File: seqretsplit.html

package info (click to toggle)
emboss 6.6.0%2Bdfsg-1
links: PTS, VCS
area: main
in suites: jessie, jessie-kfreebsd
size: 571,248 kB
ctags: 39,971
sloc: ansic: 460,578; java: 29,439; perl: 13,573; sh: 12,740; makefile: 3,275; csh: 706; asm: 351; xml: 239; pascal: 237; modula3: 8
file content (1051 lines) | stat: -rw-r--r-- 25,857 bytes
parent folder | download | duplicates (6)
<HTML>
<HEAD>
  <TITLE>
  EMBOSS: seqretsplit
  </TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">


<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="/images/emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
seqretsplit
</font></b>
</td></tr>
</table>
<br>&nbsp;
<p>


<H2>
Wiki
</H2>

The master copies of EMBOSS documentation are available
at <a href="http://emboss.open-bio.org/wiki/Appdocs">
http://emboss.open-bio.org/wiki/Appdocs</a>
on the EMBOSS Wiki.

<p>
Please help by correcting and extending the Wiki pages.

<H2>
    Function
</H2>
Read sequences and write them to individual files
<H2>
    Description
</H2>

<p><b>seqretsplit</b> is a variant of the standard program for reading
and writing sequences, <b>seqret</b>.  It performs exactly the same
function except that when it reads more than one sequence, it writes
each sequence to an individual file. In all other
respects, <b>skipseq</b> is the same as <b>seqret</b>.  Its main use
is therefore to split a file containing multiple sequences into many
files, each containing one sequence. There are many options built-in
into EMBOSS for detailed specification of the input and output
sequences, for example the sequence type and file format.  Optionally,
feature information will be read and written.</p>


<H2>
    Usage
</H2>
Here is a sample session with <b>seqretsplit</b>
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>seqretsplit tembl:m1190* </b>
Read sequences and write them to individual files
output sequence(s) [m11903.fasta]: <b></b>

</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>

<p>

The specification of the output file is not used in this case.
<p>

At some point this ought to change and you will not be prompted for the
output file at all. 

<H2>
    Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
Read sequences and write them to individual files
Version: EMBOSS:6.6.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     (Gapped) sequence(s) filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqoutall  [<sequence>.<format>] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -feature            boolean    Use feature information
   -firstonly          boolean    Read one sequence and stop

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -squick1            boolean    Read id and sequence only
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left">Qualifier</th>
<th align="left">Type</th>
<th align="left">Description</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Standard (Mandatory) qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td>[-sequence]<br>(Parameter 1)</td>
<td>seqall</td>
<td>(Gapped) sequence(s) filename and optional format, or reference (input USA)</td>
<td>Readable sequence(s)</td>
<td><b>Required</b></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>[-outseq]<br>(Parameter 2)</td>
<td>seqoutall</td>
<td>Sequence set(s) filename and optional format (output USA)</td>
<td>Writeable sequence(s)</td>
<td><i>&lt;*&gt;</i>.<i>format</i></td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Additional (Optional) qualifiers</th>
</tr>

