File: MANUAL

package info (click to toggle)
hisat2 2.1.0-2
  • links: PTS, VCS
  • area: main
  • in suites: bullseye, buster, sid
  • size: 13,756 kB
  • sloc: cpp: 86,309; python: 12,230; sh: 2,171; perl: 936; makefile: 375
file content (1467 lines) | stat: -rw-r--r-- 65,305 bytes parent folder | download
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
244
245
246
247
248
249
250
251
252
253
254
255
256
257
258
259
260
261
262
263
264
265
266
267
268
269
270
271
272
273
274
275
276
277
278
279
280
281
282
283
284
285
286
287
288
289
290
291
292
293
294
295
296
297
298
299
300
301
302
303
304
305
306
307
308
309
310
311
312
313
314
315
316
317
318
319
320
321
322
323
324
325
326
327
328
329
330
331
332
333
334
335
336
337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
357
358
359
360
361
362
363
364
365
366
367
368
369
370
371
372
373
374
375
376
377
378
379
380
381
382
383
384
385
386
387
388
389
390
391
392
393
394
395
396
397
398
399
400
401
402
403
404
405
406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
432
433
434
435
436
437
438
439
440
441
442
443
444
445
446
447
448
449
450
451
452
453
454
455
456
457
458
459
460
461
462
463
464
465
466
467
468
469
470
471
472
473
474
475
476
477
478
479
480
481
482
483
484
485
486
487
488
489
490
491
492
493
494
495
496
497
498
499
500
501
502
503
504
505
506
507
508
509
510
511
512
513
514
515
516
517
518
519
520
521
522
523
524
525
526
527
528
529
530
531
532
533
534
535
536
537
538
539
540
541
542
543
544
545
546
547
548
549
550
551
552
553
554
555
556
557
558
559
560
561
562
563
564
565
566
567
568
569
570
571
572
573
574
575
576
577
578
579
580
581
582
583
584
585
586
587
588
589
590
591
592
593
594
595
596
597
598
599
600
601
602
603
604
605
606
607
608
609
610
611
612
613
614
615
616
617
618
619
620
621
622
623
624
625
626
627
628
629
630
631
632
633
634
635
636
637
638
639
640
641
642
643
644
645
646
647
648
649
650
651
652
653
654
655
656
657
658
659
660
661
662
663
664
665
666
667
668
669
670
671
672
673
674
675
676
677
678
679
680
681
682
683
684
685
686
687
688
689
690
691
692
693
694
695
696
697
698
699
700
701
702
703
704
705
706
707
708
709
710
711
712
713
714
715
716
717
718
719
720
721
722
723
724
725
726
727
728
729
730
731
732
733
734
735
736
737
738
739
740
741
742
743
744
745
746
747
748
749
750
751
752
753
754
755
756
757
758
759
760
761
762
763
764
765
766
767
768
769
770
771
772
773
774
775
776
777
778
779
780
781
782
783
784
785
786
787
788
789
790
791
792
793
794
795
796
797
798
799
800
801
802
803
804
805
806
807
808
809
810
811
812
813
814
815
816
817
818
819
820
821
822
823
824
825
826
827
828
829
830
831
832
833
834
835
836
837
838
839
840
841
842
843
844
845
846
847
848
849
850
851
852
853
854
855
856
857
858
859
860
861
862
863
864
865
866
867
868
869
870
871
872
873
874
875
876
877
878
879
880
881
882
883
884
885
886
887
888
889
890
891
892
893
894
895
896
897
898
899
900
901
902
903
904
905
906
907
908
909
910
911
912
913
914
915
916
917
918
919
920
921
922
923
924
925
926
927
928
929
930
931
932
933
934
935
936
937
938
939
940
941
942
943
944
945
946
947
948
949
950
951
952
953
954
955
956
957
958
959
960
961
962
963
964
965
966
967
968
969
970
971
972
973
974
975
976
977
978
979
980
981
982
983
984
985
986
987
988
989
990
991
992
993
994
995
996
997
998
999
1000
1001
1002
1003
1004
1005
1006
1007
1008
1009
1010
1011
1012
1013
1014
1015
1016
1017
1018
1019
1020
1021
1022
1023
1024
1025
1026
1027
1028
1029
1030
1031
1032
1033
1034
1035
1036
1037
1038
1039
1040
1041
1042
1043
1044
1045
1046
1047
1048
1049
1050
1051
1052
1053
1054
1055
1056
1057
1058
1059
1060
1061
1062
1063
1064
1065
1066
1067
1068
1069
1070
1071
1072
1073
1074
1075
1076
1077
1078
1079
1080
1081
1082
1083
1084
1085
1086
1087
1088
1089
1090
1091
1092
1093
1094
1095
1096
1097
1098
1099
1100
1101
1102
1103
1104
1105
1106
1107
1108
1109
1110
1111
1112
1113
1114
1115
1116
1117
1118
1119
1120
1121
1122
1123
1124
1125
1126
1127
1128
1129
1130
1131
1132
1133
1134
1135
1136
1137
1138
1139
1140
1141
1142
1143
1144
1145
1146
1147
1148
1149
1150
1151
1152
1153
1154
1155
1156
1157
1158
1159
1160
1161
1162
1163
1164
1165
1166
1167
1168
1169
1170
1171
1172
1173
1174
1175
1176
1177
1178
1179
1180
1181
1182
1183
1184
1185
1186
1187
1188
1189
1190
1191
1192
1193
1194
1195
1196
1197
1198
1199
1200
1201
1202
1203
1204
1205
1206
1207
1208
1209
1210
1211
1212
1213
1214
1215
1216
1217
1218
1219
1220
1221
1222
1223
1224
1225
1226
1227
1228
1229
1230
1231
1232
1233
1234
1235
1236
1237
1238
1239
1240
1241
1242
1243
1244
1245
1246
1247
1248
1249
1250
1251
1252
1253
1254
1255
1256
1257
1258
1259
1260
1261
1262
1263
1264
1265
1266
1267
1268
1269
1270
1271
1272
1273
1274
1275
1276
1277
1278
1279
1280
1281
1282
1283
1284
1285
1286
1287
1288
1289
1290
1291
1292
1293
1294
1295
1296
1297
1298
1299
1300
1301
1302
1303
1304
1305
1306
1307
1308
1309
1310
1311
1312
1313
1314
1315
1316
1317
1318
1319
1320
1321
1322
1323
1324
1325
1326
1327
1328
1329
1330
1331
1332
1333
1334
1335
1336
1337
1338
1339
1340
1341
1342
1343
1344
1345
1346
1347
1348
1349
1350
1351
1352
1353
1354
1355
1356
1357
1358
1359
1360
1361
1362
1363
1364
1365
1366
1367
1368
1369
1370
1371
1372
1373
1374
1375
1376
1377
1378
1379
1380
1381
1382
1383
1384
1385
1386
1387
1388
1389
1390
1391
1392
1393
1394
1395
1396
1397
1398
1399
1400
1401
1402
1403
1404
1405
1406
1407
1408
1409
1410
1411
1412
1413
1414
1415
1416
1417
1418
1419
1420
1421
1422
1423
1424
1425
1426
1427
1428
1429
1430
1431
1432
1433
1434
1435
1436
1437
1438
1439
1440
1441
1442
1443
1444
1445
1446
1447
1448
1449
1450
1451
1452
1453
1454
1455
1456
1457
1458
1459
1460
1461
1462
1463
1464
1465
1466
1467

Introduction
============

What is HISAT2?
-----------------

HISAT2 is a fast and sensitive alignment program for mapping next-generation sequencing reads 
(whole-genome, transcriptome, and exome sequencing data) against the general human population 
(as well as against a single reference genome). Based on [GCSA] (an extension of [BWT] for a graph), we designed and implemented a graph FM index (GFM),
an original approach and its first implementation to the best of our knowledge. 
In addition to using one global GFM index that represents general population, 
HISAT2 uses a large set of small GFM indexes that collectively cover the whole genome 
(each index representing a genomic region of 56 Kbp, with 55,000 indexes needed to cover human population). 
These small indexes (called local indexes) combined with several alignment strategies enable effective alignment of sequencing reads. 
This new indexing scheme is called Hierarchical Graph FM index (HGFM). 
We have developed HISAT 2 based on the [HISAT] and [Bowtie2] implementations.
HISAT2 outputs alignments in [SAM] format, enabling interoperation with a large number of other tools (e.g. [SAMtools], [GATK]) that use SAM.
HISAT2 is distributed under the [GPLv3 license], and it runs on the command line under
Linux, Mac OS X and Windows.

