File: descseq.html

package info (click to toggle)
emboss 6.6.0%2Bdfsg-7
links: PTS, VCS
area: main
in suites: buster
size: 571,544 kB
sloc: ansic: 460,579; java: 29,439; perl: 13,573; sh: 12,754; makefile: 3,283; csh: 706; asm: 351; xml: 239; pascal: 237; modula3: 8
file content (999 lines) | stat: -rw-r--r-- 23,441 bytes
parent folder | download | duplicates (7)
<HTML>

<HEAD>
  <TITLE>
  EMBOSS: descseq
  </TITLE>
</HEAD>
<BODY BGCOLOR="#FFFFFF" text="#000000">

<table align=center border=0 cellspacing=0 cellpadding=0>
<tr><td valign=top>
<A HREF="/" ONMOUSEOVER="self.status='Go to the EMBOSS home page';return true"><img border=0 src="/images/emboss_icon.jpg" alt="" width=150 height=48></a>
</td>
<td align=left valign=middle>
<b><font size="+6">
descseq
</font></b>
</td></tr>
</table>
<br>&nbsp;
<p>



<H2>
Wiki
</H2>

The master copies of EMBOSS documentation are available
at <a href="http://emboss.open-bio.org/wiki/Appdocs">
http://emboss.open-bio.org/wiki/Appdocs</a>
on the EMBOSS Wiki.

<p>
Please help by correcting and extending the Wiki pages.

<H2>
    Function
</H2>
Alter the name or description of a sequence
<H2>
    Description
</H2>

<p><b>descseq</b> reads a sequence and writes it to file but with a different name and / or description.  All other records including the sequence itself are left unaltered.</p>

<H2>
    Usage
</H2>
Here is a sample session with <b>descseq</b>
<p>
Set the name of a sequence to "myclone23"  
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>descseq -seq dna.text -out clone23.seq -name "myclone23" </b>
Alter the name or description of a sequence.

</pre></td></tr></table><p>
<p>
<a href="#input.1">Go to the input files for this example</a><br><a href="#output.1">Go to the output files for this example</a><p><p>
<p>
<b>Example 2</b>
<p>
Set the description of a sequence to "This is my clone number 244"  
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>descseq -seq dna.text -out xy24.seq -desc "This is my clone number 244" </b>
Alter the name or description of a sequence.

</pre></td></tr></table><p>
<p>
<a href="#output.2">Go to the output files for this example</a><p><p>
<p>
<b>Example 3</b>
<p>
Append some text to the description of a sequence 
<p>

<p>
<table width="90%"><tr><td bgcolor="#CCFFFF"><pre>

% <b>descseq -seq dna.text -out est4.seq -desc " (submitted)" -append </b>
Alter the name or description of a sequence.

</pre></td></tr></table><p>
<p>
<a href="#output.3">Go to the output files for this example</a><p><p>

<H2>
    Command line arguments
</H2>
<table CELLSPACING=0 CELLPADDING=3 BGCOLOR="#f5f5ff" ><tr><td>
<pre>
Alter the name or description of a sequence.
Version: EMBOSS:6.6.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   (Gapped) sequence filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqout     [<sequence>.<format>] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers:
   -name               string     Name of the sequence (Any string)
   -description        string     Description of the sequence (Any string)

   Advanced (Unprompted) qualifiers:
   -append             boolean    [N] This allows you to append the name or
                                  description you have given on to the end of
                                  the existing name or description of the
                                  sequence.

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -squick1            boolean    Read id and sequence only
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

</pre>
</td></tr></table>
<P>
<table border cellspacing=0 cellpadding=3 bgcolor="#ccccff">
<tr bgcolor="#FFFFCC">
<th align="left">Qualifier</th>
<th align="left">Type</th>
<th align="left">Description</th>
<th align="left">Allowed values</th>
<th align="left">Default</th>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Standard (Mandatory) qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td>[-sequence]<br>(Parameter 1)</td>
<td>sequence</td>
<td>(Gapped) sequence filename and optional format, or reference (input USA)</td>
<td>Readable sequence</td>
<td><b>Required</b></td>
</tr>