<tr>
<td colspan=5>(none)</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Advanced (Unprompted) qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td>-feature</td>
<td>boolean</td>
<td>Use feature information</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-firstonly</td>
<td>boolean</td>
<td>Read one sequence and stop</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Associated qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-sequence" associated seqall qualifiers
</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sbegin1<br>-sbegin_sequence</td>
<td>integer</td>
<td>Start of each sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -send1<br>-send_sequence</td>
<td>integer</td>
<td>End of each sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sreverse1<br>-sreverse_sequence</td>
<td>boolean</td>
<td>Reverse (if DNA)</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sask1<br>-sask_sequence</td>
<td>boolean</td>
<td>Ask for begin/end/reverse</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -snucleotide1<br>-snucleotide_sequence</td>
<td>boolean</td>
<td>Sequence is nucleotide</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sprotein1<br>-sprotein_sequence</td>
<td>boolean</td>
<td>Sequence is protein</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -slower1<br>-slower_sequence</td>
<td>boolean</td>
<td>Make lower case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -supper1<br>-supper_sequence</td>
<td>boolean</td>
<td>Make upper case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -scircular1<br>-scircular_sequence</td>
<td>boolean</td>
<td>Sequence is circular</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -squick1<br>-squick_sequence</td>
<td>boolean</td>
<td>Read id and sequence only</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sformat1<br>-sformat_sequence</td>
<td>string</td>
<td>Input sequence format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -iquery1<br>-iquery_sequence</td>
<td>string</td>
<td>Input query fields or ID list</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ioffset1<br>-ioffset_sequence</td>
<td>integer</td>
<td>Input start position offset</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sdbname1<br>-sdbname_sequence</td>
<td>string</td>
<td>Database name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sid1<br>-sid_sequence</td>
<td>string</td>
<td>Entryname</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ufo1<br>-ufo_sequence</td>
<td>string</td>
<td>UFO features</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fformat1<br>-fformat_sequence</td>
<td>string</td>
<td>Features format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fopenfile1<br>-fopenfile_sequence</td>
<td>string</td>
<td>Features file name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-outseq" associated seqoutall qualifiers
</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -osformat2<br>-osformat_outseq</td>
<td>string</td>
<td>Output seq format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -osextension2<br>-osextension_outseq</td>
<td>string</td>
<td>File name extension</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -osname2<br>-osname_outseq</td>
<td>string</td>
<td>Base file name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -osdirectory2<br>-osdirectory_outseq</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -osdbname2<br>-osdbname_outseq</td>
<td>string</td>
<td>Database name to add</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ossingle2<br>-ossingle_outseq</td>
<td>boolean</td>
<td>Separate file for each entry</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -oufo2<br>-oufo_outseq</td>
<td>string</td>
<td>UFO features</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -offormat2<br>-offormat_outseq</td>
<td>string</td>
<td>Features format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ofname2<br>-ofname_outseq</td>
<td>string</td>
<td>Features file name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ofdirectory2<br>-ofdirectory_outseq</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>General qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td> -auto</td>
<td>boolean</td>
<td>Turn off prompts</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -stdout</td>
<td>boolean</td>
<td>Write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -filter</td>
<td>boolean</td>
<td>Read first file from standard input, write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -options</td>
<td>boolean</td>
<td>Prompt for standard and additional values</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -debug</td>
<td>boolean</td>
<td>Write debug output to program.dbg</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -verbose</td>
<td>boolean</td>
<td>Report some/full command line options</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -help</td>
<td>boolean</td>
<td>Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -warning</td>
<td>boolean</td>
<td>Report warnings</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -error</td>
<td>boolean</td>
<td>Report errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fatal</td>
<td>boolean</td>
<td>Report fatal errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -die</td>
<td>boolean</td>
<td>Report dying program messages</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -version</td>
<td>boolean</td>
<td>Report version number and exit</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

</table>

<H2>
    Input file format
</H2>

<b>seqretsplit</b> reads one or more nucleotide or protein sequences.
<p>
<p>

The input is a standard EMBOSS sequence query (also known as a 'USA').

<p>
Major sequence database sources defined as standard in EMBOSS
installations include srs:embl, srs:uniprot and ensembl

<p>

Data can also be read from sequence output in any supported format
written by an EMBOSS or third-party application.

<p>
The input format can be specified by using the
command-line qualifier <tt>-sformat xxx</tt>, where 'xxx' is replaced
by the name of the required format.  The available format names are:
gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir
(nbrf), swissprot (swiss, sw), dasgff and debug.

<p>

See:
<A href="http://emboss.sf.net/docs/themes/SequenceFormats.html">
http://emboss.sf.net/docs/themes/SequenceFormats.html</A>
for further information on sequence formats.

<p>


<a name="input.1"></a>
<h3>Input files for usage example </h3>

'tembl:m1190*' is a sequence entry in the example nucleic acid database 'tembl'
<p>


<H2>
    Output file format
</H2>

<p>

The output is a standard EMBOSS sequence file. 

<p>

The results can be output in one of several styles by using the
command-line qualifier <tt>-osformat xxx</tt>, where 'xxx' is replaced by
the name of the required format.  The available format names are: embl,
genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel,
feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.

<p>

See:
<A href="http://emboss.sf.net/docs/themes/SequenceFormats.html">
http://emboss.sf.net/docs/themes/SequenceFormats.html</A>
for further information on sequence formats.

