1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633
|
<HTML>
<HEAD>
<TITLE>
EMBOSS: tfextract
</TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">
<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="/images/emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
tfextract
</font></b>
</td></tr>
</table>
<br>
<p>
<H2>
Wiki
</H2>
The master copies of EMBOSS documentation are available
at <a href="http://emboss.open-bio.org/wiki/Appdocs">
http://emboss.open-bio.org/wiki/Appdocs</a>
on the EMBOSS Wiki.
<p>
Please help by correcting and extending the Wiki pages.
<H2>
Function
</H2>
Process TRANSFAC transcription factor database for use by tfscan
<H2>
Description
</H2>
<p><b>tfextract</b> extracts data from the TRANSFAC transcription factor database file site.dat (available from <a href="ftp://ftp.ebi.ac.uk/pub/databases/transfac/">ftp://ftp.ebi.ac.uk/pub/databases/transfac/</a>) for other EMBOSS programs, such as <b>tfscan</b>, that use these data. The data is split up by taxonomic groups and placed in individual files that are stored in the EMBOSS data directory. </p>
<H2>
Usage
</H2>
Here is a sample session with <b>tfextract</b>
<p>
<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>
% <b>tfextract </b>
Process TRANSFAC transcription factor database for use by tfscan
Transfac database sites file: <b>site.dat</b>
</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>
<H2>
Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
Process TRANSFAC transcription factor database for use by tfscan
Version: EMBOSS:6.6.0.0
Standard (Mandatory) qualifiers:
[-infile] infile Transfac database sites file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers: (none)
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left">Qualifier</th>
<th align="left">Type</th>
<th align="left">Description</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Standard (Mandatory) qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td>[-infile]<br>(Parameter 1)</td>
<td>infile</td>
<td>Transfac database sites file</td>
<td>Input file</td>
<td><b>Required</b></td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Additional (Optional) qualifiers</th>
</tr>
<tr>
<td colspan=5>(none)</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Advanced (Unprompted) qualifiers</th>
</tr>
<tr>
<td colspan=5>(none)</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Associated qualifiers</th>
</tr>
<tr>
<td colspan=5>(none)</td>
</tr>
<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>General qualifiers</th>
</tr>
<tr bgcolor="#FFFFCC">
<td> -auto</td>
<td>boolean</td>
<td>Turn off prompts</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -stdout</td>
<td>boolean</td>
<td>Write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -filter</td>
<td>boolean</td>
<td>Read first file from standard input, write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -options</td>
<td>boolean</td>
<td>Prompt for standard and additional values</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -debug</td>
<td>boolean</td>
<td>Write debug output to program.dbg</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -verbose</td>
<td>boolean</td>
<td>Report some/full command line options</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -help</td>
<td>boolean</td>
<td>Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -warning</td>
<td>boolean</td>
<td>Report warnings</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -error</td>
<td>boolean</td>
<td>Report errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -fatal</td>
<td>boolean</td>
<td>Report fatal errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -die</td>
<td>boolean</td>
<td>Report dying program messages</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>
<tr bgcolor="#FFFFCC">
<td> -version</td>
<td>boolean</td>
<td>Report version number and exit</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>
</table>
<H2>
Input file format
</H2>
It reads in the TRANSFAC file <b>site.dat</b> available from:
<p>
<!--
<A HREF="http://transfac.gbf.de/cgi-bin/download/download.pl">http://transfac.gbf.de/cgi-bin/download/download.pl</A>
-->
<!--
<A HREF="ftp://transfac.gbf.de/pub/transfac/ascii/old/tf_3.2/transfac32.tar.Z">
ftp://transfac.gbf.de/pub/transfac/ascii/old/tf_3.2/transfac32.tar.Z
-->
<A HREF="ftp://ftp.ebi.ac.uk/pub/databases/transfac/">
ftp://ftp.ebi.ac.uk/pub/databases/transfac/
</A>
<p>
<a name="input.1"></a>
<h3>Input files for usage example </h3>
<p><h3>File: site.dat</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
AC R00077
XX
ID HS$ALBU_01
XX
DT 20.06.90 (created); ewi.
DT 24.08.95 (updated); hiwi.
XX
TY D
XX
DE albumin; Gene: G000188.
XX
SQ tGGTTAGtaattactaa.
XX
SF -363
ST -338
XX
BF T00368; HNF-1A;Quality: 1; Species: human, Homo sapiens.
BF T00369; HNF-1;Quality: 1; Species: rat, Rattus norvegicus.
BF T01950; HNF-1B;Quality: 1; Species: human, Homo sapiens.
BF T01951; HNF-1C;Quality: 1; Species: human, Homo sapiens.
