1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797
|
<HTML>
<HEAD>
<TITLE>
EMBOSS
</TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">
<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="/images/emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
primersearch
</font></b>
</td></tr>
</table>
<br>
<p>
<H2>
Wiki
</H2>
The master copies of EMBOSS documentation are available
at <a href="http://emboss.open-bio.org/wiki/Appdocs">
http://emboss.open-bio.org/wiki/Appdocs</a>
on the EMBOSS Wiki.
<p>
Please help by correcting and extending the Wiki pages.
<H2>
Function
</H2>
Search DNA sequences for matches with primer pairs
<H2>
Description
</H2>
<p><b>primersearch</b> reads in primer pairs from an input file and searches them against DNA sequence(s) specified by the user. Each of the primers in a pair is searched against the sequence and potential amplimers are reported. The output file is in the format of Whitehead <b>primer3_core</b> program. The user can specify a maximum percent mismatch level; for example, 10% mismatch on a primer of length 20bp means that the program will classify a primer as matching a sequence if 18 of the 20 base pairs matches. It will only report matches if both primers in the pair have a match in opposite orientations.</p>
<H2>
Algorithm
</H2>
<p>Each primer pair is specified in the input file by a name, followed by two primer sequences, primerA and primerB. The program first compares primerA to the forward strand and if it matches, primerB is compared to the reverse strand. The approach is then reversed, with the primerB being compared to the forward strand and primerA to the reverse. In this way all possible amplimers are reported.</p>
<H2>
Usage
</H2>
Here is a sample session with <b>primersearch</b>
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>primersearch tembl:z52466 </b>
Search DNA sequences for matches with primer pairs
Primer pairs file: <b>primers</b>
Allowed percent mismatch [0]: <b></b>
Whitehead primer3_core program output file [z52466.primersearch]: <b></b>
</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>
<p>
<b>Example 2</b>
<p>
Here we run the same example but allowing 20% mismatch between the primers and the sequence:
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>primersearch tembl:z52466 </b>
Search DNA sequences for matches with primer pairs
Primer pairs file: <b>primers</b>
Allowed percent mismatch [0]: <b>20</b>
Whitehead primer3_core program output file [z52466.primersearch]: <b></b>
</pre></td></tr></table><p>
<p>
<a href="#output.2">Go to the output files for this example</a><p><p>
<H2>
Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
Search DNA sequences for matches with primer pairs
Version: EMBOSS:6.6.0.0
Standard (Mandatory) qualifiers:
[-seqall] seqall Nucleotide sequence(s) filename and optional
format, or reference (input USA)
[-infile] infile Primer pairs file
[-mismatchpercent] integer [0] Allowed percent mismatch (Any integer
value)
[-outfile] outfile [*.primersearch] Whitehead primer3_core
program output file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-seqall" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-scircular1 boolean Sequence is circular
-squick1 boolean Read id and sequence only
-sformat1 string Input sequence format
-iquery1 string Input query fields or ID list
-ioffset1 integer Input start position offset
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory4 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left">Qualifier</th>
<th align="left">Type</th>
<th align="left">Description</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Standard (Mandatory) qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td>[-seqall]<br>(Parameter 1)</td>
<td>seqall</td>
<td>Nucleotide sequence(s) filename and optional format, or reference (input USA)</td>
<td>Readable sequence(s)</td>
<td><b>Required</b></td>
</tr>
<tr bgcolor="#FFFFCC">
<td>[-infile]<br>(Parameter 2)</td>
<td>infile</td>
<td>Primer pairs file</td>
<td>Input file</td>
<td><b>Required</b></td>
</tr>
<tr bgcolor="#FFFFCC">
<td>[-mismatchpercent]<br>(Parameter 3)</td>
<td>integer</td>
<td>Allowed percent mismatch</td>
<td>Any integer value</td>
<td>0</td>
</tr>
<tr bgcolor="#FFFFCC">
<td>[-outfile]<br>(Parameter 4)</td>
<td>outfile</td>
<td>Whitehead primer3_core program output file</td>
<td>Output file</td>
<td><i><*></i>.primersearch</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Additional (Optional) qualifiers</th>
</tr>
<tr>
<td colspan=5>(none)</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Advanced (Unprompted) qualifiers</th>
</tr>
<tr>
<td colspan=5>(none)</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Associated qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-seqall" associated seqall qualifiers
</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sbegin1<br>-sbegin_seqall</td>
<td>integer</td>
<td>Start of each sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -send1<br>-send_seqall</td>
<td>integer</td>
<td>End of each sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sreverse1<br>-sreverse_seqall</td>
<td>boolean</td>
<td>Reverse (if DNA)</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sask1<br>-sask_seqall</td>
<td>boolean</td>
<td>Ask for begin/end/reverse</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -snucleotide1<br>-snucleotide_seqall</td>
<td>boolean</td>
<td>Sequence is nucleotide</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sprotein1<br>-sprotein_seqall</td>