[HISAT2]:          http://ccb.jhu.edu/software/hisat2
[HISAT]:           http://ccb.jhu.edu/software/hisat
[Bowtie2]:         http://bowtie-bio.sf.net/bowtie2
[Bowtie]:          http://bowtie-bio.sf.net
[Bowtie1]:         http://bowtie-bio.sf.net
[GCSA]:            http://ieeexplore.ieee.org/xpls/abs_all.jsp?arnumber=6698337&tag=1
[Burrows-Wheeler Transform]: http://en.wikipedia.org/wiki/Burrows-Wheeler_transform
[BWT]:             http://en.wikipedia.org/wiki/Burrows-Wheeler_transform
[FM Index]:        http://en.wikipedia.org/wiki/FM-index
[SAM]:             http://samtools.sourceforge.net/SAM1.pdf
[SAMtools]:        http://samtools.sourceforge.net
[GATK]:            http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit
[TopHat2]:         http://ccb.jhu.edu/software/tophat
[Cufflinks]:       http://cufflinks.cbcb.umd.edu/
[Crossbow]:        http://bowtie-bio.sf.net/crossbow
[Myrna]:           http://bowtie-bio.sf.net/myrna
[Bowtie paper]:    http://genomebiology.com/2009/10/3/R25
[GPLv3 license]:   http://www.gnu.org/licenses/gpl-3.0.html

Obtaining HISAT2
==================

Download HISAT2 sources and binaries from the Releases sections on the right side.
Binaries are available for Intel architectures (`x86_64`) running Linux, and Mac OS X.

Building from source
--------------------

Building HISAT2 from source requires a GNU-like environment with GCC, GNU Make
and other basics.  It should be possible to build HISAT2 on most vanilla Linux
installations or on a Mac installation with [Xcode] installed.  HISAT2 can
also be built on Windows using [Cygwin] or [MinGW] (MinGW recommended). For a 
MinGW build the choice of what compiler is to be used is important since this
will determine if a 32 or 64 bit code can be successfully compiled using it. If 
there is a need to generate both 32 and 64 bit on the same machine then a multilib 
MinGW has to be properly installed. [MSYS], the [zlib] library, and depending on 
architecture [pthreads] library are also required. We are recommending a 64 bit
build since it has some clear advantages in real life research problems. In order 
to simplify the MinGW setup it might be worth investigating popular MinGW personal 
builds since these are coming already prepared with most of the toolchains needed.

First, download the [source package] from the Releases section on the right side.
Unzip the file, change to the unzipped directory, and build the
HISAT2 tools by running GNU `make` (usually with the command `make`, but
sometimes with `gmake`) with no arguments.  If building with MinGW, run `make`
from the MSYS environment.

HISAT2 is using the multithreading software model in order to speed up 
execution times on SMP architectures where this is possible. On POSIX 
platforms (like linux, Mac OS, etc) it needs the pthread library. Although
it is possible to use pthread library on non-POSIX platform like Windows, due
to performance reasons HISAT2 will try to use Windows native multithreading
if possible.

For the support of SRA data access in HISAT2, please download and install the [NCBI-NGS] toolkit.
When running `make`, specify additional variables as follow.
`make USE_SRA=1 NCBI_NGS_DIR=/path/to/NCBI-NGS-directory NCBI_VDB_DIR=/path/to/NCBI-NGS-directory`,
where `NCBI_NGS_DIR` and `NCBI_VDB_DIR` will be used in Makefile for -I and -L compilation options.
For example, $(NCBI_NGS_DIR)/include and $(NCBI_NGS_DIR)/lib64 will be used.  

[Cygwin]:   http://www.cygwin.com/
[MinGW]:    http://www.mingw.org/
[MSYS]:     http://www.mingw.org/wiki/msys
[zlib]:     http://cygwin.com/packages/mingw-zlib/
[pthreads]: http://sourceware.org/pthreads-win32/
[GnuWin32]: http://gnuwin32.sf.net/packages/coreutils.htm
[Download]: https://sourceforge.net/projects/bowtie-bio/files/bowtie2/
[sourceforge site]: https://sourceforge.net/projects/bowtie-bio/files/bowtie2/
[source package]: http://ccb.jhu.edu/software/hisat2/downloads/hisat2-2.0.0-beta-source.zip
[Xcode]:    http://developer.apple.com/xcode/
[NCBI-NGS]: https://github.com/ncbi/ngs/wiki/Downloads 

Running HISAT2
=============

Adding to PATH
--------------

By adding your new HISAT2 directory to your [PATH environment variable], you
ensure that whenever you run `hisat2`, `hisat2-build` or `hisat2-inspect`
from the command line, you will get the version you just installed without
having to specify the entire path.  This is recommended for most users.  To do
this, follow your operating system's instructions for adding the directory to
your [PATH].

If you would like to install HISAT2 by copying the HISAT2 executable files
to an existing directory in your [PATH], make sure that you copy all the
executables, including `hisat2`, `hisat2-align-s`, `hisat2-align-l`, `hisat2-build`, `hisat2-build-s`, `hisat2-build-l`, `hisat2-inspect`, `hisat2-inspect-s` and
`hisat2-inspect-l`.

[PATH environment variable]: http://en.wikipedia.org/wiki/PATH_(variable)
[PATH]: http://en.wikipedia.org/wiki/PATH_(variable)

Reporting
---------

The reporting mode governs how many alignments HISAT2 looks for, and how to
report them.

In general, when we say that a read has an alignment, we mean that it has a
[valid alignment].  When we say that a read has multiple alignments, we mean
that it has multiple alignments that are valid and distinct from one another. 

By default, HISAT2 may soft-clip reads near their 5' and 3' ends.  Users can control this behavior by setting different penalties for soft-clipping (`--sp`) or by disallowing soft-clipping (`--no-softclip`).

### Distinct alignments map a read to different places

Two alignments for the same individual read are "distinct" if they map the same
read to different places.  Specifically, we say that two alignments are distinct
if there are no alignment positions where a particular read offset is aligned
opposite a particular reference offset in both alignments with the same
orientation.  E.g. if the first alignment is in the forward orientation and
aligns the read character at read offset 10 to the reference character at
chromosome 3, offset 3,445,245, and the second alignment is also in the forward
orientation and also aligns the read character at read offset 10 to the
reference character at chromosome 3, offset 3,445,245, they are not distinct
alignments.

Two alignments for the same pair are distinct if either the mate 1s in the two
paired-end alignments are distinct or the mate 2s in the two alignments are
distinct or both.

