1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414
|
0. Availability
============
The source code for this package is available from
http://research-pub.gene.com/gmap. License terms are provided in the
LICENSE file.
1. Building and installing GMAP and GSNAP
==========================================
Prerequisites: a Unix system (including Cygwin on Windows), a C
compiler, and Perl
Step 1: Set your site-specific variables by editing the file
config.site. In particular, you should set appropriate values for
"prefix" and probably for "with_gmapdb", as explained in that file.
If you are compiling this package on a Macintosh, you may need to edit
CFLAGS to be
CFLAGS = '-O3 -m64'
since Macintosh machines will make only 32-bit executables by default.
Step 2: Build, test, and install the programs, by running the
following GNU commands
./configure
make
make check (optional)
make install
Note 1: Instead of editing the config.site file in step 1, you may type
everything on the command line for the ./configure script in step 2,
like this
./configure --prefix=/your/usr/local/path --with-gmapdb=/path/to/gmapdb
If you omit --with-gmapdb, it defaults to ${prefix}/share. If you
omit --prefix, it defaults to /usr/local. Note that on the command
line, it is "with-gmapdb" with a hyphen, but in a config.site file,
it is "with_gmapdb" with an underscore.
Note 2: If you want to keep your version of config.site or have
multiple versions, you can save the file to a different filename, and
then refer to it like this
./configure CONFIG_SITE=<config site file>
Note 3: GSNAP can read from gzip-compressed FASTA or FASTQ input
files. This feature requires the zlib library to be present
(available from http://www.zlib.net). The configure program will
detect the availability of zlib automatically. However, to disable
this feature, you can add "--disable-zlib" to the ./configure command
or edit your config.site file to have the command "disable_zlib".
Note 4: GSNAP can read from bzip2-compressed FASTA or FASTQ input
files. This feature requires the bzlib library to be present. The
configure program will detect the availability of bzlib automatically.
However, to disable this feature, you can add "--disable-bzlib" to the
./configure command or edit your config.site file to have the command
"disable_bzlib".
2. Possible issues during compilation
======================================
Recent versions of GMAP and GSNAP use certain techniques to achieve
increased speed. One of these techniques is special SIMD
(single-instruction, multiple data) instructions that can perform some
computations in parallel. There are various levels of SIMD
instructions, and we use those from the SSE2, SSE4.1, AVX2, and AVX512
instruction sets, depending on the capabilities of the computer. Most
computers built within the last 10 years should support SSE2 at least.
However, you may run into the following issues:
Issue 1: If you have a computer cluster with different types of SIMD
capabilities, then you should compile the source code multiple times,
one on each type of computer. If your computer has SSE2 capabilities,
the ./configure and "make install" commands will create the programs
gmap.sse2 and gsnap.sse2. Likewise, if your computer has AVX2
capabilities, the ./configure and "make install" commands will create
gmap.avx2 and gsnap.avx2. The gmap and gsnap programs are dispatch
programs that determine at run time what capabilities the computer has
and call the appropriate version of the program (e.g., gsnap.sse2 or
gsnap.avx2). The ./configure and "make install" commands will also
create versions of the programs, gmap.nosimd and gsnap.nosimd, that do
not depend on SIMD. If the gmap and gsnap dispatch programs cannot
find a version of the program that matches the given computer, then it
will run the non-SIMD version instead.
Issue 2. If you compile the code successfully, but when you run the
program, you see something that says "Illegal instruction", then you
must be running GMAP or GSNAP on a different computer than the one
where you compiled it. The dispatch program should not allow this to
happen, especially if you have compiled the code on a computer of each
type in your cluster, so you can report this error to the authors and
we can try to help. In the worst case, you can compile your program
for the lowest common denominator by by providing the
--simd-level=<level> flag to ./configure.
3. Building a GMAP/GSNAP index (one chromosome per FASTA entry)
==============================================================================
A GMAP/GSNAP "index" is a set of genomic index files, representing the
genome in a hash table format. You use the gmap_build program to
build your own database from a FASTA file that contains the genome.
The gmap and gsnap programs use the same index.
Below I use the terms "genome" and "chromosome", but the input
sequences can be anything you wish to align to, including transcripts
or small fragments.
A genome can be considered regular or large in size. A regular genome
has a total sequence length of up to 2^32 = 4,294,967,296 (about 4
billion) bp, while a large genome may contain up to 2^40 (about 1
trillion) bp. However, each individual chromosome is still limited to
2^32 bp. The gmap_build program will automatically recognize when a
genome is larger than 2^32 bp and build the index files accordingly.
To handle large genomes, the ./configure and "make install" procedures
produce the programs gmapl and gsnapl. The gmapl and gsnapl programs
work on large genomes, while the gmap and gsnap programs work on
regular genomes. If you try to use the wrong program on a given
database, the programs will notify you of the error and quit.
You will need to start with a set of FASTA files containing either
entire chromosomes or contigs that represent pieces of chromosomes.
For example, for the human genome, you can retrieve all of the FASTA
files under the ftp directory at the URL:
ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.28_GRCh38.p13/GCA_000001405.28_GRCh38.p13_genomic.fna.gz
The Unix wget command makes it easy to retrieve files from the URL
identifier. You can leave the file in compressed gzip format.
Note that the file above will contain not only the reference
chromosomes (1 to 22, plus X, Y, and M), but also unmapped scaffolds
and patches. Also, the chromosomes will be labeled with GenBank
accession numbers, such as "CM000663.2", rather than "chr1". To
convert the chromosome names, and also to limit the chromosomes in
your genome build, you should also obtain
GCA_000001405.28_GRCh38.p13_assembly_report.txt
from the same FTP directory. If you want to restrict your genome
build to the reference chromosomes, you can generate a conversion file
like this:
grep assembled-molecule GCA_000001405.28_GRCh38.p13_assembly_report.txt | cut -f 5,10 > names.txt
If you want to include the unmapped scaffolds, you can do this
grep unplaced-scaffold GCA_000001405.28_GRCh38.p13_assembly_report.txt | cut -f 5,10 >> names.txt
to append those entries to your conversion file.
Alternatively, for certain species, you can obtain your genome
sequence from Gencode at
ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_25/GRCh38.primary_assembly.genome.fa.gz
which will have the chromosomes labeled "chr1" and so on, and also
contain only the primary assembly (reference chromosomes plus unmapped
scaffolds).
Or, you can obtain your chromosome sequence from Ensembl at
ftp://ftp.ensembl.org/pub/release-101/fasta/homo_sapiens/Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz
The Ensembl chromosomes are labeled without the "chr" prefix, so they
are "1", "2", "3", and so on. If you plan on using other data sources
from NCBI, you may want to add the "chr" prefix, by generating a
names.txt file, with lines like this:
1 chr1
2 chr2
where there is a tab character between the two columns.
Finally, you can obtain your genome sequence from UCSC at
ftp://hgdownload.cse.ucsc.edu/goldenPath/hg38/chromosomes/
but you will have to download your chromosomes individually. There is
no need to gunzip them or to concatenate them, though. These chromosomes
do have the "chr" prefix.