<p>
<p>


<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: m11903.fasta</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
&gt;M11903 M11903.1 Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exons 1 and 1A, alternatively spliced.
cctttcaaatagaaactctcgtgaaggctgtctgagaacacaagctcaaggttgtgactg
atttcagtgatgccgtcttgaagagggataccgtgctagagaatgactcctgatcaaccc
tgaagacttctgcaagcccgaagtcgtgcttccccactctgaactgacatatgttcagga
agtagagacgtgcaccgttggatgttctcaaggtaaaaaggaagatttggaagaatgctc
tagtgttgttgccttggagaggaccagggaacagtacaagactcctactgagcagagaga
aaggagcctgacatttaccgataagaaaggtcatttgccttccaacctgtaggcaaggcc
agacaaggaaatatataaaggagaacctcagatcagctctcagtcaagacccttcctgac
aagatgagtcccaccgggttcttcctccttacggtgctccttgttctggtgacagaagca
gcctcgagggggccccgaggtgagtggcaattttgtgctatgggaaagatgtttgagaac
tatgttctcaaaagggagtctgcagaatgctgtgttcccagggcttctccatgaaggaaa
cttgagtcttttcaagctttaaccatagtcctactgtgagtctctgtgacttgacaagca
acattgctggtaaggagggctgagggggaatgcgggcaacggcctcgggtaacatcctca
ttgt
</pre>
</td></tr></table><p>
<p><h3>File: m11904.fasta</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
&gt;M11904 M11904.1 Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exon 2 and complete cds.
ggtatctccaaacacagcagctggctctcaacagagagtcctcatgcacaactaatccaa
gatacagaaagtggatatagagaatgagacattgttttctctcaacagaaaaattctcac
agtcagctgaagacccttatagtgaaaacatgaatctaaagattctggcgagcgggaggg
gatcaagttctacctttggggcattcagccgaagtgagaactctcggagtaacttcaaat
caaaaagtccaagcagtatcaccagggagaaagtgaatgaggaaagcaggagtgaaatga
gtagtaccagcagccattttggtctcaaaatgagaagatctcatggaggaggagaaatga
atccctttgaaaccaaagtaaagacccggatcactcgcaaataatgtgttccccggccaa
ctgaagacttgagcccaataggcaggtaagtgttatcaccaggtgagggcttacaaacta
ctcgtgcctaatccctaggccattgtaggattgtgcacgcagtaaagttgctataagggg
aggtatggaaacgacctacaaggcagacaaagatacgagctatactgtgt
</pre>
</td></tr></table><p>
<p><h3>File: m11905.fasta</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
&gt;M11905 M11905.1 Rattus norvegicus androgen-responsive protein precursor (Svf) gene, exon 3.
ccgtgcaatctcttcctgtgtccacacagccctgttagaagcaactctctcgttctcaag
gccctacctgcaagaactacctttctcttcctccgcccaacaaaggaggaatgtttctgc
ttgtgacccaccagagatgaaatatagcagtgtcctgcagtaaaggggggccccagaggc
atgggacatacacgcattaatccctccacgtcttccctgtcctacctcacaggttgtcct
cgttccctgggtgtcactgaactaagagaagtctatgatgtcttcaggatgcaggatccc
acaggtgccccggaaatagtccgtgcttcttatttcctccttacacttgttttctttaag
attccggaacctgacaagattcaaatttaaccttttcaataaaaaagatactattctgca
tcattatctcctgaaatctcttgcttctgcagtacaggggctgggtgggattcctaaact
tgaccagttctgccgttaaaggaagatcccttctgtgccgtatcagagactatttccaga
ctctggataga
</pre>
</td></tr></table><p>

<p>

One file for each input sequence is written out.

<p>

The names of the files it creates are derived from the ID name of the
sequence, followed by an extension denoting the format of the sequence. 
You have no control over the names of the files it writes out. 

<p>

For example, if the files <i>embl:hsfa11*</i> are read in and the
output is specified as <i>wibble.seq</i>, then the following files are
expected to be created:

<p>

<pre>
hsfa110.fasta
hsfa111.fasta
hsfa112.fasta
hsfa113.fasta
hsfa114.fasta
</pre>

<p>

(No file <i>wibble.seq</i> is created.)

<H2>
    Data files
</H2>

None.