### Default mode: search for one or more alignments, report each

HISAT2 searches for up to N distinct, primary alignments for
each read, where N equals the integer specified with the `-k` parameter.
Primary alignments mean alignments whose alignment score is equal or higher than any other alignments.
It is possible that multiple distinct alignments have the same score.
That is, if `-k 2` is specified, HISAT2 will search for at most 2 distinct
alignments. The alignment score for a paired-end alignment equals the sum of the
alignment scores of the individual mates.  Each reported read or pair alignment
beyond the first has the SAM 'secondary' bit (which equals 256) set in its FLAGS
field.  See the [SAM specification] for details.

HISAT2 does not "find" alignments in any specific order, so for reads that
have more than N distinct, valid alignments, HISAT2 does not guarantee that
the N alignments reported are the best possible in terms of alignment score.
Still, this mode can be effective and fast in situations where the user cares
more about whether a read aligns (or aligns a certain number of times) than
where exactly it originated.

[SAM specification]: http://samtools.sourceforge.net/SAM1.pdf

Alignment summary
------------------

When HISAT2 finishes running, it prints messages summarizing what happened. 
These messages are printed to the "standard error" ("stderr") filehandle.  For
datasets consisting of unpaired reads, the summary might look like this:

    20000 reads; of these:
      20000 (100.00%) were unpaired; of these:
        1247 (6.24%) aligned 0 times
        18739 (93.69%) aligned exactly 1 time
        14 (0.07%) aligned >1 times
    93.77% overall alignment rate

For datasets consisting of pairs, the summary might look like this:

    10000 reads; of these:
      10000 (100.00%) were paired; of these:
        650 (6.50%) aligned concordantly 0 times
        8823 (88.23%) aligned concordantly exactly 1 time
        527 (5.27%) aligned concordantly >1 times
        ----
        650 pairs aligned concordantly 0 times; of these:
          34 (5.23%) aligned discordantly 1 time
        ----
        616 pairs aligned 0 times concordantly or discordantly; of these:
          1232 mates make up the pairs; of these:
            660 (53.57%) aligned 0 times
            571 (46.35%) aligned exactly 1 time
            1 (0.08%) aligned >1 times
    96.70% overall alignment rate

The indentation indicates how subtotals relate to totals.

Wrapper
-------

The `hisat2`, `hisat2-build` and `hisat2-inspect` executables are actually 
wrapper scripts that call binary programs as appropriate.  The wrappers shield
users from having to distinguish between "small" and "large" index formats,
discussed briefly in the following section.  Also, the `hisat2` wrapper
provides some key functionality, like the ability to handle compressed inputs,
and the functionality for `--un`, `--al` and related options.

It is recommended that you always run the hisat2 wrappers and not run the
binaries directly.

Small and large indexes
-----------------------

`hisat2-build` can index reference genomes of any size.  For genomes less than
about 4 billion nucleotides in length, `hisat2-build` builds a "small" index
using 32-bit numbers in various parts of the index.  When the genome is longer,
`hisat2-build` builds a "large" index using 64-bit numbers.  Small indexes are
stored in files with the `.ht2` extension, and large indexes are stored in
files with the `.ht2l` extension.  The user need not worry about whether a
particular index is small or large; the wrapper scripts will automatically build
and use the appropriate index.

Performance tuning
------------------

1.  If your computer has multiple processors/cores, use `-p`

    The `-p` option causes HISAT2 to launch a specified number of parallel
    search threads.  Each thread runs on a different processor/core and all
    threads find alignments in parallel, increasing alignment throughput by
    approximately a multiple of the number of threads (though in practice,
    speedup is somewhat worse than linear).

Command Line
------------

### Setting function options

Some HISAT2 options specify a function rather than an individual number or
setting.  In these cases the user specifies three parameters: (a) a function
type `F`, (b) a constant term `B`, and (c) a coefficient `A`.  The available
function types are constant (`C`), linear (`L`), square-root (`S`), and natural
log (`G`). The parameters are specified as `F,B,A` - that is, the function type,
the constant term, and the coefficient are separated by commas with no
whitespace.  The constant term and coefficient may be negative and/or
floating-point numbers.

For example, if the function specification is `L,-0.4,-0.6`, then the function
defined is:

    f(x) = -0.4 + -0.6 * x

If the function specification is `G,1,5.4`, then the function defined is:

    f(x) = 1.0 + 5.4 * ln(x)

See the documentation for the option in question to learn what the parameter `x`
is for.  For example, in the case if the `--score-min` option, the function
`f(x)` sets the minimum alignment score necessary for an alignment to be
considered valid, and `x` is the read length.

### Usage

    hisat2 [options]* -x <hisat2-idx> {-1 <m1> -2 <m2> | -U <r> | --sra-acc <SRA accession number>} [-S <hit>]

### Main arguments

    -x <hisat2-idx>

The basename of the index for the reference genome.  The basename is the name of
any of the index files up to but not including the final `.1.ht2` / etc.
`hisat2` looks for the specified index first in the current directory,
then in the directory specified in the `HISAT2_INDEXES` environment variable.

    -1 <m1>

Comma-separated list of files containing mate 1s (filename usually includes
`_1`), e.g. `-1 flyA_1.fq,flyB_1.fq`.  Sequences specified with this option must
correspond file-for-file and read-for-read with those specified in `<m2>`. Reads
may be a mix of different lengths. If `-` is specified, `hisat2` will read the
mate 1s from the "standard in" or "stdin" filehandle.

    -2 <m2>

Comma-separated list of files containing mate 2s (filename usually includes
`_2`), e.g. `-2 flyA_2.fq,flyB_2.fq`.  Sequences specified with this option must
correspond file-for-file and read-for-read with those specified in `<m1>`. Reads
may be a mix of different lengths. If `-` is specified, `hisat2` will read the
mate 2s from the "standard in" or "stdin" filehandle.

    -U <r>

Comma-separated list of files containing unpaired reads to be aligned, e.g.
`lane1.fq,lane2.fq,lane3.fq,lane4.fq`.  Reads may be a mix of different lengths.
If `-` is specified, `hisat2` gets the reads from the "standard in" or "stdin"
filehandle.

    --sra-acc <SRA accession number>

Comma-separated list of SRA accession numbers, e.g. `--sra-acc SRR353653,SRR353654`.
Information about read types is available at http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?sp=runinfo&acc=<b>sra-acc</b>&retmode=xml,
where <b>sra-acc</b> is SRA accession number.  If users run HISAT2 on a computer cluster, it is recommended to disable SRA-related caching (see the instruction at [SRA-MANUAL]).

[SRA-MANUAL]:	     https://github.com/ncbi/sra-tools/wiki/Toolkit-Configuration

    -S <hit>

File to write SAM alignments to.  By default, alignments are written to the
"standard out" or "stdout" filehandle (i.e. the console).

### Options

#### Input options

    -q

Reads (specified with `<m1>`, `<m2>`, `<s>`) are FASTQ files.  FASTQ files
usually have extension `.fq` or `.fastq`.  FASTQ is the default format.  See
also: `--solexa-quals` and `--int-quals`.

    --qseq

Reads (specified with `<m1>`, `<m2>`, `<s>`) are QSEQ files.  QSEQ files usually
end in `_qseq.txt`.  See also: `--solexa-quals` and `--int-quals`.

    -f

Reads (specified with `<m1>`, `<m2>`, `<s>`) are FASTA files.  FASTA files
usually have extension `.fa`, `.fasta`, `.mfa`, `.fna` or similar.  FASTA files
do not have a way of specifying quality values, so when `-f` is set, the result
is as if `--ignore-quals` is also set.

    -r

Reads (specified with `<m1>`, `<m2>`, `<s>`) are files with one input sequence
per line, without any other information (no read names, no qualities).  When
`-r` is set, the result is as if `--ignore-quals` is also set.