If your FASTA entries each contain a single chromosome, and the
accession for each chromosome is the chromosome number/letter, you can
simply run this command
gmap_build -d <genome> [-k <kmer size>] [--names=<file>] [--limit-to-names] <fasta_files...>
which will build and install the GMAP index files in your default
GMAPDB location. If your FASTA files are gzipped, you should add the
flag "--gunzip". If you created a file to convert chromosome names,
you can use the --names flag to perform the conversion. If your
conversion file is also intended to limit the chromosomes in your
genome build (which is the usual case), then you should add the flag
--limit-to-names, or else all chromosomes in the FASTA file will be
added to the build.
For the mitochondrial chromosome, which is circular, you will probably
want to allow for circular alignments by GSNAP and GMAP around the
circular origin of the chromosome. You will need to give gmap_build
the flag "--circular=<mitochondrial chromosome name>". If you
obtained your genome from NCBI, Gencode, or UCSC, this would be
"--circular=chrM". For Ensembl, it would be "--circular=MT". If your
genome has a few circular chromosomes, you can list them in a single
string, separated by commas. If you have many circular chromosomes or
contigs, you provide a file to the --circular flag instead. Note that
if you provide the --names conversion file, you should provide the new
name of the circular chromosome, not the old one. (Note: This
behavior has changed starting with the 2020-10-20 release of this
package. Previously, you specified the old name of the circular
chromosome.)
You can see the full usage of gmap_build by doing "gmap_build --help",
but here are some other useful flags. You can control the k-mer size
for the genomic index with the -k flag, which can range from 12 to 15.
The default value for -k is 15, but this requires your machine to have
4 GB of RAM to build the indices. If you do not have 4 GB of RAM,
then you will need to reduce the value of -k or find another machine.
Here are the RAM requirements for building various indices:
k-mer of 12: 64 MB
k-mer of 13: 256 MB
k-mer of 14: 1 GB
k-mer of 15: 4 GB
Note that the term
<fasta_files...>
above indicates that multiple files can be listed. The files can be
in any order, and the contigs can be in any order within these files.
By default, the gmap_build process will sort the contigs and
chromosomes into their appropriate "chrom" order. For the human
genome, this order is 1, 2, ..., 10, 11, ..., 22, X, Y, M, followed by
all other chromosomes in numeric/alphabetical order. If you don't
want this sort, provide the "-s none" flag to gmap_build. Other sort
options besides "none" and "chrom" are "alpha" and "numeric-alpha".
You can type "gmap_build --help" to see the full set of options. We
discuss some specific situations below.
You can provide information to gmap_build that certain chromosomes are
circular, with the -c or --circular flag. The value for these flags
is a list of chromosomes, separated by commas. The gmap_build program
will then allow . For example, the mitochondrial genome in human beings is
circular.
If your genome files are compressed using gzip, you can simply add the
flag "--gunzip" to gmap_build. But if your genome files require some
other type of processing, you may need to write a small script that
pipes the sequences in FASTA format to gmap_build. You can tell
gmap_build about your script with the -E (or --fasta-pipe) flag, like
this
gmap_build -d <genome> -E 'gunzip -c chr*.gz'
gmap_build -d <genome> -E 'cat *.fa | ./add-chromosomal-info.pl'
You can think of the command as a Unix pipe for processing each FASTA
file before it is read by gmap_build.
4. Running GMAP
================
To see the full set of options, type "gmap --help". The following are
some common examples of usage. For more examples, see the document
available at http://www.gene.com/share/gmap/paper/demo-slides.pdf
For each of the examples below, we assume that you have installed a
genome database called <genome> in your GMAPDB directory. (If your
database is located elsewhere, you can specify the -D flag to gmap or
set the environment variable GMAPDB to point to that directory.)
* Mapping only: To map one or more cDNAs in a FASTA file onto a
genome, run GMAP as follows:
gmap -d <genome> <cdna_file>
* Mapping and alignment: If you want to map the cDNAs to a genome,
and show the full alignment, provide the -A flag:
gmap -d <genome> -A <cdna_file>
* Alignment only: To align one or more cDNAs in a FASTA file onto a
given genomic segment (also in a FASTA file), use the -g flag
instead of the -d flag:
gmap -g <genome_segment> -A <cdna_file>
* Batch mode: If you have a large number of cDNAs to run, and you have
sufficient RAM to run in batch mode, add the "-B 3", "-B 4", or "-B
5" option. Details for these options are provided by running "gmap
--help".
gmap -d <genome> -B 5 -A <cdna_file>
* Multithreaded mode: If your machine has several processors, you can
make batch mode run even faster by specifying multiple threads with
the -t flag:
gmap -d <genome> -B 5 -A -t <nthreads> <cdna_file>
Note that with multiple threads, the output results will appear in
random order, depending on which thread finishes its computation
first. If you wish your output to be in the same order as the
input cDNA file, add the '-O' (letter O, not the number 0) flag
to get ordered output.
Guidelines: The -t flag specifies the number of computational
threads. In addition, if your machine supports threads, GMAP also
uses one thread for reading the input query sequences, and one
thread for printing the output results. Therefore, the total number
of threads will be 2 plus the number you specify. The program will
work optimally if it uses one thread per available processor. If
you specify too many threads, you can cause your computer to thrash
and slow down. Note that other programs running on your computer
also need processors.
* Compressed output: If you want to store the alignment results in a
compressed format, use the -Z flag. You can uncompress the results
by using the gmap_uncompress.pl program:
gmap -d <genome> -Z <cdna_file> > x
cat x | gmap_uncompress
Note that gmap is written for small genomes (less than 2^32 bp in
total length). With large genomes, there is an equivalent program
called gmapl, which you should run instead of gmap. The gmapl program
is equivalent to gmap, and is based on the same source code, but is
compiled to use 64-bit index files instead of 32-bit files. The gmap
and gmapl programs will detect whether the genomes are the correct
size, and will exit if you try to run them on the wrong-sized genomes.
5. Building map files
======================
This package includes an implementation of interval index trees
(IITs), which permits efficient lookup of interval information. The
gmap program also allows you (with its -m flag) to look up pre-mapped
annotation information that overlaps your query cDNA sequence. These
interval index trees (or map files) are built using the iit_store
program included in this package. To build a map file, do the
following:
Step 1: Put your map information for a given genome into a map file
with the following FASTA-like format:
>label coords optional_tag
optional_annotation (which may be zero, one, or multiple lines)
For example, the label may be an EST accession, with the coords
representing its genomic position. Labels may be duplicated if
necessary.
The coords should be of the form
chr:position
chr:startposition..endposition
The term "chr:position" is equivalent to "chr:position..position". If
you want to indicate that the interval is on the minus strand or
reverse direction, then <endposition> may be less than
<startposition>.
Tags are very general and can be used for a variety of purposes. For
example, you could
Step 2: Run iit_store on this map file as follows
cat <mapfile> | iit_store -o <mapname>
The program will create a file called <mapname>.iit.
Now you can retrieve this information with iit_get
iit_get <mapname>.iit <coords>
where <coords> has the format "chr:position" or
"chr:startposition..endposition". The iit_get program has other
capabilities, including the ability to retrieve information by label,
like this:
iit_get <mapname>.iit <label>
More details can be found by running "iit_get --help".