<tr bgcolor="#FFFFCC">
<td>[-outseq]<br>(Parameter 2)</td>
<td>seqout</td>
<td>Sequence filename and optional format (output USA)</td>
<td>Writeable sequence</td>
<td><i>&lt;*&gt;</i>.<i>format</i></td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Additional (Optional) qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td>-name</td>
<td>string</td>
<td>Name of the sequence</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td>-description</td>
<td>string</td>
<td>Description of the sequence</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Advanced (Unprompted) qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td>-append</td>
<td>boolean</td>
<td>This allows you to append the name or description you have given on to the end of the existing name or description of the sequence.</td>
<td>Boolean value Yes/No</td>
<td>No</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>Associated qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-sequence" associated sequence qualifiers
</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sbegin1<br>-sbegin_sequence</td>
<td>integer</td>
<td>Start of the sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -send1<br>-send_sequence</td>
<td>integer</td>
<td>End of the sequence to be used</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sreverse1<br>-sreverse_sequence</td>
<td>boolean</td>
<td>Reverse (if DNA)</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sask1<br>-sask_sequence</td>
<td>boolean</td>
<td>Ask for begin/end/reverse</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -snucleotide1<br>-snucleotide_sequence</td>
<td>boolean</td>
<td>Sequence is nucleotide</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sprotein1<br>-sprotein_sequence</td>
<td>boolean</td>
<td>Sequence is protein</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -slower1<br>-slower_sequence</td>
<td>boolean</td>
<td>Make lower case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -supper1<br>-supper_sequence</td>
<td>boolean</td>
<td>Make upper case</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -scircular1<br>-scircular_sequence</td>
<td>boolean</td>
<td>Sequence is circular</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -squick1<br>-squick_sequence</td>
<td>boolean</td>
<td>Read id and sequence only</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sformat1<br>-sformat_sequence</td>
<td>string</td>
<td>Input sequence format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -iquery1<br>-iquery_sequence</td>
<td>string</td>
<td>Input query fields or ID list</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ioffset1<br>-ioffset_sequence</td>
<td>integer</td>
<td>Input start position offset</td>
<td>Any integer value</td>
<td>0</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sdbname1<br>-sdbname_sequence</td>
<td>string</td>
<td>Database name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -sid1<br>-sid_sequence</td>
<td>string</td>
<td>Entryname</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ufo1<br>-ufo_sequence</td>
<td>string</td>
<td>UFO features</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fformat1<br>-fformat_sequence</td>
<td>string</td>
<td>Features format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fopenfile1<br>-fopenfile_sequence</td>
<td>string</td>
<td>Features file name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td align="left" colspan=5>"-outseq" associated seqout qualifiers
</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -osformat2<br>-osformat_outseq</td>
<td>string</td>
<td>Output seq format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -osextension2<br>-osextension_outseq</td>
<td>string</td>
<td>File name extension</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -osname2<br>-osname_outseq</td>
<td>string</td>
<td>Base file name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -osdirectory2<br>-osdirectory_outseq</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -osdbname2<br>-osdbname_outseq</td>
<td>string</td>
<td>Database name to add</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ossingle2<br>-ossingle_outseq</td>
<td>boolean</td>
<td>Separate file for each entry</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -oufo2<br>-oufo_outseq</td>
<td>string</td>
<td>UFO features</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -offormat2<br>-offormat_outseq</td>
<td>string</td>
<td>Features format</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ofname2<br>-ofname_outseq</td>
<td>string</td>
<td>Features file name</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -ofdirectory2<br>-ofdirectory_outseq</td>
<td>string</td>
<td>Output directory</td>
<td>Any string</td>
<td>&nbsp;</td>
</tr>

<tr bgcolor="#FFFFCC">
<th align="left" colspan=5>General qualifiers</th>
</tr>

<tr bgcolor="#FFFFCC">
<td> -auto</td>
<td>boolean</td>
<td>Turn off prompts</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -stdout</td>
<td>boolean</td>
<td>Write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -filter</td>
<td>boolean</td>
<td>Read first file from standard input, write first file to standard output</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -options</td>
<td>boolean</td>
<td>Prompt for standard and additional values</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -debug</td>
<td>boolean</td>
<td>Write debug output to program.dbg</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -verbose</td>
<td>boolean</td>
<td>Report some/full command line options</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -help</td>
<td>boolean</td>
<td>Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -warning</td>
<td>boolean</td>
<td>Report warnings</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -error</td>
<td>boolean</td>
<td>Report errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -fatal</td>
<td>boolean</td>
<td>Report fatal errors</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -die</td>
<td>boolean</td>
<td>Report dying program messages</td>
<td>Boolean value Yes/No</td>
<td>Y</td>
</tr>

<tr bgcolor="#FFFFCC">
<td> -version</td>
<td>boolean</td>
<td>Report version number and exit</td>
<td>Boolean value Yes/No</td>
<td>N</td>
</tr>

</table>

<H2>
    Input file format
</H2>

<b>descseq</b> reads a single nucleotide or protein sequence.
<p>
<p>

The input is a standard EMBOSS sequence query (also known as a 'USA').

<p>
Major sequence database sources defined as standard in EMBOSS
installations include srs:embl, srs:uniprot and ensembl

<p>

Data can also be read from sequence output in any supported format
written by an EMBOSS or third-party application.

<p>
The input format can be specified by using the
command-line qualifier <tt>-sformat xxx</tt>, where 'xxx' is replaced
by the name of the required format.  The available format names are:
gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir
(nbrf), swissprot (swiss, sw), dasgff and debug.