<td>boolean</td>
<td>Sequence is protein</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -slower1<br>-slower_seqall</td>
<td>boolean</td>
<td>Make lower case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -supper1<br>-supper_seqall</td>
<td>boolean</td>
<td>Make upper case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -scircular1<br>-scircular_seqall</td>
<td>boolean</td>
<td>Sequence is circular</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -squick1<br>-squick_seqall</td>
<td>boolean</td>
<td>Read id and sequence only</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sformat1<br>-sformat_seqall</td>
<td>string</td>
<td>Input sequence format</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -iquery1<br>-iquery_seqall</td>
<td>string</td>
<td>Input query fields or ID list</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -ioffset1<br>-ioffset_seqall</td>
<td>integer</td>
<td>Input start position offset</td>
<td>Any integer value</td>
<td>0</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sdbname1<br>-sdbname_seqall</td>
<td>string</td>
<td>Database name</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -sid1<br>-sid_seqall</td>
<td>string</td>
<td>Entryname</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -ufo1<br>-ufo_seqall</td>
<td>string</td>
<td>UFO features</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -fformat1<br>-fformat_seqall</td>
<td>string</td>
<td>Features format</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -fopenfile1<br>-fopenfile_seqall</td>
<td>string</td>
<td>Features file name</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-outfile" associated outfile qualifiers
</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -odirectory4<br>-odirectory_outfile</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td> </td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>General qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td> -auto</td>
<td>boolean</td>
<td>Turn off prompts</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -stdout</td>
<td>boolean</td>
<td>Write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -filter</td>
<td>boolean</td>
<td>Read first file from standard input, write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -options</td>
<td>boolean</td>
<td>Prompt for standard and additional values</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -debug</td>
<td>boolean</td>
<td>Write debug output to program.dbg</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -verbose</td>
<td>boolean</td>
<td>Report some/full command line options</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -help</td>
<td>boolean</td>
<td>Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -warning</td>
<td>boolean</td>
<td>Report warnings</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -error</td>
<td>boolean</td>
<td>Report errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -fatal</td>
<td>boolean</td>
<td>Report fatal errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -die</td>
<td>boolean</td>
<td>Report dying program messages</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -version</td>
<td>boolean</td>
<td>Report version number and exit</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
</table>
<H2>
Input file format
</H2>
<b>primersearch</b> reads in one or more nucleotide sequences.
<p>
<p>
The input is a standard EMBOSS sequence query (also known as a 'USA').
<p>
Major sequence database sources defined as standard in EMBOSS
installations include srs:embl, srs:uniprot and ensembl
<p>
Data can also be read from sequence output in any supported format
written by an EMBOSS or third-party application.
<p>
The input format can be specified by using the
command-line qualifier <tt>-sformat xxx</tt>, where 'xxx' is replaced
by the name of the required format. The available format names are:
gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir
(nbrf), swissprot (swiss, sw), dasgff and debug.
<p>
See:
<A href="http://emboss.sf.net/docs/themes/SequenceFormats.html">
http://emboss.sf.net/docs/themes/SequenceFormats.html</A>
for further information on sequence formats.
<p>
<a name="input.1"></a>
<h3>Input files for usage example </h3>
'tembl:z52466' is a sequence entry in the example nucleic acid database 'tembl'
<p>
<p><h3>File: primers</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
# This is my primer file
D1S243 cacacaggctcacatgcc gctccagcgtcatggact
D1S468 aattaaccgttttggtcct gcgacacacacttccc
D1S2845 ccaaagggtgcttctc gtggcattccaacctc
D1S1608 gatggcttttggggactatt cactgagccaagtgacacag
D1S2893 aaaacatcaactctcccctg ctcaaaccccaataagcctt
D1S2660 cacacatgcacatgcac agtgacaccagcaggg
</pre>
</td></tr></table><p>
<p><h3>Database entry: tembl:z52466</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
ID Z52466; SV 1; linear; genomic DNA; STS; HUM; 389 BP.
XX
AC Z52466;
XX
DT 18-MAR-1996 (Rel. 47, Created)
DT 09-SEP-2004 (Rel. 81, Last updated, Version 4)
XX
DE H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1;
DE single read.
XX
KW CA repeat; dinucleotide repeat; GT repeat; microsatellite DNA;
KW microsatellite marker; repeat polymorphism; STS.
XX
OS Homo sapiens (human)
OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC Homo.
XX
RN [1]
RP 1-389
RA Weissenbach J.;
RT ;
RL Submitted (01-SEP-1995) to the INSDC.
RL Genethon, B.P. 60, 91002 Evry Cedex France. E-mail:
RL Jean.Weissenbach@genethon.fr
XX
RN [2]
RP 1-389
RX DOI; 10.1038/380152a0.
RX PUBMED; 8600387.