If you plan to use this map information frequently, you may want to
place it with its corresponding genome for future use. In each
GMAP/GSNAP database, there is a subdirectory for storing map files,
like this
/path/to/gmapdb/<genome>/<genome>.maps/
(If you don't remember where your default gmap directory is, run "gmap
--version" to find it.) If you put your <mapname>.iit file into this
maps subdirectory, you can get additional functionality. First, you
can run the program get-genome, which is used mainly for getting
genome sequence, to get map information instead, like this
get-genome -d <genome> -m <mapname> <coords>
Second, you can use GMAP with the -m flag to retrieve map information
that corresponds to a given cDNA sequence like this
gmap -d <genome> -m <mapname> <cdna_file>
Finally, GMAP and the IIT utilities support the GFF3 format. GMAP can
generate its results in GFF3 format, and iit_store can parse GFF3
files using its -G and -l flags. More details about iit_store can be
found by doing "iit_store --help".
6. Running GSNAP
=================
GSNAP uses the same database as GMAP does, so you will need to process
the genome using gmap_build as explained above, if you haven't done
that already. To see the full set of options for GSNAP, type "gsnap --help".
Input to GSNAP should be either in FASTQ or FASTA format. The FASTQ
input may include quality scores, which will then be included in SAM
output, if that output format is selected. For single-end reads, the
FASTQ file may be piped into GSNAP, or given as its command-line
argument, like this
cat <fastq_file> | gsnap -d <genome>
or
gsnap -d <genome> <fastq_file>
For paired-end reads, the two corresponding FASTQ files should be
given as command-line arguments in pairs, like this
gsnap -d <genome> <fastq_file_1> <fastq_file_2> [<fastq_file_3> <fastq_file_4>...]
A pipe cannot work since GSNAP needs to access both FASTQ files in
parallel. The reads in FASTQ files may have varying lengths, if
desired. Note that GSNAP can process multiple sets of paired-end
reads, by adding the files in pairs. If you want to provide multiple
single-end files, you can either use "cat" to concatenate them into
the stdin of gsnap, like this:
cat <fastq_file_1> [<fastq_file_2>...] | gsnap -d <genome>
or you can provide them all on the command line with the
--force-single-end flag, like this:
gsnap -d <genome> --force-single-end <fastq_file_1> [<fastq_file_2>...]
which will process each FASTQ file one at a time as single-end reads,
and not try to pair them up.
GSNAP also has the ability to deal with files compressed with gzip, if
the configure script at compile time can find a zlib library in your
system (see Note 3 in the section above about building and installing
GMAP and GSNAP). If so, and your files are gzipped, you can then read
in gzipped files directly like this
gsnap --gunzip -d <genome> <fastq.gz>, or
gsnap --gunzip -d <genome> --force-single-end <fastq1.gz> [<fastq2.gz>...]
for single-end reads, or
gsnap --gunzip -d <genome> <fastq_1.gz> <fastq_2.gz> [<fastq_3.gz> <fastq_4.gz>...]
for paired-end reads.
Likewise, GSNAP can handle files compressed with bzip2, if the
configure script at compile time can find a bzlib library in your
system (see Note 3 in the section above about building and installing
GMAP and GSNAP). If so, and your files are bzip2-compressed, you can
then read in those files directly like this
gsnap --bunzip2 -d <genome> <fastq.bz2>, or
gsnap --bunzip2 -d <genome> --force-single-end <fastq1.bz2> [<fastq2.bz2>...]
for single-end reads, or
gsnap --bunzip2 -d <genome> <fastq_1.bz2> <fastq_2.bz2> [<fastq_1.bz2> <fastq_2.bz2>...]
for paired-end reads.
For FASTA format, you should include one line per read (or end of a
paired-end read). The same FASTA file can have a mixture of
single-end and paired-end reads of varying lengths, if desired.
Single-end reads:
Each FASTA entry should contain one short read per line, like this
>Header information
AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA
Each short read can have a different length. However, the entire read
needs to be on a single line, and may not wrap around multiple lines.
If it extends to a second line, GSNAP will think that the read is
paired-end.
Paired-end reads:
Each FASTA entry should contain two short reads, one per line, like
this
>Header information
AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA
GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG
By default, the program assumes that the second end is in the reverse
complement direction compared with the first end. If they are in the
same direction, you may need to use the --circular-input (or -c) flag.
GSNAP and GMAP can also read an extended FASTA format that include
quality scores, which look like this
>Header information
AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA
+
<quality scores>
for single-end reads, or
<Header information
AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA
+
<quality scores>
for the second-end of a paired-end read. In addition, GSNAP can read
an extended FASTA format for paired-end reads, like this:
>Header information
AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA
GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG
+
<quality scores 1>
<quality scores 2>
This extended FASTA format is useful if paired-end information needs
to be piped into GSNAP via stdin.
As with gmap, gsnap is written for small genomes (less than 2^32 bp in
total length). With large genomes, there is an equivalent program
called gsnapl, which you should run instead of gsnap. The gsnapl
program is equivalent to gmap, and is based on the same source code,
but is compiled to use 64-bit index files instead of 32-bit files.
The gsnap and gsnapl programs will detect whether the genomes are the
correct size, and will exit if you try to run them on the wrong-sized
genomes.
7. Detecting known and novel splice sites in GSNAP
====================================================
Whereas GMAP assumes RNA-seq input by default, GSNAP assumes DNA-seq
input by default. To tell GSNAP to find splice junctions in
individual reads, you need to provide either the "--novelsplicing=1"
(or "-N 1") flag and/or the "-s <splicing_file>" flag to GSNAP.
GSNAP can detect splices using a probabilistic model using the
--novelsplicing (or -N) flag. You can also detect splices from a set
of splice sites that you provide, using the --splicesites (or -s)
flag. You may specify both flags, which will report splice junctions
involving both known and novel sites.
Output for a splicing junction will look like this:
>TCCGTGACGTGGATTGGTGCTGCACCCCTCATC 1 Header
TCCGTGACGTGGATTGgt--------------- 1..16 +19:56050054..56050069 start:0..donor:0.99,splice_dist:1238,dir:sense,sub:0+0=0,label:NM_001648.KLK3.exon1/5|NM_001030047.KLK3.exon1/5|NM_001030048.KLK3.exon1/5|NM_001030049.KLK3.exon1/6|NM_001030050.KLK3.exon1/2
,--------------agGTGCTGCACCCCTCATC 17..33 +19:56051308..56051324 acceptor:0.99..end:0,dir:sense,sub:0+0=0,label:NM_001648.KLK3.exon2/5|NM_001030047.KLK3.exon2/5|NM_001030048.KLK3.exon2/5|NM_001030049.KLK3.exon2/6|NM_001030050.KLK3.exon2/2
After the "donor:" or "acceptor:" splice site type, the model score
probability is given, even if the splice site is known. For known
splice sites, the "label:" field will provide information about the
site. If there is more than one known splice site at a genomic
position, the labels are separated by a "|" delimiter.