    -c

The read sequences are given on command line.  I.e. `<m1>`, `<m2>` and
`<singles>` are comma-separated lists of reads rather than lists of read files.
There is no way to specify read names or qualities, so `-c` also implies
`--ignore-quals`.

    -s/--skip <int>

Skip (i.e. do not align) the first `<int>` reads or pairs in the input.

    -u/--qupto <int>

Align the first `<int>` reads or read pairs from the input (after the
`-s`/`--skip` reads or pairs have been skipped), then stop.  Default: no limit.

    -5/--trim5 <int>

Trim `<int>` bases from 5' (left) end of each read before alignment (default: 0).

    -3/--trim3 <int>

Trim `<int>` bases from 3' (right) end of each read before alignment (default:
0).

    --phred33

Input qualities are ASCII chars equal to the [Phred quality] plus 33.  This is
also called the "Phred+33" encoding, which is used by the very latest Illumina
pipelines.

[Phred quality]: http://en.wikipedia.org/wiki/Phred_quality_score

    --phred64

Input qualities are ASCII chars equal to the [Phred quality] plus 64.  This is
also called the "Phred+64" encoding.

    --solexa-quals

Convert input qualities from [Solexa][Phred quality] (which can be negative) to
[Phred][Phred quality] (which can't).  This scheme was used in older Illumina GA
Pipeline versions (prior to 1.3).  Default: off.

    --int-quals

Quality values are represented in the read input file as space-separated ASCII
integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`....
 Integers are treated as being on the [Phred quality] scale unless
`--solexa-quals` is also specified. Default: off.

#### Alignment options

    --n-ceil <func>

Sets a function governing the maximum number of ambiguous characters (usually
`N`s and/or `.`s) allowed in a read as a function of read length.  For instance,
specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`,
where x is the read length.  See also: [setting function options].  Reads
exceeding this ceiling are [filtered out].  Default: `L,0,0.15`.

    --ignore-quals

When calculating a mismatch penalty, always consider the quality value at the
mismatched position to be the highest possible, regardless of the actual value. 
I.e. input is treated as though all quality values are high.  This is also the
default behavior when the input doesn't specify quality values (e.g. in `-f`,
`-r`, or `-c` modes).

    --nofw/--norc

If `--nofw` is specified, `hisat2` will not attempt to align unpaired reads to
the forward (Watson) reference strand.  If `--norc` is specified, `hisat2` will
not attempt to align unpaired reads against the reverse-complement (Crick)
reference strand. In paired-end mode, `--nofw` and `--norc` pertain to the
fragments; i.e. specifying `--nofw` causes `hisat2` to explore only those
paired-end configurations corresponding to fragments from the reverse-complement
(Crick) strand.  Default: both strands enabled. 

#### Scoring options

    --mp MX,MN

Sets the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers.  A
number less than or equal to `MX` and greater than or equal to `MN` is
subtracted from the alignment score for each position where a read character
aligns to a reference character, the characters do not match, and neither is an
`N`.  If `--ignore-quals` is specified, the number subtracted quals `MX`.
Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )`
where Q is the Phred quality value.  Default: `MX` = 6, `MN` = 2.

    --sp MX,MN

Sets the maximum (`MX`) and minimum (`MN`) penalties for soft-clipping per base, 
both integers. A number less than or equal to `MX` and greater than or equal to `MN` is
subtracted from the alignment score for each position.
The number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )`
where Q is the Phred quality value.  Default: `MX` = 2, `MN` = 1.

    --no-softclip

Disallow soft-clipping.

    --np <int>

Sets penalty for positions where the read, reference, or both, contain an
ambiguous character such as `N`.  Default: 1.

    --rdg <int1>,<int2>

Sets the read gap open (`<int1>`) and extend (`<int2>`) penalties.  A read gap of
length N gets a penalty of `<int1>` + N * `<int2>`.  Default: 5, 3.

    --rfg <int1>,<int2>

Sets the reference gap open (`<int1>`) and extend (`<int2>`) penalties.  A
reference gap of length N gets a penalty of `<int1>` + N * `<int2>`.  Default:
5, 3.

    --score-min <func>

Sets a function governing the minimum alignment score needed for an alignment to
be considered "valid" (i.e. good enough to report).  This is a function of read
length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f`
to `f(x) = 0 + -0.6 * x`, where `x` is the read length.  See also: [setting
function options].  The default is `L,0,-0.2`.

#### Spliced alignment options

    --pen-cansplice <int>

Sets the penalty for each pair of canonical splice sites (e.g. GT/AG). Default: 0.

    --pen-noncansplice <int>

Sets the penalty for each pair of non-canonical splice sites (e.g. non-GT/AG). Default: 12.

    --pen-canintronlen <func>

Sets the penalty for long introns with canonical splice sites so that alignments with shorter introns are preferred
to those with longer ones.  Default: G,-8,1

    --pen-noncanintronlen <func>

Sets the penalty for long introns with noncanonical splice sites so that alignments with shorter introns are preferred
to those with longer ones.  Default: G,-8,1

    --min-intronlen <int>

Sets minimum intron length. Default: 20

    --max-intronlen <int>

Sets maximum intron length. Default: 500000

    --known-splicesite-infile <path>

With this mode, you can provide a list of known splice sites, which HISAT2 makes use of to align reads with small anchors.   
You can create such a list using `python hisat2_extract_splice_sites.py genes.gtf > splicesites.txt`,
where `hisat2_extract_splice_sites.py` is included in the HISAT2 package, `genes.gtf` is a gene annotation file,
and `splicesites.txt` is a list of splice sites with which you provide HISAT2 in this mode.
Note that it is better to use indexes built using annotated transcripts (such as <i>genome_tran</i> or <i>genome_snp_tran</i>), which works better
than using this option.  It has no effect to provide splice sites that are already included in the indexes.

    --novel-splicesite-outfile <path>

In this mode, HISAT2 reports a list of splice sites in the file <path>:  
   chromosome name `<tab>` genomic position of the flanking base on the left side of an intron `<tab>` genomic position of the flanking base on the right `<tab>` strand (+, -, and .)
   '.' indicates an unknown strand for non-canonical splice sites.

    --novel-splicesite-infile <path>

With this mode, you can provide a list of novel splice sites that were generated from the above option "--novel-splicesite-outfile".

    --no-temp-splicesite

HISAT2, by default, makes use of splice sites found by earlier reads to align later reads in the same run,
in particular, reads with small anchors (<= 15 bp).  
The option disables this default alignment strategy. 

    --no-spliced-alignment

Disable spliced alignment.

    --rna-strandness <string>

Specify strand-specific information: the default is unstranded.  
For single-end reads, use F or R. 
 'F' means a read corresponds to a transcript.
 'R' means a read corresponds to the reverse complemented counterpart of a transcript.
For paired-end reads, use either FR or RF.  
With this option being used, every read alignment will have an XS attribute tag:
 '+' means a read belongs to a transcript on '+' strand of genome.
 '-' means a read belongs to a transcript on '-' strand of genome.

(TopHat has a similar option, --library-type option, where fr-firststrand corresponds to R and RF; fr-secondstrand corresponds to F and FR.)

    --tmo/--transcriptome-mapping-only

Report only those alignments within known transcripts.

    --dta/--downstream-transcriptome-assembly

Report alignments tailored for transcript assemblers including StringTie.
With this option, HISAT2 requires longer anchor lengths for de novo discovery of splice sites.
This leads to fewer alignments with short-anchors, 
which helps transcript assemblers improve significantly in computation and memory usage.