<p>

See:
<A href="http://emboss.sf.net/docs/themes/SequenceFormats.html">
http://emboss.sf.net/docs/themes/SequenceFormats.html</A>
for further information on sequence formats.

<p>

<a name="input.1"></a>
<h3>Input files for usage example </h3>
<p><h3>File: dna.text</h3>
<table width="90%"><tr><td bgcolor="#FFCCFF">
<pre>
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
</pre>
</td></tr></table><p>

<H2>
    Output file format
</H2>


<b>descseq</b> writes the sequence file with a changed name or description.
<p>
<p>

The output is a standard EMBOSS sequence file. 

<p>

The results can be output in one of several styles by using the
command-line qualifier <tt>-osformat xxx</tt>, where 'xxx' is replaced by
the name of the required format.  The available format names are: embl,
genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel,
feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.

<p>

See:
<A href="http://emboss.sf.net/docs/themes/SequenceFormats.html">
http://emboss.sf.net/docs/themes/SequenceFormats.html</A>
for further information on sequence formats.

<p>

<p>

<a name="output.1"></a>
<h3>Output files for usage example </h3>
<p><h3>File: clone23.seq</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
&gt;myclone23
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
</pre>
</td></tr></table><p>

<a name="output.2"></a>
<h3>Output files for usage example 2</h3>
<p><h3>File: xy24.seq</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
&gt;EMBOSS_001 This is my clone number 244
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
</pre>
</td></tr></table><p>

<a name="output.3"></a>
<h3>Output files for usage example 3</h3>
<p><h3>File: est4.seq</h3>
<table width="90%"><tr><td bgcolor="#CCFFCC">
<pre>
&gt;EMBOSS_001  (submitted)
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
</pre>
</td></tr></table><p>

<H2>
    Data files
</H2>


None.
	
<H2>
    Notes
</H2>

<p>Most sequence formats allow, at the very minimum, a name for the sequence and some comments to be stored in the sequence file.  <b>descseq</b> let's you change the sequence name and / or description, and is far more convenient and less error-prone than using the editor for editing.</p>
<p>The default action is to replace the existing name or description with your new one, but by using the qualifier <tt>-append</tt> what you enter is appended to the existing name or description.  Note that if you append to a description, no space is inserted by default bewteen the existing description and your appended text. You have to put in a space yourself if you require one. </p>
	
<H2>
    References
</H2>


None.
	
<H2>
    Warnings
</H2>


None.
	
<H2>
    Diagnostic Error Messages
</H2>


None.
	
<H2>
    Exit status
</H2>


It always exits with status 0.

<H2>
    Known bugs
</H2>


None noted.

<h2><a name="See also">See also</a></h2>
<table border cellpadding=4 bgcolor="#FFFFF0">
<tr><th>Program name</th>
<th>Description</th></tr>
<tr>
<td><a href="aligncopy.html">aligncopy</a></td>
<td>Read and write alignments</td>
</tr>

<tr>
<td><a href="aligncopypair.html">aligncopypair</a></td>
<td>Read and write pairs from alignments</td>
</tr>

<tr>
<td><a href="biosed.html">biosed</a></td>
<td>Replace or delete sequence sections</td>
</tr>

<tr>
<td><a href="codcopy.html">codcopy</a></td>
<td>Copy and reformat a codon usage table</td>
</tr>

<tr>
<td><a href="cutseq.html">cutseq</a></td>
<td>Remove a section from a sequence</td>
</tr>

<tr>
<td><a href="degapseq.html">degapseq</a></td>
<td>Remove non-alphabetic (e.g. gap) characters from sequences</td>
</tr>

<tr>
<td><a href="entret.html">entret</a></td>
<td>Retrieve sequence entries from flatfile databases and files</td>
</tr>

<tr>
<td><a href="extractalign.html">extractalign</a></td>
<td>Extract regions from a sequence alignment</td>
</tr>

<tr>
<td><a href="extractfeat.html">extractfeat</a></td>
<td>Extract features from sequence(s)</td>
</tr>

<tr>
<td><a href="extractseq.html">extractseq</a></td>
<td>Extract regions from a sequence</td>
</tr>

<tr>
<td><a href="featcopy.html">featcopy</a></td>
<td>Read and write a feature table</td>
</tr>

<tr>
<td><a href="featmerge.html">featmerge</a></td>
<td>Merge two overlapping feature tables</td>
</tr>

<tr>
<td><a href="featreport.html">featreport</a></td>
<td>Read and write a feature table</td>
</tr>

<tr>
<td><a href="feattext.html">feattext</a></td>
<td>Return a feature table original text</td>
</tr>

<tr>
<td><a href="listor.html">listor</a></td>
<td>Write a list file of the logical OR of two sets of sequences</td>
</tr>