There are several advantages to specifying a database of known splice
sites. First, GSNAP will then be able to detect splicing involving
atypical splice sites, that would otherwise give low scores using its
probabilistic model. A known splice site is treated as if its model
probability is 1.0. Second, GSNAP can find splicing involving short
exons. Such cases have a single end aligning to three exons,
separated by two introns. Third, GSNAP can identify splicing at the
ends of reads with greater sensitivity, even if they have short
overlaps onto the next exon. Fourth, GSNAP can detect known long
splices, because expected splice lengths can be included with the
splice site information.
GSNAP allows for known splicing at two levels: at the level of known
splice sites and at the level of known introns. At the site level,
GSNAP finds splicing between arbitrary combinations of donor and
acceptor splice sites, meaning that it can find alternative splicing
events. At the intron level, GSNAP finds splicing only between the
set of given donor-acceptor pairs, so it is constrained not to find
alternative splicing events, only introns included in the given list.
For most purposes, I would recommend using known splice sites, rather
than known introns, unless you are certain that all alternative
splicing events are known are represented in your file.
GSNAP can tell the difference between known site-level and known
intron-level splicing based on the format of the input file. To
perform known site-level splicing, you will need to create a file with
the following format:
>NM_004448.ERBB2.exon1 17:35110090..35110091 donor 6678
>NM_004448.ERBB2.exon2 17:35116768..35116769 acceptor 6678
>NM_004448.ERBB2.exon2 17:35116920..35116921 donor 1179
>NM_004448.ERBB2.exon3 17:35118099..35118100 acceptor 1179
>NM_004449.ERG.exon1 21:38955452..38955451 donor 783
>NM_004449.ERG.exon2 21:38878740..38878739 acceptor 783
>NM_004449.ERG.exon2 21:38878638..38878637 donor 360
>NM_004449.ERG.exon3 21:38869542..38869541 acceptor 360
Each line must start with a ">" character, then be followed by an
identifier, which may have duplicates and can have any format, with
the gene name or exon number shown here only as a suggestion. Then
there should be the chromosomal coordinates which straddle the
exon-intron boundary, so one coordinate is on the exon and one is on
the intron. (Coordinates are all 1-based, so the first character of a
chromosome is number 1.) Finally, there should be the splice type:
"donor" or "acceptor". You may optionally store the intron distance
at the end. GSNAP can use this intron distance, if it is longer than
its value for --localsplicedist, to look for long introns at that
splice site. The same splice site may have different intron distances
in the database; GSNAP will use the longest intron distance reported
in searching for long introns.
Note that the chromosomal coordinates are in the sense direction.
Therefore, genes on the plus strand of the genome (like NM_004448) have
the coordinates in ascending order (e.g., 35110090..35110091).
Genes on the minus strand of the genome (like NM_004449) have the
coordinates in descending order (e.g., 38955452..38955451).
On the other hand, to perform known intron-level splicing, you will need
to create a file with the following format:
>NM_004448.ERBB2.intron1 17:35110090..35116769
>NM_004448.ERBB2.intron2 17:35116920..35118100
>NM_004449.ERG.intron1 21:38955452..38878739
>NM_004449.ERG.intron2 21:38878638..38869541
Again, coordinates are 1-based, and specify the exon coordinates
surrounding the intron, with the first coordinate being from the donor
exon and the second one being from the acceptor exon.
There are several ways to help you generate these files. First, if
you have a GTF file, you can use the included programs gtf_splicesites
and gtf_introns like this:
cat <gtf file> | gtf_splicesites > foo.splicesites
cat <gtf file> | gtf_introns > foo.introns
Second, if you retrieve an alignment tracks from UCSC, like this:
ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/refGene.txt.gz
if you are aligning to genome hg18, or
ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/refGene.txt.gz
if you are aligning to genome hg19, you can process this track using
the included program psl_splicesites or psl_introns, like this:
gunzip -c refGene.txt.gz | psl_splicesites -s 1 > foo.splicesites
gunzip -c refGene.txt.gz | psl_introns -s 1 > foo.introns
Note that alignment tracks in UCSC sometimes have an extra column on
the left. The "-s" flag allows you to indicate how many columns
should be skipped.
Once you have built this splicesites or introns file, you process it
as a map file (see "Building map files" above), by doing
cat foo.splicesites | iit_store -o <splicesitesfile>, or
cat foo.introns | iit_store -o <intronsfile>
If you want to include more than one track, you can do this:
gunzip -c refGene.txt.gz | psl_splicesites -s 1 > foo
gunzip -c knownGene.txt.gz | psl_splicesites > bar
cat foo bar | iit_store -o <splicesitesfile>
A third way to build a known splicesites or known introns file is
useful if you have cDNA sequences rather than an alignment track, or
if you do not trust the alignment track and prefer to use cDNA
sequences. GMAP has an option "-f splicesites" that finds splice
sites in cDNA sequences and reports them in the correct splicesite
format. Likewise, GMAP can build an intron file, with the option "-f
introns".
When processing known cDNA sequences, you should also run GMAP with
the "-n 1" flag, so you get the best alignment, and with the "-z
sense_force" or "-z sense_filter" flag. The sense_force option will
help GMAP know that the introns in your cDNA sequences are in the
correct GT-AG sense, and is applicable when you have a high quality
set of cDNA sequences. The sense_filter option will allow GMAP to try
either sense or antisense, and to filter out sequences that appear to
be antisense; this is applicable if you are uncertain about the
validity of your cDNA sequences.
Again once you have built either a known splicesites or known introns
file, you process it as a map file by doing
cat <file> | iit_store -o <splicesitesfile>, or
cat <file> | iit_store -o <intronsfile>
which creates <splicesitesfile>.iit or <intronsfile>.iit.
Regardless of how you built <splicesitesfile>.iit or <intronsfile>.iit,
you put it in the maps subdirectory by doing
cp <splicesitesfile>.iit /path/to/gmapdb/<genome>/<genome>.maps, or
cp <intronsfile>.iit /path/to/gmapdb/<genome>/<genome>.maps
Then, you may use the file by doing this:
gsnap -d <genome> -s <splicesitesfile> <shortreads>, or
gsnap -d <genome> -s <intronsfile> <shortreads>, or
8. SAM output format
=====================
GSNAP can generate SAM output format, by providing the "-A sam" flag
to GSNAP. In addition, GMAP can also print its alignments in SAM
output, using the "-f samse" or "-f sampe" options, for single-end or
paired-end data. The sampe option will generate SAM flags to indicate
whether the read is the first or second end of a pair, which requires
that you provide GMAP with an extended FASTA format having a ">" or
"<" character in the header to indicate that information. However,
the sampe option will change only the SAM flags, and not change the
underlying alignment algorithm. GMAP does not know how to find
concordance between paired-end reads like GSNAP does.
GSNAP provides some special SAM flags as follows:
XQ: A non-normalized mapping quality score
X2: The second best XQ score among all multimapping alignments for a
given read. If there is only a single alignment, this value is 0.