<H2>
    Notes
</H2>

<p>See the documentation for <b>seqret</b> to see the full range of
things that you can do when reading and writing sequences.</p>

<p>Some non-EMBOSS programs will accept only single sequences.  In
such cases <b>seqretsplit</b> is useful for splitting a multiple
sequence file into many individual files.  Some EMBOSS programs will
also read only a single sequence, which may, however, be one of many
in a file. You can specify the sequence using the USA
filename:sequenceID.  Nonetheless, some people feel more comfortable
handling one sequence per file, so <b>seqretsplit</b> will be useful
to them too.</p>

<p>One file for each input sequence is written.  The names of the
files it creates are derived from the ID name of the sequence,
followed by an extension denoting the format of the sequence. You have
no control over the names of the files it writes out. For example, if
the files <tt>embl:hsfa11*</tt> are read in and the output is
specified as <tt>wibble.seq</tt>, then the following files are
expected to be created:</p>

<pre>
hsfa110.fasta
hsfa111.fasta
hsfa112.fasta
hsfa113.fasta
hsfa114.fasta
</pre>

<p>(No file wibble.seq is created.)</p>

<H2>
    References
</H2>

None.

<H2>
    Warnings
</H2>

None.

<H2>
    Diagnostic Error Messages
</H2>

None.

<H2>
    Exit status
</H2>

It always exits with status 0.

<H2>
    Known bugs
</H2>

It shouldn't really prompt for the output filename.
<p>
This is a side effect of the way sequence output works in
EMBOSS. Writing multiple sequences to separate files (the -ossingle
qualifier) does this, and seqretsplit has set it automatically on.

<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th>
<th>Description</th></tr>
<tr>
<td><a href="aligncopy.html">aligncopy</a></td>
<td>Read and write alignments</td>
</tr>

<tr>
<td><a href="aligncopypair.html">aligncopypair</a></td>
<td>Read and write pairs from alignments</td>
</tr>

<tr>
<td><a href="biosed.html">biosed</a></td>
<td>Replace or delete sequence sections</td>
</tr>

<tr>
<td><a href="codcopy.html">codcopy</a></td>
<td>Copy and reformat a codon usage table</td>
</tr>

<tr>
<td><a href="cutseq.html">cutseq</a></td>
<td>Remove a section from a sequence</td>
</tr>

<tr>
<td><a href="degapseq.html">degapseq</a></td>
<td>Remove non-alphabetic (e.g. gap) characters from sequences</td>
</tr>

<tr>
<td><a href="descseq.html">descseq</a></td>
<td>Alter the name or description of a sequence</td>
</tr>

<tr>
<td><a href="entret.html">entret</a></td>
<td>Retrieve sequence entries from flatfile databases and files</td>
</tr>

<tr>
<td><a href="extractalign.html">extractalign</a></td>
<td>Extract regions from a sequence alignment</td>
</tr>

<tr>
<td><a href="extractfeat.html">extractfeat</a></td>
<td>Extract features from sequence(s)</td>
</tr>

<tr>
<td><a href="extractseq.html">extractseq</a></td>
<td>Extract regions from a sequence</td>
</tr>

<tr>
<td><a href="featcopy.html">featcopy</a></td>
<td>Read and write a feature table</td>
</tr>

<tr>
<td><a href="featmerge.html">featmerge</a></td>
<td>Merge two overlapping feature tables</td>
</tr>

<tr>
<td><a href="featreport.html">featreport</a></td>
<td>Read and write a feature table</td>
</tr>

<tr>
<td><a href="feattext.html">feattext</a></td>
<td>Return a feature table original text</td>
</tr>

<tr>
<td><a href="listor.html">listor</a></td>
<td>Write a list file of the logical OR of two sets of sequences</td>
</tr>

<tr>
<td><a href="makenucseq.html">makenucseq</a></td>
<td>Create random nucleotide sequences</td>
</tr>

<tr>
<td><a href="makeprotseq.html">makeprotseq</a></td>
<td>Create random protein sequences</td>
</tr>

<tr>
<td><a href="maskambignuc.html">maskambignuc</a></td>
<td>Mask all ambiguity characters in nucleotide sequences with N</td>
</tr>

