1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179
|
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
package go1
import "runtime"
// Not a benchmark; input for revcomp.
var fastabytes = makefasta()
func makefasta() []byte {
var n int = 25e6
if runtime.GOARCH == "arm" || runtime.GOARCH == "mips" || runtime.GOARCH == "mips64" {
// TODO(dfc) remove this limitation after precise gc.
// A value of 25e6 consumes 465mb of heap on 32bit
// platforms, which is too much for some systems.
// A value of 25e5 produces a memory layout that
// confuses the gc on 32bit platforms. So 25e4 it is.
n = 25e4
}
return fasta(n)
}
func fasta(n int) []byte {
out := make(fastaBuffer, 0, 11*n)
iub := []fastaAcid{
{prob: 0.27, sym: 'a'},
{prob: 0.12, sym: 'c'},
{prob: 0.12, sym: 'g'},
{prob: 0.27, sym: 't'},
{prob: 0.02, sym: 'B'},
{prob: 0.02, sym: 'D'},
{prob: 0.02, sym: 'H'},
{prob: 0.02, sym: 'K'},
{prob: 0.02, sym: 'M'},
{prob: 0.02, sym: 'N'},
{prob: 0.02, sym: 'R'},
{prob: 0.02, sym: 'S'},
{prob: 0.02, sym: 'V'},
{prob: 0.02, sym: 'W'},
{prob: 0.02, sym: 'Y'},
}
homosapiens := []fastaAcid{
{prob: 0.3029549426680, sym: 'a'},
{prob: 0.1979883004921, sym: 'c'},
{prob: 0.1975473066391, sym: 'g'},
{prob: 0.3015094502008, sym: 't'},
}
alu := []byte(
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
out.WriteString(">ONE Homo sapiens alu\n")
fastaRepeat(&out, alu, 2*n)
out.WriteString(">TWO IUB ambiguity codes\n")
fastaRandom(&out, iub, 3*n)
out.WriteString(">THREE Homo sapiens frequency\n")
fastaRandom(&out, homosapiens, 5*n)
return out
}
type fastaBuffer []byte
func (b *fastaBuffer) Flush() {
panic("flush")
}
func (b *fastaBuffer) WriteString(s string) {
p := b.NextWrite(len(s))
copy(p, s)
}
func (b *fastaBuffer) NextWrite(n int) []byte {
p := *b
if len(p)+n > cap(p) {
b.Flush()
p = *b
}
out := p[len(p) : len(p)+n]
*b = p[:len(p)+n]
return out
}
const fastaLine = 60
func fastaRepeat(out *fastaBuffer, alu []byte, n int) {
buf := append(alu, alu...)
off := 0
for n > 0 {
m := n
if m > fastaLine {
m = fastaLine
}
buf1 := out.NextWrite(m + 1)
copy(buf1, buf[off:])
buf1[m] = '\n'
if off += m; off >= len(alu) {
off -= len(alu)
}
n -= m
}
}
const (
fastaLookupSize = 4096
fastaLookupScale float64 = fastaLookupSize - 1
)
var fastaRand uint32 = 42
type fastaAcid struct {
sym byte
prob float64
cprob float64
next *fastaAcid
}
func fastaComputeLookup(acid []fastaAcid) *[fastaLookupSize]*fastaAcid {
var lookup [fastaLookupSize]*fastaAcid
var p float64
for i := range acid {
p += acid[i].prob
acid[i].cprob = p * fastaLookupScale
if i > 0 {
acid[i-1].next = &acid[i]
}
}
acid[len(acid)-1].cprob = 1.0 * fastaLookupScale
j := 0
for i := range lookup {
for acid[j].cprob < float64(i) {
j++
}
lookup[i] = &acid[j]
}
return &lookup
}
func fastaRandom(out *fastaBuffer, acid []fastaAcid, n int) {
const (
IM = 139968
IA = 3877
IC = 29573
)
lookup := fastaComputeLookup(acid)
for n > 0 {
m := n
if m > fastaLine {
m = fastaLine
}
buf := out.NextWrite(m + 1)
f := fastaLookupScale / IM
myrand := fastaRand
for i := 0; i < m; i++ {
myrand = (myrand*IA + IC) % IM
r := float64(int(myrand)) * f
a := lookup[int(r)]
for a.cprob < r {
a = a.next
}
buf[i] = a.sym
}
fastaRand = myrand
buf[m] = '\n'
n -= m
}
}
|