XO: Output type. GSNAP categorizes its alignments into output types,
as follows. Note that the --split-output option will create separate
output files for each output type. Alternatively, if you use
sam_sort, you should provide --split-output to that program instead
and achieve the same functionality. (The reason for this is that
there may be situations where GSNAP assigns different output types to
the first and second ends of the reads and sam_sort needs to see
alignments from both ends together.) In either case, the output types
have the following meanings and filename suffixes:
NM (nomapping) (filename suffix ".nomapping"): The entire read
(single-end or paired-end) could not be aligned. If the
--failed-input=FILENAME flag is specified, then these reads are also
printed in FASTQ or FASTA format (depending on the input format) in
the given file (plus a .1 or .2 ending for the first and second ends
of a paired-end read).
CU (concordant unique) (filename suffix ".concordant_uniq"): Both
ends of a paired-end read could be aligned concordantly to a single
position in the genome. For a definition of concordance, see the
section "Output types" below.
CM (concordant multiple) (filename suffix ".concordant_mult"): Both
ends of a paired-end read could be aligned concordantly, but to more
than one position in the genome.
CX (concordant multiple excess) (filename suffix
".concordant_mult_xs"): Multiple concordant alignments, but user
specified --quiet-if-excessive and the number of alignments exceeds
"-n" threshold. If the --failed-input option is given, these reads
are also printed in FASTA or FASTQ format in the given file.
CT (concordant translocation) (filename suffix
".concordant_transloc"): Both ends of a paired-end read could be
aligned concordantly, but one end requires a split alignment to a
distant location, such as another chromosome, or a different strand
on that chromosome, or a far distance on that strand. Note that
translocation alignments need to be printed on two separate SAM
lines.
CC (concordant circular) (filename suffix ".concordant_circular"):
Both ends of a paired-end read could be aligned concordantly, but
one or both ends require an alignment that goes around the origin of
a circular chromosome. Circular chromosomes are specified in the
gmap_build step by using the -c or --circular flag, as described
previously. Note that circular alignments need to be printed on two
separate SAM lines.
PI (paired unique inversion) (filename suffix ".paired_uniq_inv"):
Both ends of a paired-end read could be aligned uniquely, but in a
way that indicates that a genomic inversion has occurred between the
two ends.
PS (paired unique scramble) (filename suffix ".paired_uniq_scr"):
Both ends of a paired-end read could be aligned uniquely, but in a
way that indicates that the genomic order is scrambled. This
typically occurs because of tandem duplications.
PL (paired unique long) (filename suffix ".paired_uniq_long"): Both
ends of a paired-end read could be aligned uniquely, but in a way
that indicates that a large genomic deletion has occurred between
the two ends.
PC (paired unique circular) (filename suffix
".paired_uniq_circular"): Both ends of a paired-end read could be
aligned uniquely, but not concordantly, representing an inversion,
scramble, or deletion. In addition, one or both ends of the read
goes around the origin of a circular chromosome.
PM (paired multiple) (filename suffix ".paired_mult"): Both
ends of a paired-end read could be aligned near each other,
representing an inversion, scramble, or deletion, but there are
multiple places in the genome where an alignment is found.
PX (paired multiple excess) (filename suffix ".paired_mult_xs"):
Multiple paired alignments, but user specified --quiet-if-excessive
and the number of alignments exceeds the "-n" threshold. If the
--failed-input option is given, these reads are also printed in
FASTA or FASTQ format in the given file.
HU, HM, HT, HC (halfmapping unique, halfmapping multiple,
halfmapping translocation, and halfmapping circular, respectively)
(filename suffixes: ".halfmapping_uniq", ".halfmapping_mult",
".halfmapping_transloc", ".halfmapping_circular): Same as for the
concordant output types, except that only one end of the paired-end
read could be aligned, and the other end could not be aligned
anywhere in the genome.
HX (halfmapping multiple excess) (filename suffix
".halfmapping_mult_xs"): Multiple halfmapping alignments, but user
specified --quiet-if-excessive and the number of alignments exceeds
the "-n" threshold. If the --failed-input option is given, these
reads are also printed in FASTA or FASTQ format in the given file.
UU, UM, UT, UC (unpaired unique, unpaired multiple, unpaired
translocation, and unpaired circular, respectively) (filename
suffixes: ".unpaired_uniq", ".unpaired_mult", ".unpaired_transloc",
".unpaired_circular): Same as for the concordant output types,
except that the two ends could not be aligned concordantly or even
paired. These "unpaired" categories are also used for single-end
reads, since they lack a mate end that can allow for concordance,
pairing, or halfmapping.
UX (unpaired multiple excess) (filename suffix ".unpaired_mult_xs"):
Multiple unpaired alignments, but user specified
--quiet-if-excessive and the number of alignments on one end exceeds
the "-n" threshold. If the --failed-input option is given, these
reads are also printed in FASTA or FASTQ format in the given file.
XB: Prints the barcode extracted from the end of the read. Applies only
if --barcode-length is not 0.
XP: Prints the primer inferred from a paired-end read. Applies only
if the --adapter-strip flag is specified.
XH: Prints the part of the query sequence that was hard-clipped.
Sequence is printed in plus-genomic order and replaces the "H" part of
the CIGAR string.
XI: Prints the part of the quality string that was hard-clipped.
Sequence is printed in plus-genomic order and replaces the "H" part of
the CIGAR string.
XS: Prints the strand orientation (+ or -) for a splice. Appears only
if splicing is allowed (-N or -s flag provided), and only for reads
containing a splice. The value "+" means the expected GT-AG, GC-AG,
or AT-AC dinucleotide pair is on the plus strand of the genome, and
"-" means the dinucleotides are on the minus strand. If the
orientation is not obvious, because the dinucleotides do not match
GT-AG, GC-AG, AT-AC, or their complements, then the program applies a
probabilistic splice model to determine the orientation. If the
splice sites have low probability, then the program may not be able to
determine an orientation, and the result will be printed as XS:A:?.
To prevent this flag, which cannot be handled by such programs (such
as Cufflinks), use the --force-xs-dir flag. However, this flag will
merely change occurrences of XS:A:? arbitrarily to XS:A:+.
XA: Indicates an ambiguous splice. If GSNAP finds two or more
possible splices at a given position, it will try to resolve the
ambiguity if possible based on the other end of the paired-end read.
If the ambiguity cannot be resolved, GSNAP will not report any of the
splices, but will report a soft clip instead. The XA field indicates
which end or ends are ambiguous and the number of matches found on
each ambiguous end, based on the output XA:Z:i,j. If i or j is
greater than 0, that indicates that the lower or higher chromosomal
end is ambiguous, respectively. The value given indicates the number
of matches found in the ambiguous end. This number may be smaller
than the number of bases soft-clipped, due to mismatches.
XC: Indicates whether the alignment crosses over the origin of a
circular chromosome. If so, the string XC:A:+ is printed.
XT: Prints the intron dinucleotides and splice probabilities around a
distant splicing event (genomic deletion, inversion, scramble, or
translocation).
XW and XV: Printed only when SNP-tolerant alignment is enabled. XW
provides the number of mismatches against both the reference and
alternate alleles (or the "World" population). Therefore, these are
true mismatches. XV provides the number of positions that are
mismatches against the reference genome, but do match the alternate
genome. Therefore, these are known variant positions. The sum of XW
and XV provides the number of differences relative to the reference
genome, and with the exception of indels, should equal the value of
NM.