XX
OS human, Homo sapiens
OC eukaryota; animalia; metazoa; chordata; vertebrata;
OC tetrapoda; mammalia; eutheria; primates
XX
SO 0103; Hep3B
SO 0289; rl
XX
MM gel retardation
MM direct gel shift
MM DNase I footprinting
MM gel shift competition
MM affinity chromatography
MM methylation interference
XX
DR EMBL: M13075; HSALBEX1(695:711).
XX
RN [1]
RA Frain M., Swart G., Monaci P., Nicosia A., Staempfli
RA S., Frank R., Cortese R.
RT The liver-specific transcription factor LF-B1 contains
RT a highly diverged homeobox DNA binding domain
RL Cell 59:145-157 (1989).
RN [2]
RA Frain M., Hardon E., Ciliberto G., Sala-Trepat J. M.
RT Binding of a liver-specific factor to the human albumin
RT gene promoter and enhancer
RL Mol. Cell. Biol. 10:991-999 (1990).
XX
//
<font color=red> [Part of this file has been deleted for brevity]</font>
DR EMBL: U11854; MM11854(1931:1941).
XX
RN [1]
RA Feinman R., Qiu W. Q., Pearse R. N., Nikolajczyk B.
RA S., Sen R., Sheffery M., Ravetch J. V.
RT PU.1 and an HLH family member contribute to the myeloid-specific
RT transcription of the FcgammaRIIIA promoter
RL EMBO J. 13:3852-3860 (1994).
XX
//
AC R04413
XX
ID MOUSE$FCGR3A_02
XX
DT 14.05.97 (created); ewi.
DT 14.05.97 (updated); ewi.
XX
TY D
XX
DE FcgammaRIIIA (low-affinity Fc receptor IIIA for IgG); Gene: G001014.
XX
SQ TTCCTC.
XX
EL MRR
XX
SF -48
ST -43
XX
BF T00702; PU.1;Quality: 3; Species: mouse, Mus musculus.
XX
OS mouse, Mus musculus
OC eukaryota; animalia; metazoa; chordata; vertebrata;
OC tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae; murinae
XX
SO 0495; A20
SO 0848; RAW264.7
XX
MM direct gel shift
MM methylation interference
MM supershift (antibody binding)
XX
DR EMBL: U11854; MM11854(1971:1976).
XX
RN [1]
RA Feinman R., Qiu W. Q., Pearse R. N., Nikolajczyk B.
RA S., Sen R., Sheffery M., Ravetch J. V.
RT PU.1 and an HLH family member contribute to the myeloid-specific
RT transcription of the FcgammaRIIIA promoter
RL EMBO J. 13:3852-3860 (1994).
XX
//
</pre>
</td></tr></table><p>
<H2>
Output file format
</H2>
<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: tffungi</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
Y$ADH1_02 ACAATATGGACTTCCTCTTTTCTGG R04140 T00322; GCR1;Quality: 2; Species: yeast, Saccharomyces cerevisiae.
</pre>
</td></tr></table><p>
<p><h3>File: tfinsect</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
</pre>
</td></tr></table><p>
<p><h3>File: tfvertebrate</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
HS$ALBU_01 tGGTTAGtaattactaa R00077 T01951; HNF-1C;Quality: 1; Species: human, Homo sapiens.
HS$ALBU_02 TTGGCA R00078 T00599; NF-1/L;Quality: 6; Species: rat, Rattus norvegicus.
HS$ALBU_03 TGGCA R00079 T00599; NF-1/L;Quality: 6; Species: rat, Rattus norvegicus.
HS$ALBU_04 TTAATAAT R00080 T00015; AFP1;Quality: 6; Species: human, Homo sapiens.
HS$ALBU_05 TCTAGTTAATAATCTACAAT R00081 T00369; HNF-1;Quality: 4; Species: rat, Rattus norvegicus.
MOUSE$FCGR3A_01 GTCTGCTGACC R04412 T00874; USF;Quality: 2; Species: human, Homo sapiens.
MOUSE$FCGR3A_02 TTCCTC R04413 T00702; PU.1;Quality: 3; Species: mouse, Mus musculus.
</pre>
</td></tr></table><p>
<p><h3>File: tfplant</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
</pre>
</td></tr></table><p>
<p><h3>File: tfother</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
</pre>
</td></tr></table><p>
<p>
The output from tfextract is a set of files in the emboss/data
directory containing reformatted sites from the transfac database.
<p>
These files are used by the tfscan program to search for TRANSFAC sites in
sequences.
<H2>
Data files
</H2>
<p>
EMBOSS data files are distributed with the application and stored
in the standard EMBOSS data directory, which is defined
by the EMBOSS environment variable EMBOSS_DATA.