<tr>
<td><a href="makenucseq.html">makenucseq</a></td>
<td>Create random nucleotide sequences</td>
</tr>

<tr>
<td><a href="makeprotseq.html">makeprotseq</a></td>
<td>Create random protein sequences</td>
</tr>

<tr>
<td><a href="maskambignuc.html">maskambignuc</a></td>
<td>Mask all ambiguity characters in nucleotide sequences with N</td>
</tr>

<tr>
<td><a href="maskambigprot.html">maskambigprot</a></td>
<td>Mask all ambiguity characters in protein sequences with X</td>
</tr>

<tr>
<td><a href="maskfeat.html">maskfeat</a></td>
<td>Write a sequence with masked features</td>
</tr>

<tr>
<td><a href="maskseq.html">maskseq</a></td>
<td>Write a sequence with masked regions</td>
</tr>

<tr>
<td><a href="newseq.html">newseq</a></td>
<td>Create a sequence file from a typed-in sequence</td>
</tr>

<tr>
<td><a href="nohtml.html">nohtml</a></td>
<td>Remove mark-up (e.g. HTML tags) from an ASCII text file</td>
</tr>

<tr>
<td><a href="noreturn.html">noreturn</a></td>
<td>Remove carriage return from ASCII files</td>
</tr>

<tr>
<td><a href="nospace.html">nospace</a></td>
<td>Remove whitespace from an ASCII text file</td>
</tr>

<tr>
<td><a href="notab.html">notab</a></td>
<td>Replace tabs with spaces in an ASCII text file</td>
</tr>

<tr>
<td><a href="notseq.html">notseq</a></td>
<td>Write to file a subset of an input stream of sequences</td>
</tr>

<tr>
<td><a href="nthseq.html">nthseq</a></td>
<td>Write to file a single sequence from an input stream of sequences</td>
</tr>

<tr>
<td><a href="nthseqset.html">nthseqset</a></td>
<td>Read and write (return) one set of sequences from many</td>
</tr>

<tr>
<td><a href="pasteseq.html">pasteseq</a></td>
<td>Insert one sequence into another</td>
</tr>

<tr>
<td><a href="revseq.html">revseq</a></td>
<td>Reverse and complement a nucleotide sequence</td>
</tr>

<tr>
<td><a href="seqcount.html">seqcount</a></td>
<td>Read and count sequences</td>
</tr>

<tr>
<td><a href="seqret.html">seqret</a></td>
<td>Read and write (return) sequences</td>
</tr>

<tr>
<td><a href="seqretsetall.html">seqretsetall</a></td>
<td>Read and write (return) many sets of sequences</td>
</tr>

<tr>
<td><a href="seqretsplit.html">seqretsplit</a></td>
<td>Read sequences and write them to individual files</td>
</tr>

<tr>
<td><a href="sizeseq.html">sizeseq</a></td>
<td>Sort sequences by size</td>
</tr>

<tr>
<td><a href="skipredundant.html">skipredundant</a></td>
<td>Remove redundant sequences from an input set</td>
</tr>

<tr>
<td><a href="skipseq.html">skipseq</a></td>
<td>Read and write (return) sequences, skipping first few</td>
</tr>

<tr>
<td><a href="splitsource.html">splitsource</a></td>
<td>Split sequence(s) into original source sequences</td>
</tr>

<tr>
<td><a href="splitter.html">splitter</a></td>
<td>Split sequence(s) into smaller sequences</td>
</tr>

<tr>
<td><a href="trimest.html">trimest</a></td>
<td>Remove poly-A tails from nucleotide sequences</td>
</tr>

<tr>
<td><a href="trimseq.html">trimseq</a></td>
<td>Remove unwanted characters from start and end of sequence(s)</td>
</tr>

<tr>
<td><a href="trimspace.html">trimspace</a></td>
<td>Remove extra whitespace from an ASCII text file</td>
</tr>

<tr>
<td><a href="union.html">union</a></td>
<td>Concatenate multiple sequences into a single sequence</td>
</tr>

<tr>
<td><a href="vectorstrip.html">vectorstrip</a></td>
<td>Remove vectors from the ends of nucleotide sequence(s)</td>
</tr>

<tr>
<td><a href="yank.html">yank</a></td>
<td>Add a sequence reference (a full USA) to a list file</td>
</tr>

</table>

<H2>
    Author(s)
</H2>

Gary Williams formerly at:
<br>
MRC Rosalind Franklin Centre for Genomics Research
Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

<p>
Please report all bugs to the EMBOSS bug team (emboss-bug&nbsp;&copy;&nbsp;emboss.open-bio.org) not to the original author.

<H2>
    History
</H2>


<H2>
    Target users
</H2>
This program is intended to be used by everyone and everything, from naive users to embedded scripts.

<H2>
    Comments
</H2>
None

</BODY>
</HTML>