    --dta-cufflinks

Report alignments tailored specifically for Cufflinks. In addition to what HISAT2 does with the above option (--dta),
With this option, HISAT2 looks for novel splice sites with three signals (GT/AG, GC/AG, AT/AC), but all user-provided splice sites are used irrespective of their signals.
HISAT2 produces an optional field, XS:A:[+-], for every spliced alignment.

    --no-templatelen-adjustment

Disables template length adjustment for RNA-seq reads.

#### Reporting options

    -k <int>

It searches for at most `<int>` distinct, primary alignments for each read.
Primary alignments mean alignments whose alignment score is equal or higher than any other alignments.
The search terminates when it can't find more distinct valid alignments, or when it
finds `<int>`, whichever happens first. The alignment score for a paired-end
alignment equals the sum of the alignment scores of the individual mates. Each
reported read or pair alignment beyond the first has the SAM 'secondary' bit
(which equals 256) set in its FLAGS field.  For reads that have more than
`<int>` distinct, valid alignments, `hisat2` does not guarantee that the
`<int>` alignments reported are the best possible in terms of alignment score. Default: 5 (HFM) or 10 (HGFM)

Note: HISAT2 is not designed with large values for `-k` in mind, and when
aligning reads to long, repetitive genomes large `-k` can be very, very slow.

    --max-seeds <int>

HISAT2, like other aligners, uses seed-and-extend approaches.  HISAT2 tries to extend seeds to full-length alignments. In HISAT2, --max-seeds is used to control the maximum number of seeds that will be extended. HISAT2 extends up to these many seeds and skips the rest of the seeds. Large values for `--max-seeds` may improve alignment sensitivity, but HISAT2 is not designed with large values for `--max-seeds` in mind, and when aligning reads to long, repetitive genomes large `--max-seeds` can be very, very slow. The default value is the maximum of 5 and the value that comes with`-k`.

    --secondary

Report secondary alignments.

#### Paired-end options

    -I/--minins <int>

The minimum fragment length for valid paired-end alignments.This option is valid only with --no-spliced-alignment.
E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the
appropriate orientation with a 20-bp gap between them, that alignment is
considered valid (as long as `-X` is also satisfied).  A 19-bp gap would not
be valid in that case.  If trimming options `-3` or `-5` are also used, the
`-I` constraint is applied with respect to the untrimmed mates.

The larger the difference between `-I` and `-X`, the slower HISAT2 will
run.  This is because larger differences between `-I` and `-X` require that
HISAT2 scan a larger window to determine if a concordant alignment exists.
For typical fragment length ranges (200 to 400 nucleotides), HISAT2 is very
efficient.

Default: 0 (essentially imposing no minimum) 

    -X/--maxins <int>

The maximum fragment length for valid paired-end alignments.  This option is valid only with --no-spliced-alignment.
E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the
proper orientation with a 60-bp gap between them, that alignment is considered
valid (as long as `-I` is also satisfied).  A 61-bp gap would not be valid in
that case.  If trimming options `-3` or `-5` are also used, the `-X`
constraint is applied with respect to the untrimmed mates, not the trimmed
mates.

The larger the difference between `-I` and `-X`, the slower HISAT2 will
run.  This is because larger differences between `-I` and `-X` require that
HISAT2 scan a larger window to determine if a concordant alignment exists.
For typical fragment length ranges (200 to 400 nucleotides), HISAT2 is very
efficient.

Default: 500.

    --fr/--rf/--ff

The upstream/downstream mate orientations for a valid paired-end alignment
against the forward reference strand.  E.g., if `--fr` is specified and there is
a candidate paired-end alignment where mate 1 appears upstream of the reverse
complement of mate 2 and the fragment length constraints (`-I` and `-X`) are
met, that alignment is valid.  Also, if mate 2 appears upstream of the reverse
complement of mate 1 and all other constraints are met, that too is valid.
`--rf` likewise requires that an upstream mate1 be reverse-complemented and a
downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1
and a downstream mate 2 to be forward-oriented.  Default: `--fr` (appropriate
for Illumina's Paired-end Sequencing Assay).

    --no-mixed

By default, when `hisat2` cannot find a concordant or discordant alignment for
a pair, it then tries to find alignments for the individual mates.  This option
disables that behavior.

    --no-discordant

By default, `hisat2` looks for discordant alignments if it cannot find any
concordant alignments.  A discordant alignment is an alignment where both mates
align uniquely, but that does not satisfy the paired-end constraints
(`--fr`/`--rf`/`--ff`, `-I`, `-X`).  This option disables that behavior.

#### Output options

    -t/--time

Print the wall-clock time required to load the index files and align the reads. 
This is printed to the "standard error" ("stderr") filehandle.  Default: off.

    --un <path>
    --un-gz <path>
    --un-bz2 <path>

Write unpaired reads that fail to align to file at `<path>`.  These reads
correspond to the SAM records with the FLAGS `0x4` bit set and neither the
`0x40` nor `0x80` bits set.  If `--un-gz` is specified, output will be gzip
compressed. If `--un-bz2` is specified, output will be bzip2 compressed.  Reads
written in this way will appear exactly as they did in the input file, without
any modification (same sequence, same name, same quality string, same quality
encoding).  Reads will not necessarily appear in the same order as they did in
the input.

    --al <path>
    --al-gz <path>
    --al-bz2 <path>

Write unpaired reads that align at least once to file at `<path>`.  These reads
correspond to the SAM records with the FLAGS `0x4`, `0x40`, and `0x80` bits
unset.  If `--al-gz` is specified, output will be gzip compressed. If `--al-bz2`
is specified, output will be bzip2 compressed.  Reads written in this way will
appear exactly as they did in the input file, without any modification (same
sequence, same name, same quality string, same quality encoding).  Reads will
not necessarily appear in the same order as they did in the input.

    --un-conc <path>
    --un-conc-gz <path>
    --un-conc-bz2 <path>

Write paired-end reads that fail to align concordantly to file(s) at `<path>`.
These reads correspond to the SAM records with the FLAGS `0x4` bit set and
either the `0x40` or `0x80` bit set (depending on whether it's mate #1 or #2).
`.1` and `.2` strings are added to the filename to distinguish which file
contains mate #1 and mate #2.  If a percent symbol, `%`, is used in `<path>`,
the percent symbol is replaced with `1` or `2` to make the per-mate filenames.
Otherwise, `.1` or `.2` are added before the final dot in `<path>` to make the
per-mate filenames.  Reads written in this way will appear exactly as they did
in the input files, without any modification (same sequence, same name, same
quality string, same quality encoding).  Reads will not necessarily appear in
the same order as they did in the inputs.

    --al-conc <path>
    --al-conc-gz <path>
    --al-conc-bz2 <path>

Write paired-end reads that align concordantly at least once to file(s) at
`<path>`. These reads correspond to the SAM records with the FLAGS `0x4` bit
unset and either the `0x40` or `0x80` bit set (depending on whether it's mate #1
or #2). `.1` and `.2` strings are added to the filename to distinguish which
file contains mate #1 and mate #2.  If a percent symbol, `%`, is used in
`<path>`, the percent symbol is replaced with `1` or `2` to make the per-mate
filenames. Otherwise, `.1` or `.2` are added before the final dot in `<path>` to
make the per-mate filenames.  Reads written in this way will appear exactly as
they did in the input files, without any modification (same sequence, same name,
same quality string, same quality encoding).  Reads will not necessarily appear
in the same order as they did in the inputs.

    --quiet

Print nothing besides alignments and serious errors.

    --summary-file

Print alignment summary to this file.

    --new-summary

Print alignment summary in a new style, which is more machine-friendly.