XG: Indicates which method within GSNAP generated the alignment. B:
GMAP alignment produced from suffix array, M: GMAP alignment produced
from GSNAP hash table method, T: terminal alignment, O: merging of
overlaps. Absence of XG flag indicates the standard GSNAP hash table
method. (Note: older versions of GSNAP used "PG:", but some
downstream software required all PG methods to be listed in the header
section, so we changed the field name to "XG:")
9. GSNAP output format
========================
By default, GSNAP prints its output in a FASTA-like format, which we
developed before we incorporated the SAM format. The default GSNAP
output has some advantages over SAM output, especially for debugging
purposes. However, we routinely use SAM output for our own pipeline,
and it has been subject to the most testing by ourselves and by outside
users.
Here is some output from GSNAP on a paired-end read:
>GGACTGCGCACCGAACGGCAGCGACTTCCCGTAGTAGCGGTGCTCCGCGAAGACCAGTAGAGCCCCCCGCTCGGCC 1 concordant ILLUMINA-A1CCE9_0004:1:1:1510:2090#0
GGACTGCGCACCGAACGGCAGCGACTTCCCGTAGTAGCGct----------------------------------- 1..39 +9:139128263..139128301 start:0..acceptor:0.99,dir:antisense,splice_dist:214,sub:0+0=0,label:NM_013379.DPP7.exon4/13 segs:2,align_score:2 pair_score:5,pair_length:112
,-------------------------------------acGTGCTCCGCGAAGACCAGTAGAGCCCCCCGCTCGGCC 40..76 +9:139128516..139128552 donor:0.96..end:0,dir:antisense,splice_dist:214,sub:0+0=0,label:NM_013379.DPP7.exon3/13
<CTTCGCCAACAACTCGGGCTTCGTCGCGGAGCTGGCGGCCGAGCGGGGGGCTCTACTGGTCTTCGCGGAGCACCGC 1 concordant ILLUMINA-A1CCE9_0004:1:1:1510:2090#0
CTTCGCCAACAACTCGGcCTTCGTCGCGGAGCTGGCGGCCGAGCGGGGGGCTCTACTGGTCTTCGCGGAGCACgtg 1..73 -9:139128588..139128516 start:0..end:3,sub:3+1=4 segs:1,align_score:3 pair_score:5,pair_length:112
Each end of a read gets its own block, with the first read starting
with ">" and the second read for paired-end reads starting with "<".
The block starts with a header line that has in column 1, the query
sequence in its original direction (and with lower-case preserved if
any); in column 2, the number of hits for that query and if the read
is paired-end, the relationship between the ends (as discussed in the
next paragraph); and in column 3, the accession number for the query.
10. Output types
=================
The two ends of a paired-end read can have the following
relationships: "concordant", "paired", or "unpaired". A paired-end
read is concordant if the ends align to the same chromosome, in the
expected relative orientations, and having an inferred insert length
greater than zero and within the "--pairmax" parameter. The inferred
insert length is the distance from the end of the first-end alignment
to the start of the second-end alignment, plus the read lengths of the
two ends. There may be more than one concordant alignment for a given
read, and if so, the alignments for each end are reported in
corresponding order.
If a concordant relationship cannot be found, then the program will
report any paired relationships it can find. A paired alignment
occurs when the two ends align to the same chromosome, but fail some
criterion for concordance. There are different subtypes of paired
alignments, depending on which criterion is violated. If the
orientations are opposite what is expected, the paired subtype is
"inversion". If they are in the expected orientation, but the
distance is greater than the "--pairmax" parameter, then the paired
subtype is "toolong". If they are in the expected orientation, but
the inferred insert length appears to be negative, then the paired
subtype is "scramble". In GSNAP output, a paired subtype is shown in
a label called "pairtype", which can have the values
"pairtype:inversion", "pairtype:toolong", and "pairtype:scramble".
Otherwise, if neither a concordant nor paired alignment can be found,
then the program will align each end separately, and report the
relationship as being "unpaired".
GSNAP can find translocation splices within a single end of a read,
but it tries to be conservative about reporting them. If there is any
alignment that does not involve such a translocation, then it will not
report the translocation. It therefore reports translocation splices
only when no other alignment is found within the concordant, paired,
or unpaired categories. Therefore, such results are listed in the
header as having "(transloc)" appear after the "concordant", "paired",
or "unpaired" result type.
After the query line, each of the genomic hits is shown, up to the
'-n' parameter. If too many hits were found (more than the '-n'
parameter), the behavior depends on whether the "--quiet-if-excessive"
flag is given to GSNAP. If not, then the first n hits will be printed
and the rest will not be printed. If the "--quiet-if-excessive" flag
is given to GSNAP, then no hits will be printed if the number exceeds
n.
Each of the genomic hits contains one or more alignment segments,
which is a region of continuous one-to-one correspondence (matches or
mismatches) between the query and the genome. Multiple segments occur
when the alignment contains an insertion, deletion, or splice. The
first segment is marked by a space (" ") at the beginning of the line,
while the second and following segments are marked by a comma (",") at
the beginning of the line. (In the current implementation of GSNAP
that allows only a single indel or splice, the number of segments is
at most two.)
The segments contain information in tab-delimited columns as follows:
Column 1: Genomic sequence with matches in capital letters, mismatches
in lower-case letters, and regions outside the segment with dashes.
For deletions in the query, the deleted genomic sequence is also
included in lower case. For spliced reads, the two dinucleotides at
the intron ends are included in lower case.
Column 2: Range of query sequence aligned in the segment. Coordinates
are inclusive, with the first nucleotide considered to be position 1.
Column 3: Range of genomic segment aligned, again with inclusive
coordinates, with the first nucleotide in each chromosome considered
to be position 1. Plus and minus strands are marked with a "+" or "-"
sign.
Column 4: Segment information, delimited by commas. The first item
reports on the ends of the segment, which can be of type "start",
"end", "ins", "del", "donor", "acceptor", or "term". After "start"
and "end", we report the number of nucleotides clipped or trimmed from
the segment. In our example above, "end:3" means that 3 nucleotides
should be trimmed from the end. Trimming finds a local maximum of
matches to mismatches from the end and is computed only if the "-T"
flag is specified, and the value for "-T" limits the amount of
trimming allowed. After "ins" and "del", we report the number of
nucleotides that were inserted or deleted in the query relative to the
genome. After "donor" or "acceptor", we report the probability of the
splice site, based on the MaxEnt model. The "term" label indicate a
terminal segment, where the entire read could not be aligned, but more
than half of the read could be aligned from either end.
Each segment will also show after the "sub" tag, he number of
mismatches in that segment including the part that is trimmed, if any.
If SNP-tolerant alignment is chosen, then the number of SNPs is also
shown (see details below under SNP-tolerant alignment). Other
information may also be included with the segment information, such as
the orientation and distance of the splice or known splice labels, if
appropriate flags and information are given to GSNAP. Splices are
marked with a splice_type, which can be "consistent", "inversion",
"scramble", or "translocation". A "translocation" splice includes
splices on the same chromosome where the splice distance exceeds the
parameter for localsplicedist.