<tr>
<td><a href="maskambigprot.html">maskambigprot</a></td>
<td>Mask all ambiguity characters in protein sequences with X</td>
</tr>

<tr>
<td><a href="maskfeat.html">maskfeat</a></td>
<td>Write a sequence with masked features</td>
</tr>

<tr>
<td><a href="maskseq.html">maskseq</a></td>
<td>Write a sequence with masked regions</td>
</tr>

<tr>
<td><a href="newseq.html">newseq</a></td>
<td>Create a sequence file from a typed-in sequence</td>
</tr>

<tr>
<td><a href="nohtml.html">nohtml</a></td>
<td>Remove mark-up (e.g. HTML tags) from an ASCII text file</td>
</tr>

<tr>
<td><a href="noreturn.html">noreturn</a></td>
<td>Remove carriage return from ASCII files</td>
</tr>

<tr>
<td><a href="nospace.html">nospace</a></td>
<td>Remove whitespace from an ASCII text file</td>
</tr>

<tr>
<td><a href="notab.html">notab</a></td>
<td>Replace tabs with spaces in an ASCII text file</td>
</tr>

<tr>
<td><a href="notseq.html">notseq</a></td>
<td>Write to file a subset of an input stream of sequences</td>
</tr>

<tr>
<td><a href="nthseq.html">nthseq</a></td>
<td>Write to file a single sequence from an input stream of sequences</td>
</tr>

<tr>
<td><a href="nthseqset.html">nthseqset</a></td>
<td>Read and write (return) one set of sequences from many</td>
</tr>

<tr>
<td><a href="pasteseq.html">pasteseq</a></td>
<td>Insert one sequence into another</td>
</tr>

<tr>
<td><a href="revseq.html">revseq</a></td>
<td>Reverse and complement a nucleotide sequence</td>
</tr>

<tr>
<td><a href="seqcount.html">seqcount</a></td>
<td>Read and count sequences</td>
</tr>

<tr>
<td><a href="seqret.html">seqret</a></td>
<td>Read and write (return) sequences</td>
</tr>

<tr>
<td><a href="seqretsetall.html">seqretsetall</a></td>
<td>Read and write (return) many sets of sequences</td>
</tr>

<tr>
<td><a href="sizeseq.html">sizeseq</a></td>
<td>Sort sequences by size</td>
</tr>

<tr>
<td><a href="skipredundant.html">skipredundant</a></td>
<td>Remove redundant sequences from an input set</td>
</tr>

<tr>
<td><a href="skipseq.html">skipseq</a></td>
<td>Read and write (return) sequences, skipping first few</td>
</tr>

<tr>
<td><a href="splitsource.html">splitsource</a></td>
<td>Split sequence(s) into original source sequences</td>
</tr>

<tr>
<td><a href="splitter.html">splitter</a></td>
<td>Split sequence(s) into smaller sequences</td>
</tr>

<tr>
<td><a href="trimest.html">trimest</a></td>
<td>Remove poly-A tails from nucleotide sequences</td>
</tr>

<tr>
<td><a href="trimseq.html">trimseq</a></td>
<td>Remove unwanted characters from start and end of sequence(s)</td>
</tr>

<tr>
<td><a href="trimspace.html">trimspace</a></td>
<td>Remove extra whitespace from an ASCII text file</td>
</tr>

<tr>
<td><a href="union.html">union</a></td>
<td>Concatenate multiple sequences into a single sequence</td>
</tr>

<tr>
<td><a href="vectorstrip.html">vectorstrip</a></td>
<td>Remove vectors from the ends of nucleotide sequence(s)</td>
</tr>

<tr>
<td><a href="yank.html">yank</a></td>
<td>Add a sequence reference (a full USA) to a list file</td>
</tr>

</table>


<H2>
    Author(s)
</H2>

Peter Rice
<br>
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

<p>
Please report all bugs to the EMBOSS bug team (emboss-bug&nbsp;&copy;&nbsp;emboss.open-bio.org) not to the original author.
<H2>
    History
</H2>

Written (Jan 2000) - Peter Rice

<H2>
    Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.

<H2>
    Comments
</H2>
The specification of the output file is not used when the output file
names are generated automatically..
<p>

At some point this ought to change and you will not be prompted for the
output file at all. 



</BODY>
</HTML>