    --met-file <path>

Write `hisat2` metrics to file `<path>`.  Having alignment metric can be useful
for debugging certain problems, especially performance issues.  See also:
`--met`.  Default: metrics disabled.

    --met-stderr

Write `hisat2` metrics to the "standard error" ("stderr") filehandle.  This is
not mutually exclusive with `--met-file`.  Having alignment metric can be
useful for debugging certain problems, especially performance issues.  See also:
`--met`.  Default: metrics disabled.

    --met <int>

Write a new `hisat2` metrics record every `<int>` seconds.  Only matters if
either `--met-stderr` or `--met-file` are specified.  Default: 1.

#### SAM options

    --no-unal

Suppress SAM records for reads that failed to align.

    --no-hd

Suppress SAM header lines (starting with `@`).

    --no-sq

Suppress `@SQ` SAM header lines.

    --rg-id <text>

Set the read group ID to `<text>`.  This causes the SAM `@RG` header line to be
printed, with `<text>` as the value associated with the `ID:` tag.  It also
causes the `RG:Z:` extra field to be attached to each SAM output record, with
value set to `<text>`.

    --rg <text>

Add `<text>` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the
`@RG` header line.  Note: in order for the `@RG` line to appear, `--rg-id`
must also be specified.  This is because the `ID` tag is required by the [SAM
Spec][SAM].  Specify `--rg` multiple times to set multiple fields.  See the
[SAM Spec][SAM] for details about what fields are legal.

    --remove-chrname

Remove 'chr' from reference names in alignment (e.g., chr18 to 18)

    --add-chrname

Add 'chr' to reference names in alignment (e.g., 18 to chr18)

    --omit-sec-seq

When printing secondary alignments, HISAT2 by default will write out the `SEQ`
and `QUAL` strings.  Specifying this option causes HISAT2 to print an asterisk
in those fields instead.

#### Performance options

    -o/--offrate <int>

Override the offrate of the index with `<int>`.  If `<int>` is greater
than the offrate used to build the index, then some row markings are
discarded when the index is read into memory.  This reduces the memory
footprint of the aligner but requires more time to calculate text
offsets.  `<int>` must be greater than the value used to build the
index.

    -p/--threads NTHREADS

Launch `NTHREADS` parallel search threads (default: 1).  Threads will run on
separate processors/cores and synchronize when parsing reads and outputting
alignments.  Searching for alignments is highly parallel, and speedup is close
to linear.  Increasing `-p` increases HISAT2's memory footprint. E.g. when
aligning to a human genome index, increasing `-p` from 1 to 8 increases the
memory footprint by a few hundred megabytes.  This option is only available if
`bowtie` is linked with the `pthreads` library (i.e. if `BOWTIE_PTHREADS=0` is
not specified at build time).

    --reorder

Guarantees that output SAM records are printed in an order corresponding to the
order of the reads in the original input file, even when `-p` is set greater
than 1.  Specifying `--reorder` and setting `-p` greater than 1 causes HISAT2
to run somewhat slower and use somewhat more memory then if `--reorder` were
not specified.  Has no effect if `-p` is set to 1, since output order will
naturally correspond to input order in that case.

    --mm

Use memory-mapped I/O to load the index, rather than typical file I/O.
Memory-mapping allows many concurrent `bowtie` processes on the same computer to
share the same memory image of the index (i.e. you pay the memory overhead just
once).  This facilitates memory-efficient parallelization of `bowtie` in
situations where using `-p` is not possible or not preferable.

#### Other options

    --qc-filter

Filter out reads for which the QSEQ filter field is non-zero.  Only has an
effect when read format is `--qseq`.  Default: off.

    --seed <int>

Use `<int>` as the seed for pseudo-random number generator.  Default: 0.

    --non-deterministic

Normally, HISAT2 re-initializes its pseudo-random generator for each read.  It
seeds the generator with a number derived from (a) the read name, (b) the
nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed`
option.  This means that if two reads are identical (same name, same
nucleotides, same qualities) HISAT2 will find and report the same alignment(s)
for both, even if there was ambiguity.  When `--non-deterministic` is specified,
HISAT2 re-initializes its pseudo-random generator for each read using the
current time.  This means that HISAT2 will not necessarily report the same
alignment for two identical reads.  This is counter-intuitive for some users,
but might be more appropriate in situations where the input consists of many
identical reads.

    --version

Print version information and quit.

    -h/--help

Print usage information and quit.

SAM output
----------

Following is a brief description of the [SAM] format as output by `hisat2`. 
For more details, see the [SAM format specification][SAM].

By default, `hisat2` prints a SAM header with `@HD`, `@SQ` and `@PG` lines. 
When one or more `--rg` arguments are specified, `hisat2` will also print
an `@RG` line that includes all user-specified `--rg` tokens separated by
tabs.

Each subsequent line describes an alignment or, if the read failed to align, a
read.  Each line is a collection of at least 12 fields separated by tabs; from
left to right, the fields are:

1.  Name of read that aligned.

    Note that the [SAM specification] disallows whitespace in the read name.
	If the read name contains any whitespace characters, HISAT2 will truncate
	the name at the first whitespace character.  This is similar to the
	behavior of other tools.

2.  Sum of all applicable flags.  Flags relevant to HISAT2 are:

        1

    The read is one of a pair

        2

    The alignment is one end of a proper paired-end alignment

        4

    The read has no reported alignments

        8

    The read is one of a pair and has no reported alignments

        16

    The alignment is to the reverse reference strand

        32

    The other mate in the paired-end alignment is aligned to the
    reverse reference strand

        64

    The read is mate 1 in a pair

        128

    The read is mate 2 in a pair

    Thus, an unpaired read that aligns to the reverse reference strand
    will have flag 16.  A paired-end read that aligns and is the first
    mate in the pair will have flag 83 (= 64 + 16 + 2 + 1).

3.  Name of reference sequence where alignment occurs

4.  1-based offset into the forward reference strand where leftmost
    character of the alignment occurs

5.  Mapping quality

6.  CIGAR string representation of alignment

7.  Name of reference sequence where mate's alignment occurs.  Set to `=` if the
mate's reference sequence is the same as this alignment's, or `*` if there is no
mate.

8.  1-based offset into the forward reference strand where leftmost character of
the mate's alignment occurs.  Offset is 0 if there is no mate.

9.  Inferred fragment length.  Size is negative if the mate's alignment occurs
upstream of this alignment.  Size is 0 if the mates did not align concordantly.
However, size is non-0 if the mates aligned discordantly to the same
chromosome.

10. Read sequence (reverse-complemented if aligned to the reverse strand)

11. ASCII-encoded read qualities (reverse-complemented if the read aligned to
the reverse strand).  The encoded quality values are on the [Phred quality]
scale and the encoding is ASCII-offset by 33 (ASCII char `!`), similarly to a
[FASTQ] file.

12. Optional fields.  Fields are tab-separated.  `hisat2` outputs zero or more
of these optional fields for each alignment, depending on the type of the
alignment:

        AS:i:<N>

    Alignment score.  Can be negative.  Only present if SAM record is for
    an aligned read.

        ZS:i:<N>

    Alignment score for the best-scoring alignment found other than the
    alignment reported.  Can be negative.  Only present if the SAM record is
    for an aligned read and more than one alignment was found for the read.
    Note that, when the read is part of a concordantly-aligned pair, this score
    could be greater than `AS:i`.

        YS:i:<N>

    Alignment score for opposite mate in the paired-end alignment.  Only present
    if the SAM record is for a read that aligned as part of a paired-end
    alignment.

        XN:i:<N>

    The number of ambiguous bases in the reference covering this alignment. 
    Only present if SAM record is for an aligned read.