Column 5: Alignment or hit information, delimited by commas. For the
first segment in a hit (the one starting with a space), this column
provides the number of segments (denoted by "segs:") and the score of
the alignment (denoted by "align_score:").
Column 6: Pair information (for paired-end reads only). For the first
segment in a hit (with the same information repeated on both ends of a
concordant pair), this column provides the score of the pair (which is
the sum of the alignment scores) and the inferred length of the insert
(ignoring splices within each segment, but not between segments).
11. SNP-tolerant alignment in GSNAP
====================================
GSNAP has the ability to align to a reference space of all possible
major and minor alleles in a set of known SNPs provided by the user.
This ability is provided by the -v flag, and produces output like
this:
>ATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGA 2 Header
ATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGt 1..36 -12:34263937..34263902 start:0..end:0,sub:1+0=1
ATGGTAATCCTGCTCAGTAGGAGAGGAACCCCAGGt 1..36 -21:14379300..14379265 start:0..end:0,sub:1+2=3
The notation "sub:1+0=1" indicates that the SNP-tolerant alignment has
one mismatch ("sub:1") and zero minor SNP alleles ("+0"), for a total
of one differences ("=1") relative to the reference genome with all
major alleles. Likewise, the notation "sub:1+2=3" indicates one
SNP-tolerant mismatch, two minor SNP alleles, and 3 mismatches
relative to the reference sequence with all major alleles.
Note that by default, GSNAP shows only differences relative to both
the reference and alternate genomes in lower case. If you want to
show differences relative to the reference genome in lower case, you
will need to provide the flag --show-refdiff, which would give the
output above as:
>ATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGA 2 Header
ATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGt 1..36 -12:34263937..34263902 start:0..end:0,sub:1+0=1
ATGGTAATCCTGCTCAGTAgGAGAGGAACCcCAGGt 1..36 -21:14379300..14379265 start:0..end:0,sub:1+2=3
For SAM output format, all differences from the reference sequence are
shown in the NM and MD fields, although the alignment scoring and
mapping qualities are based on a SNP-tolerant alignment.
Before deciding to use SNP-tolerant alignment, please note the
following. First, SNP-tolerant alignment requires more memory than
standard alignment, perhaps twice as much. Also, with longer reads
now of 75 or more bp, GSNAP alignments are generally fine without
SNP-tolerant alignment. Finally, if your SNPs are incorrect (and many
in the databases are), then they can lead SNP-tolerant alignment to
favor the faulty SNPs.
If you still wish to use SNP-tolerant alignment, you will need to
specify a set of known SNPs by creating a file with the following
format:
>rs62211261 21:14379270 CG
>rs62211262 21:14379281 CG
Each line must start with a ">" character, then be followed by an
identifier (which may have duplicates). Then there should be the
chromosomal coordinate of the SNP. (Coordinates are all 1-based, so
the first character of a chromosome is number 1.) Finally, there
should be the two possible alleles. (Previous versions required that
these be in alphabetical order: "AC", "AG", "AT", "CG", "CT", or "GT",
but that is no longer a requirement.) These alleles must correspond
to the possible nucleotides on the plus strand of the genome. If the
one of these two letters does not match the allele in the reference
sequence, that SNP will be ignored in subsequent processing as a
probable error.
GSNAP also supports the idea of a wildcard SNP. A wildcard SNP allows
all nucleotides to match at that position, not just a given reference
and alternate allele. It is essentially as if an "N" were recorded at
that genomic location, although the index files still keep track of
the reference allele. To indicate that a position has a wildcard SNP,
you can indicate the genotype as "WN", where "W" is the reference
allele. Another indication of a wildcard SNP is to provide two
separate lines at that position with the genotypes "WX" and "WY",
where "W" is the reference allele and "X" and "Y" are two different
alternate alleles.
To help you generate the file, this package includes programs that can
process known SNP data, from various formats, including dbSNP files,
VCF format, or GVF format. One issue is that SNP databases now
contain many more variants than the common set of SNPs in the human
population. The SNP-tolerance feature in GSNAP is not intended to
handle density packed variants, but rather more widely spaced
variants. Therefore, it is important to limit the known SNPs to ones
that are common in the human population.
You can obtain dbSNP files from UCSC, like this
ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/snp151Common.txt.gz
Note that there is a file called snp151.txt.gz, but this has far too
many SNPs to be useful, and possibly too densely packed to be handled
easily by the SNP tolerance feature of GSNAP. You can process UCSC
files using our program dbsnp_iit, like this:
gunzip -c snp151Common.txt.gz | dbsnp_iit [-w <weight>] > <snpfile>.txt, or
The option "-w <weight>" makes use of the dbSNP item weight, a value
from 1 to 3, where lower weight means higher confidence. Items will
be included if the item weight is the given value <weight> or less.
The default value of -w is 1, which is the criterion UCSC uses to
build its ambiguous version of the genome. To allow all item weights,
specify "-w 3".
SNPs have various types of exceptions. Starting with snp132, these
exceptions are included in the snp file itself. By default, dbsnp_iit
will exclude all types of exceptions. However, if you want to include
some types of exceptions, you will need to modify the dbsnp_iit
program (written in Perl) to indicate a "1" for the type of exception
you want to include.
An alternative source for SNP data is from Ensembl, such as
ftp://ftp.ensembl.org/pub/release-101/variation/gvf/homo_sapiens/homo_sapiens-chr*.gvf.gz
which can be handled by the gvf_iit program in this package. However,
there appear to be too many variants to be useful for the
SNP-tolerance feature of GSNAP. If someone knows how to limit the
SNPs from an Ensembl source, please let me know.
Another source of dbSNP in 2020 is located at:
ftp://ftp.ncbi.nih.gov/snp/redesign/latest_release/VCF/GCF_000001405.38.gz (for GRCh38)
ftp://ftp.ncbi.nih.gov/snp/redesign/latest_release/VCF/GCF_000001405.25.gz (for GRCh37)
and can also be processed with the vcf_iit program, like this:
gunzip -c <file> | vcf_iit -C [-v <version>] [-n <conversion file>] > <snpfile>.txt
The -C flag indicates that only those snp variants labeled as "COMMON"
will be used, which is important as explained previously. Although
this version of dbSNP is 154, it contains multiple historical versions
of dbSNP, so if you want a particular version, such as 150, you would
use the flag "-v 150". The VCF file from NCBI is labeled with Refseq
accession numbers like "NC_000001.11" instead of "chr1". To make the
appropriate name conversion, you should create another conversion file
from the NCBI accession_report.txt file, like this:
grep -v "^#" GCA_000001405.28_GRCh38.p13_assembly_report.txt | cut -f 7,10 >> refseq-to-chr.txt
and then provide the flag "-n refseq-to-chr.txt" to vcf_iit.