RA Dib C., Faure S., Fizames C., Samson D., Drouot N., Vignal A.,
RA Millasseau P., Marc S., Hazan J., Seboun E., Lathrop M., Gyapay G.,
RA Morissette J., Weissenbach J.;
RT "A comprehensive genetic map of the human genome based on 5,264
RT microsatellites";
RL Nature 380(6570):152-154(1996).
XX
DR GDB; 606855.
XX
CC full automatic;
XX
FH Key Location/Qualifiers
FH
FT source 1..389
FT /organism="Homo sapiens"
FT /chromosome="1"
FT /mol_type="genomic DNA"
FT /clone_lib="genomic DNA"
FT /cell_line="CEPH 134702"
FT /note="cloning vector is M13mp18"
FT /db_xref="taxon:9606"
XX
SQ Sequence 389 BP; 118 A; 124 C; 86 G; 57 T; 4 other;
agctgtgtgc acacaacatg anggggcaca catgcacatg cacacatgcc cacatgcata 60
tgcacacaca cacacacaca cacacacaca ttcatgccca agcacgccca ccctcatgtc 120
tcaccatgtg cacataacac acagtcacat ataccctggc acacatgccc acatgcagac 180
acgaaacaca ggcccacgnt tncatgcaca caggtatggg cacacatacc atgcacacat 240
aangacaaat accaggccag acatgatttg cccctgctgg tgtcactgtt aagtgtgaca 300
gacaagcaga ggacacacac ccacctggga cgcggggctt caggagagag gcagacctaa 360
tagggcccgg attcggggct ggggaggct 389
//
</pre>
</td></tr></table><p>
<p>
The input primer file has the following format:
<p>
Comment lines start with a '#'
<br>
Lines with primer information have three fields separated by spaces or TAB characters. The columns contain:
<br>
<ol>
<li>The name of the primer pair - this is reported in the output.
<li>The sequence of the first primer.
<li>The sequence of the second primer.
</ol>
<p>
Empty files will cause primersearch to note that no primers have
been found, and to exit.
<H2>
Output file format
</H2>
<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: z52466.primersearch</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
Primer name D1S243
Primer name D1S468
Primer name D1S2845
Primer name D1S1608
Primer name D1S2893
Primer name D1S2660
Amplimer 1
Sequence: Z52466 Z52466
H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches
AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
Amplimer length: 261 bp
</pre>
</td></tr></table><p>
<a name="output.2"></a>
<h3>Output files for usage example 2</h3>
<p><h3>File: z52466.primersearch</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
Primer name D1S243
Primer name D1S468
Primer name D1S2845
Primer name D1S1608
Primer name D1S2893
Primer name D1S2660
Amplimer 1
Sequence: Z52466 Z52466
H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
CACACATGCACATGCAC hits forward strand at 49 with 2 mismatches
AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
Amplimer length: 239 bp
Amplimer 2
Sequence: Z52466 Z52466
H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.
CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches
AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches
Amplimer length: 261 bp
</pre>
</td></tr></table><p>
<H2>
Data files
</H2>
None.
<H2>
Notes
</H2>
<p>Every potential amplimer will be reported; if one primer matches the forward strand twice and the other matches the reverse strand only once, two potential amplimers are reported. If the reverse primer matches twice, four potential amplimers are reported.</p>
<H2>
References
</H2>
None.
<H2>
Warnings
</H2>
<p>This program is processor-intensive. You should probably not use it, for example, to search the whole of EMBL or even the human section of EMBL. It will take longer with more primer pairs and if mismatches are allowed.</p>
<H2>
Diagnostic Error Messages
</H2>
"No suitable primers found - exiting" means that either the primers
file was empty or there were no compilable primer pairs contained in it.
<H2>
Exit status
</H2>
It always exits with status 0
<H2>
Known bugs
</H2>
None.
<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th>
<th>Description</th></tr>
<tr>
<td><a href="eprimer3.html">eprimer3</a></td>
<td>Pick PCR primers and hybridization oligos</td>
</tr>
<tr>
<td><a href="eprimer32.html">eprimer32</a></td>
<td>Pick PCR primers and hybridization oligos</td>
</tr>
<tr>
<td><a href="stssearch.html">stssearch</a></td>
<td>Search a DNA database for matches with a set of STS primers</td>
</tr>
</table>
<p>
<a href="stssearch.html">stssearch</a> does something similar, but doesn't
allow you to find mismatches and will report any match in any
orientation and doesn't require you to have both primers matching.
<H2>
Author(s)
</H2>
Val Curwen formerly at:
<br>
Sanger Institute, Wellcome Trust Genome Campus, Hinxton,
Cambridge, CB10 1SA, UK.
<p>
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.
<H2>
History
</H2>
Written Aug 2000 - Val Curwen
<H2>
Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.
<H2>
Comments
</H2>
None
</BODY>
</HTML>
|