        XM:i:<N>

    The number of mismatches in the alignment.  Only present if SAM record is
    for an aligned read.

        XO:i:<N>

    The number of gap opens, for both read and reference gaps, in the alignment.
    Only present if SAM record is for an aligned read.

        XG:i:<N>

    The number of gap extensions, for both read and reference gaps, in the
    alignment. Only present if SAM record is for an aligned read.

        NM:i:<N>

    The edit distance; that is, the minimal number of one-nucleotide edits
    (substitutions, insertions and deletions) needed to transform the read
    string into the reference string.  Only present if SAM record is for an
    aligned read.

        YF:Z:<S>

    String indicating reason why the read was filtered out.  See also:
    [Filtering].  Only appears for reads that were filtered out.

        YT:Z:<S>

    Value of `UU` indicates the read was not part of a pair.  Value of `CP`
    indicates the read was part of a pair and the pair aligned concordantly.
    Value of `DP` indicates the read was part of a pair and the pair aligned
    discordantly.  Value of `UP` indicates the read was part of a pair but the
    pair failed to aligned either concordantly or discordantly.

        MD:Z:<S>

    A string representation of the mismatched reference bases in the alignment. 
    See [SAM] format specification for details.  Only present if SAM record is
    for an aligned read.

        XS:A:<A>

    Values of `+` and `-` indicate the read is mapped to transcripts on sense and anti-sense
    strands, respectively.  Spliced alignments need to have this field, which is required in Cufflinks and StringTie.  
    We can report this field for the canonical-splice site (GT/AG), but not for non-canonical splice sites.
    You can direct HISAT2 not to output such alignments (involving non-canonical splice sites)  using "--pen-noncansplice 1000000".

        NH:i:<N>

    The number of mapped locations for the read or the pair.
    
        Zs:Z:<S>

    When the alignment of a read involves SNPs that are in the index, this option is used to indicate where exactly the read involves the SNPs.
    This optional field is similar to the above MD:Z field.
    For example, `Zs:Z:1|S|rs3747203,97|S|rs16990981` indicates the second base of the read corresponds to a known SNP (ID: rs3747203).
    97 bases after the third base (the base after the second one), the read at 100th base involves another known SNP (ID: rs16990981).
    'S' indicates a single nucleotide polymorphism.  'D' and 'I' indicate a deletion and an insertion, respectively.
    
[SAM format specification]: http://samtools.sf.net/SAM1.pdf
[FASTQ]: http://en.wikipedia.org/wiki/FASTQ_format

The `hisat2-build` indexer
===========================

`hisat2-build` builds a HISAT2 index from a set of DNA sequences.
`hisat2-build` outputs a set of 6 files with suffixes `.1.ht2`, `.2.ht2`,
`.3.ht2`, `.4.ht2`, `.5.ht2`, `.6.ht2`, `.7.ht2`, and `.8.ht2`.  In the case of a large 
index these suffixes will have a `ht2l` termination.  These files together
constitute the index: they are all that is needed to align reads to that
reference.  The original sequence FASTA files are no longer used by HISAT2
once the index is built.

Use of Karkkainen's [blockwise algorithm] allows `hisat2-build` to trade off
between running time and memory usage. `hisat2-build` has three options
governing how it makes this trade: `-p`/`--packed`, `--bmax`/`--bmaxdivn`,
and `--dcv`.  By default, `hisat2-build` will automatically search for the
settings that yield the best running time without exhausting memory.  This
behavior can be disabled using the `-a`/`--noauto` option.

The indexer provides options pertaining to the "shape" of the index, e.g.
`--offrate` governs the fraction of [Burrows-Wheeler]
rows that are "marked" (i.e., the density of the suffix-array sample; see the
original [FM Index] paper for details).  All of these options are potentially
profitable trade-offs depending on the application.  They have been set to
defaults that are reasonable for most cases according to our experiments.  See
[Performance tuning] for details.

`hisat2-build` can generate either [small or large indexes].  The wrapper
will decide which based on the length of the input genome.  If the reference
does not exceed 4 billion characters but a large index is preferred,  the user
can specify `--large-index` to force `hisat2-build` to build a large index
instead.

The HISAT2 index is based on the [FM Index] of Ferragina and Manzini, which in
turn is based on the [Burrows-Wheeler] transform.  The algorithm used to build
the index is based on the [blockwise algorithm] of Karkkainen.

[Blockwise algorithm]: http://portal.acm.org/citation.cfm?id=1314852
[Burrows-Wheeler]: http://en.wikipedia.org/wiki/Burrows-Wheeler_transform

Command Line
------------

Usage:

    hisat2-build [options]* <reference_in> <ht2_base>

### Notes
    If you use --snp, --ss, and/or --exon, hisat2-build will need about 200GB RAM for the human genome size as index building involves a graph construction. 
    Otherwise, you will be able to build an index on your desktop with 8GB RAM.
    
### Main arguments

A comma-separated list of FASTA files containing the reference sequences to be
aligned to, or, if `-c` is specified, the sequences
themselves. E.g., `<reference_in>` might be `chr1.fa,chr2.fa,chrX.fa,chrY.fa`,
or, if `-c` is specified, this might be
`GGTCATCCT,ACGGGTCGT,CCGTTCTATGCGGCTTA`.

The basename of the index files to write.  By default, `hisat2-build` writes
files named `NAME.1.ht2`, `NAME.2.ht2`, `NAME.3.ht2`, `NAME.4.ht2`,
`NAME.5.ht2`, `NAME.6.ht2`, `NAME.7.ht2`, and `NAME.8.ht2` where `NAME` is `<ht2_base>`.

### Options

    -f

The reference input files (specified as `<reference_in>`) are FASTA files
(usually having extension `.fa`, `.mfa`, `.fna` or similar).

    -c

The reference sequences are given on the command line.  I.e. `<reference_in>` is
a comma-separated list of sequences rather than a list of FASTA files.

    --large-index

Force `hisat2-build` to build a [large index], even if the reference is less
than ~ 4 billion nucleotides long.

    -a/--noauto

Disable the default behavior whereby `hisat2-build` automatically selects
values for the `--bmax`, `--dcv` and `--packed` parameters according to
available memory.  Instead, user may specify values for those parameters.  If
memory is exhausted during indexing, an error message will be printed; it is up
to the user to try new parameters.

    --bmax <int>

The maximum number of suffixes allowed in a block.  Allowing more suffixes per
block makes indexing faster, but increases peak memory usage.  Setting this
option overrides any previous setting for `--bmax`, or `--bmaxdivn`. 
Default (in terms of the `--bmaxdivn` parameter) is `--bmaxdivn` 4.  This is
configured automatically by default; use `-a`/`--noauto` to configure manually.

    --bmaxdivn <int>

The maximum number of suffixes allowed in a block, expressed as a fraction of
the length of the reference.  Setting this option overrides any previous setting
for `--bmax`, or `--bmaxdivn`.  Default: `--bmaxdivn` 4.  This is
configured automatically by default; use `-a`/`--noauto` to configure manually.

    --dcv <int>

Use `<int>` as the period for the difference-cover sample.  A larger period
yields less memory overhead, but may make suffix sorting slower, especially if
repeats are present.  Must be a power of 2 no greater than 4096.  Default: 1024.
 This is configured automatically by default; use `-a`/`--noauto` to configure
manually.

    --nodc

Disable use of the difference-cover sample.  Suffix sorting becomes
quadratic-time in the worst case (where the worst case is an extremely
repetitive reference).  Default: off.

    -r/--noref

Do not build the `NAME.3.ht2` and `NAME.4.ht2` portions of the index, which
contain a bitpacked version of the reference sequences and are used for
paired-end alignment.