Once you have built a <snpfile>.txt file using dbsnp_iit, gvf_iit, or
vcf_iit, you create an IIT file by doing this
cat <snpfile>.txt | iit_store -o <snpfile>
which creates <snpfile>.iit. If you wish to store this file for other
people to use, you can then put it in a central place:
cp <snpfile>.iit /path/to/gmapdb/<genome>/<genome>.maps
Or you can keep it in your own directory for your own use. Then you
need to create a reference space index and compressed genome by doing
snpindex -d <genome> [-V <snpdirectory>] -v <snpfile> <snpfile>.iit
If you specify the [-V <snpdirectory>] option, then the resulting SNP
index files are placed in the given directory. Otherwise, if you
don't specify this, then the SNP files are saved with the reference
index files.
If your <snpfile>.iit file is already in a <genome>.maps subdirectory,
then you can simply run
snpindex -d <genome> [-V <snpdirectory>] -v <snpfile>
and the program will find the indicated <snpfile>.iit file.
Additional options for snpindex can be found by doing "snpindex
--help".
Finally, you can perform SNP-tolerant alignment by doing
gsnap -d <genome> [-V <snpdirectory>] -v <snpfile> <shortreads>
You can also retrieve snp information for genomic segments by running
get-genome with the -v and -f flags. For more details, run
"get-genome --help".
12. Alignment of reads from bisulfite-treated DNA in GSNAP
===========================================================
GSNAP has the ability to align reads from bisulfite-treated DNA, which
converts unmethylated cytosines to uracils that appear as thymines in
reads. GSNAP is able to identify genomic-T to read-C mismatches, and
produces output like this:
>CTACGTcGTAGACATATTGATTCAGAATTTGAAGTTTAGCTAGATCTTAc 1 Read
C.ACG.tGTAGACATA.TGATTCAGAAT.TGAAGTTTAGCTAGA.C.TAg 1..50 sub:2 +9:1000000..1000049
As with all GSNAP output, the first line is the query, and the ones
afterward represent genomic segments. The "." symbol indicates an
unmethylated C in the genome that appears as a T in the read.
Mismatches are shown by lower case characters in the genomic segment.
In position 6, we see an example of a genomic-T that appears as a
read-C, representing a mismatch. The last position also shows a
mismatch between a genomic-G and read-C.
To process reads from bisulfite-treated DNA, you will first need to
create the necessary index files by doing
cmetindex -d <genome>
Then, you can align the reads by doing
gsnap -d <genome> --mode=cmet-stranded, or
gsnap -d <genome> --mode=cmet-nonstranded
on your set of short reads. The stranded flag works on data where
the laboratory allows only reads that go from 5' to 3' on each strand
of the genome, and excludes their reverse complement reads that would
be produced by PCR amplification. The resulting reads should have a
preponderance of C's converted to T's.
The non-stranded flag is for the laboratory protocol that allows both
the 5'-to-3' genomic reads on each strand, as well as their reverse
complements. The reverse complemented reads will have the C-to-T
conversion show up as a G-to-A change. The resulting reads should
have a preponderance of T's in half the reads, and a preponderance of
A's in half the reads.
13. RNA-editing tolerance in GSNAP
===================================
Just as GSNAP has a program cmetindex and a mode called "cmet" for
tolerance to C-to-T changes, it can be tolerant to A-to-G changes
using the program atoiindex and a mode called "atoi". This mode is
designed to facilitate alignments that are tolerant to RNA editing
where A's are converted to I's, which appear as G's to a sequencer.
To process reads under RNA-editing tolerance, you will first need to
create the necessary index files by doing
atoiindex -d <genome>
Then, you can align the reads by doing
gsnap -d <genome> --mode=atoi-stranded, or
gsnap -d <genome> --mode=atoi-nonstranded
on your set of short reads. As with bisulfite sequencing, the
stranded flag is for laboratory protocols that allow only the 5'-to-3'
RNA, or sense, reads, and the non-stranded flag is for laboratory
protocols that allow both sense and antisense reads.
14. Transcriptome-guided genomic alignment
===========================================
Transcriptome-guided genomic alignment (TGGA) is a feature in GSNAP
that utilizes both a genome and a transcriptome. In this alignment
mode, GSNAP aligns reads first against the set of transcripts. This
alignment is generally gap-free, since splicing is not an issue.
Indels can still be present, but GSNAP knows how to identify them in
transcripts. The advantage of aligning against a transcript is that
GSNAP can find seeds anywhere in the transcript, even if they span an
exon-exon junction. In contrast, with standard genomic alignment, if
the end of a read is near a splice junction, there may not be enough
nucleotides on the distal end of the splice to find a seed.
Therefore, in such cases, GSNAP would have soft-clip the end of the
alignment.
In TGGA, GSNAP converts alignments to transcripts to alignments in the
genome, using information about how the entire transcript maps to the
genome. The ends of reads can be aligned more accurately, even if
only one or two nucleotides are on the distal end of a splice. In
addition, gap-free alignment to transcripts is fast, so TGGA is many
times faster than regular genomic alignment. A final advantage of
TGGA is that GSNAP reports the transcripts that are consistent with
the read, which can be useful for downstream analyses that measure
gene expression by transcript. Therefore, TGGA serves a function
similar to that of alignment-free RNA-seq tools like Kallisto or
Salmon, but also provides the genomic alignment needed for the
analysis of splicing, mutations, and polymorphisms.
To perform TGGA, in addition to the genome in FASTA format (suppose it
is called genome.fasta), you will need either a set of transcripts in
FASTA format (transcripts.fasta) or a set of transcript mappings to
the genome (transcripts.map). The map format can be obtained from a
GFF3 or GTF file using the programs gff3_genes or gtf_genes included
with this software package, as follows:
gff3_genes <gff3_file> > transcripts.map
gtf_genes <gtf_file> > transcripts.map
The map file can also be generated by aligning the transcript FASTA
format against the genome using "gmap -f map_exons", but if you are
starting with a FASTA file, it is easier to let gmap_build perform
this process for you.
To build the genome and transcriptome index files, there are two
cases:
Case 1: The genome index has not yet been built. In this case, you
can build both the genome and transcriptome indices with one command,
either
gmap_build [-D <directory>] -d <genome_name> -c <transcriptome_name> -T transcripts.fasta genome.fasta, or
gmap_build [-D <directory>] -d <genome_name> -c <transcriptome_name> -G transcripts.map genome.fasta
depending on whether you have a FASTA or map file.
Case 2: The genome index has already been built (as described in
section 3 above). In this case, you do not need to build the genome
index again, just the transcriptome index, so you should omit the
genome FASTA file:
gmap_build [-D <directory>] -d <genome_name> -c <transcriptome_name> -T transcripts.fasta, or
gmap_build [-D <directory>] -d <genome_name> -c <transcriptome_name> -G transcripts.map
The result of these procedures will be to create index files in one
directory for the genome, and in another directory for the
transcriptome. In addition, there will be a subdirectory
<genome_name>.transcripts with files <transcriptome_name>.*, which
contain information about how transcripts map to the genome.
After these indices are built, you can perform TGGA by doing
gsnap [-D <directory>] -d <genome_name> -c <transcriptome_name> -N 1 -A sam <fastq files...>
In other words, the only addition is the flag "-c
<transcriptome_name>". The "-N 1" flag is actually optional, because
the fact that you have a transcriptome tells GSNAP that your input
files are RNA-seq.
|