<p>
To see the available EMBOSS data files, run:
<p>
<pre>
% embossdata -showall
</pre>
<p>
To fetch one of the data files (for example 'Exxx.dat') into your
current directory for you to inspect or modify, run:
<pre>
% embossdata -fetch -file Exxx.dat
</pre>
<p>
Users can provide their own data files in their own directories.
Project specific files can be put in the current directory, or for
tidier directory listings in a subdirectory called
".embossdata". Files for all EMBOSS runs can be put in the user's home
directory, or again in a subdirectory called ".embossdata".
<p>
The directories are searched in the following order:
<ul>
<li> . (your current directory)
<li> .embossdata (under your current directory)
<li> ~/ (your home directory)
<li> ~/.embossdata
</ul>
<p>
<H2>
Notes
</H2>
<p>The TRANSFAC Database is a commercial database of eukaryotic cis-acting regulatory DNA elements and trans-acting factors. It covers the whole range from yeast to human. An old public domain version is available at: <a href="ftp://ftp.ebi.ac.uk/pub/databases/transfac/transfac32.tar.Z">ftp://ftp.ebi.ac.uk/pub/databases/transfac/transfac32.tar.Z</a></p>
<p>TRANSFAC started in 1988 with a printed compilation (Nucleic Acids Res. 16: 1879-1902, 1988) and was transferred into computer-readable format in 1990 (BioTechForum - Advances in Molecular Genetics (J. Collins, A.J. Driesel, eds.) 4:95-108, 1991). The basic structures of Table 1 and 2 of the compilation were taken as the core of the emergent database. The aim of the early compilation as well as of the TRANSFAC database is:
1. to guide through a meanwhile overwhelming amount of data in a field which is connected to nearly all areas of modern molecular biology;
2. to map the regulatory sites in the individual genes and, ultimately, in the genome(s) as a whole;
3. to develop a tool for the identification of regulatory elements in newly unravelled genomic sequences;
4. to provide a basis for a more comprehensive understanding of how the genome governs transcriptional control.
</p>
<p>The program <b>tfextract</b> extracts data from the TRANSFAC database file <tt>site.dat</tt>. This file contains information on individual (putatively) regulatory protein binding sites. About half of these refer to sites within eukaryotic genes. Just under half of them resulted from mutagenesis studies, in vitro selection procedures starting from random oligonucleotide mixtures or from specific theoretical considerations. And finally, there are about 5% with consensus binding sequences given in the IUPAC code, many of them being taken from the compilation of Faisst and Meyer (Nucleic Acids Res. 20:3-26, 1992). A number of consensi have been generated by the TRANSFAC team, generally derived from the profiles stored in the MATRIX table.</p>
<p>The data is split up by taxonomic groups:<p>
<ul>
<li>Fungi
<li>Insects
<li>Plants
<li>Vertebrates
<li>Other
</ul>
<p>and placed in individual files:</p>
<ul>
<li>tffungi
<li>tfinsect
<li>tfplant
<li>tfvertebrate
<li>tfother
</ul>
<p>These files are stored in the EMBOSS data directory, see Data Files below.</p>
<H2>
References
</H2>
<ul>
<li>Nucleic Acids Res. 16: 1879-1902, 1988
<li>BioTechForum - Advances in Molecular Genetics (J. Collins,A.J.
Driesel, eds.) 4:95-108, 1991
<li>Nucleic Acids Res. 20:3-26, 1992
</ul>
<H2>
Warnings
</H2>
None.
<H2>
Diagnostic Error Messages
</H2>
None.
<H2>
Exit status
</H2>
It always exits with a status of 0.
<H2>
Known bugs
</H2>
None.
<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th>
<th>Description</th></tr>
<tr>
<td><a href="aaindexextract.html">aaindexextract</a></td>
<td>Extract amino acid property data from AAINDEX</td>
</tr>
<tr>
<td><a href="cutgextract.html">cutgextract</a></td>
<td>Extract codon usage tables from CUTG database</td>
</tr>
<tr>
<td><a href="jaspextract.html">jaspextract</a></td>
<td>Extract data from JASPAR</td>
</tr>
<tr>
<td><a href="printsextract.html">printsextract</a></td>
<td>Extract data from PRINTS database for use by pscan</td>
</tr>
<tr>
<td><a href="prosextract.html">prosextract</a></td>
<td>Process the PROSITE motif database for use by patmatmotifs</td>
</tr>
<tr>
<td><a href="rebaseextract.html">rebaseextract</a></td>
<td>Process the REBASE database for use by restriction enzyme applications</td>
</tr>
</table>
<H2>
Author(s)
</H2>
Alan Bleasby
<br>
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK
<p>
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.
<H2>
History
</H2>
Written Summer 2000 - Alan Bleasby.
<H2>
Target users
</H2>
This program is intended to be used by administrators responsible
for software and database installation and maintenance.
<H2>
Comments
</H2>
None
</BODY>
</HTML>
|