          . cctagcccta
    501     510       + test2:cctagc(3)ta          . cctagcccta
    801     810       + test2:cctagc(3)ta          . cctagcccta

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 13
#---------------------------------------
</pre>
</td></tr></table><p>

<a name="output.4"></a>
<h3>Output files for usage example 4</h3>
<p><h3>File: l46634.fuzznuc</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
########################################
# Program: fuzznuc
# Rundate: Mon 15 Jul 2013 12:00:00
# Commandline: fuzznuc
#    -sequence tembl:L46634
#    -pattern @../../data/nuc.pat
# Report_format: seqtable
# Report_file: l46634.fuzznuc
########################################

#=======================================
#
# Sequence: L46634     from: 1   to: 1272
# HitCount: 27
#
# Pattern_name Mismatch Pattern
# pat1                0 cggccctaaccctagcccta
# pat2                1 cg(2)c(3)taaccctagc(3)ta
# pat3                0 cggc(2,4)taac(2,5)
# 
# Complement: No
#
#=======================================

  Start     End  Strand Pattern                       Mismatch Sequence
    429     448       + pat1:cggccctaaccctagcccta            . cggccctaaccctagcccta
    491     510       + pat1:cggccctaaccctagcccta            . cggccctaaccctagcccta
    429     448       + pat2:cg(2)c(3)taaccctagc(3)ta        . cggccctaaccctagcccta
    491     510       + pat2:cg(2)c(3)taaccctagc(3)ta        . cggccctaaccctagcccta
    535     554       + pat2:cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    605     624       + pat2:cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    631     650       + pat2:cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    695     714       + pat2:cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    721     740       + pat2:cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    753     772       + pat2:cg(2)c(3)taaccctagc(3)ta        1 cggccctaaccctaacccta
    791     810       + pat2:cg(2)c(3)taaccctagc(3)ta        1 cggcccgaaccctagcccta
    753     763       + pat3:cggc(2,4)taac(2,5)              . cggccctaacc
    753     764       + pat3:cggc(2,4)taac(2,5)              . cggccctaaccc
    721     731       + pat3:cggc(2,4)taac(2,5)              . cggccctaacc
    721     732       + pat3:cggc(2,4)taac(2,5)              . cggccctaaccc
    695     705       + pat3:cggc(2,4)taac(2,5)              . cggccctaacc
    695     706       + pat3:cggc(2,4)taac(2,5)              . cggccctaaccc
    631     641       + pat3:cggc(2,4)taac(2,5)              . cggccctaacc
    631     642       + pat3:cggc(2,4)taac(2,5)              . cggccctaaccc
    605     615       + pat3:cggc(2,4)taac(2,5)              . cggccctaacc
    605     616       + pat3:cggc(2,4)taac(2,5)              . cggccctaaccc
    535     545       + pat3:cggc(2,4)taac(2,5)              . cggccctaacc
    535     546       + pat3:cggc(2,4)taac(2,5)              . cggccctaaccc
    491     501       + pat3:cggc(2,4)taac(2,5)              . cggccctaacc
    491     502       + pat3:cggc(2,4)taac(2,5)              . cggccctaaccc
    429     439       + pat3:cggc(2,4)taac(2,5)              . cggccctaacc
    429     440       + pat3:cggc(2,4)taac(2,5)              . cggccctaaccc

#---------------------------------------
#---------------------------------------

#---------------------------------------
# Total_sequences: 1
# Total_length: 1272
# Reported_sequences: 1
# Reported_hitcount: 27
#---------------------------------------
</pre>
</td></tr></table><p>
    

	
<H2>
    Data files
</H2>

None.

<H2>
    Notes
</H2>

None.


<H2>
    References
</H2>

None.


<H2>
    Warnings
</H2>

None.


<H2>
    Diagnostic Error Messages
</H2>

None.


<H2>
    Exit status
</H2>

It always exits with a status of 0.

<H2>
    Known bugs
</H2>

None.

<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th>
<th>Description</th></tr>
<tr>
<td><a href="dreg.html">dreg</a></td>
<td>Regular expression search of nucleotide sequence(s)</td>
</tr>

<tr>
<td><a href="fuzztran.html">fuzztran</a></td>
<td>Search for patterns in protein sequences (translated)</td>
</tr>

</table>

<H2>
    Author(s)
</H2>
Alan Bleasby 
<br>
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

<p>
Please report all bugs to the EMBOSS bug team (emboss-bug&nbsp;&copy;&nbsp;emboss.open-bio.org) not to the original author.

<H2>
    History
</H2>

Written (2000) - Alan Bleasby
<br>
'-usa' added (13 March 2001) - Gary Williams

<H2>
    Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.

<H2>
    Comments
</H2>
None

</BODY>
</HTML>