    -3/--justref

Build only the `NAME.3.ht2` and `NAME.4.ht2` portions of the index, which
contain a bitpacked version of the reference sequences and are used for
paired-end alignment.

    -o/--offrate <int>

To map alignments back to positions on the reference sequences, it's necessary
to annotate ("mark") some or all of the [Burrows-Wheeler] rows with their
corresponding location on the genome. 
`-o`/`--offrate` governs how many rows get marked:
the indexer will mark every 2^`<int>` rows.  Marking more rows makes
reference-position lookups faster, but requires more memory to hold the
annotations at runtime.  The default is 4 (every 16th row is marked; for human
genome, annotations occupy about 680 megabytes).  

    -t/--ftabchars <int>

The ftab is the lookup table used to calculate an initial [Burrows-Wheeler]
range with respect to the first `<int>` characters of the query.  A larger
`<int>` yields a larger lookup table but faster query times.  The ftab has size
4^(`<int>`+1) bytes.  The default setting is 10 (ftab is 4MB).

    --localoffrate <int>

This option governs how many rows get marked in a local index:
the indexer will mark every 2^`<int>` rows.  Marking more rows makes
reference-position lookups faster, but requires more memory to hold the
annotations at runtime.  The default is 3 (every 8th row is marked,
this occupies about 16KB per local index).  

    --localftabchars <int>

The local ftab is the lookup table in a local index.
The default setting is 6 (ftab is 8KB per local index).

    -p <int>

Launch `NTHREADS` parallel build threads (default: 1).

    --snp <path>

Provide a list of SNPs (in the HISAT2's own format) as follows (five columns).
   
   SNP ID `<tab>` snp type (single, deletion, or insertion) `<tab>` chromosome name `<tab>` zero-offset based genomic position of a SNP `<tab>` alternative base (single), the length of SNP (deletion), or insertion sequence (insertion)
   
   For example,
       rs58784443      single  13      18447947        T

Use `hisat2_extract_snps_haplotypes_UCSC.py` (in the HISAT2 package) to extract SNPs and haplotypes from a dbSNP file (e.g. http://hgdownload.soe.ucsc.edu/goldenPath/hg38/database/snp144Common.txt.gz).
or `hisat2_extract_snps_haplotypes_VCF.py` to extract SNPs and haplotypes from a VCF file (e.g. ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/release/20130502/supporting/GRCh38_positions/ALL.chr22.phase3_shapeit2_mvncall_integrated_v3plus_nounphased.rsID.genotypes.GRCh38_dbSNP_no_SVs.vcf.gz).

    --haplotype <path>

Provide a list of haplotypes (in the HISAT2's own format) as follows (five columns).
   
   Haplotype ID `<tab>` chromosome name `<tab>` zero-offset based left coordinate of haplotype `<tab>` zero-offset based right coordinate of haplotype `<tab>` a comma separated list of SNP ids in the haplotype
   
   For example,
       ht35    13      18446877        18446945        rs12381094,rs12381056,rs192016659,rs538569910

See the above option, --snp, about how to extract haplotypes.  This option is not required, but haplotype information can keep the index construction from exploding and reduce the index size substantially.

    --ss <path>

Note this option should be used with the following --exon option.
Provide a list of splice sites (in the HISAT2's own format) as follows (four columns).
   
   chromosome name `<tab>` zero-offset based genomic position of the flanking base on the left side of an intron `<tab>` zero-offset based genomic position of the flanking base on the right `<tab>` strand

Use `hisat2_extract_splice_sites.py` (in the HISAT2 package) to extract splice sites from a GTF file.

    --exon <path>

Note this option should be used with the above --ss option.
Provide a list of exons (in the HISAT2's own format) as follows (three columns).
   
   chromosome name `<tab>` zero-offset based left genomic position of an exon `<tab>` zero-offset based right genomic position of an exon

Use `hisat2_extract_exons.py` (in the HISAT2 package) to extract exons from a GTF file.

    --seed <int>

Use `<int>` as the seed for pseudo-random number generator.

    --cutoff <int>

Index only the first `<int>` bases of the reference sequences (cumulative across
sequences) and ignore the rest.

    -q/--quiet

`hisat2-build` is verbose by default.  With this option `hisat2-build` will
print only error messages.

    -h/--help

Print usage information and quit.

    --version

Print version information and quit.

The `hisat2-inspect` index inspector
=====================================

`hisat2-inspect` extracts information from a HISAT2 index about what kind of
index it is and what reference sequences were used to build it. When run without
any options, the tool will output a FASTA file containing the sequences of the
original references (with all non-`A`/`C`/`G`/`T` characters converted to `N`s).
 It can also be used to extract just the reference sequence names using the
`-n`/`--names` option or a more verbose summary using the `-s`/`--summary`
option.

Command Line
------------

Usage:

    hisat2-inspect [options]* <ht2_base>

### Main arguments

The basename of the index to be inspected.  The basename is name of any of the
index files but with the `.X.ht2` suffix omitted.
`hisat2-inspect` first looks in the current directory for the index files, then
in the directory specified in the `HISAT2_INDEXES` environment variable.

### Options

    -a/--across <int>

When printing FASTA output, output a newline character every `<int>` bases
(default: 60).

    -n/--names

Print reference sequence names, one per line, and quit.

    -s/--summary

Print a summary that includes information about index settings, as well as the
names and lengths of the input sequences.  The summary has this format: 

    Colorspace	<0 or 1>
    SA-Sample	1 in <sample>
    FTab-Chars	<chars>
    Sequence-1	<name>	<len>
    Sequence-2	<name>	<len>
    ...
    Sequence-N	<name>	<len>

Fields are separated by tabs.  Colorspace is always set to 0 for HISAT2.

    --snp

Print SNPs, and quit.

    --ss

Print splice sites, and quit.

    --ss-all

Print splice sites including those not in the global index, and quit.

    --exon

Print exons, and quit.

    -v/--verbose

Print verbose output (for debugging).

    --version

Print version information and quit.

    -h/--help

Print usage information and quit.

Getting started with HISAT2
===================================================

HISAT2 comes with some example files to get you started.  The example files
are not scientifically significant; these files will simply let you start running HISAT2 and
downstream tools right away.

First follow the manual instructions to [obtain HISAT2].  Set the `HISAT2_HOME`
environment variable to point to the new HISAT2 directory containing the
`hisat2`, `hisat2-build` and `hisat2-inspect` binaries.  This is important,
as the `HISAT2_HOME` variable is used in the commands below to refer to that
directory.

Indexing a reference genome
---------------------------

To create an index for the genomic region (1 million bps from the human chromosome 22 between 20,000,000 and 20,999,999)
included with HISAT2, create a new temporary directory (it doesn't matter where), change into that directory, and run:

    $HISAT2_HOME/hisat2-build $HISAT2_HOME/example/reference/22_20-21M.fa --snp $HISAT2_HOME/example/reference/22_20-21M.snp 22_20-21M_snp

The command should print many lines of output then quit. When the command
completes, the current directory will contain ten new files that all start with
`22_20-21M_snp` and end with `.1.ht2`, `.2.ht2`, `.3.ht2`, `.4.ht2`, `.5.ht2`, `.6.ht2`,
`.7.ht2`, and `.8.ht2`.  These files constitute the index - you're done!

You can use `hisat2-build` to create an index for a set of FASTA files obtained
from any source, including sites such as [UCSC], [NCBI], and [Ensembl]. When
indexing multiple FASTA files, specify all the files using commas to separate
file names.  For more details on how to create an index with `hisat2-build`,
see the [manual section on index building].  You may also want to bypass this
process by obtaining a pre-built index.

[UCSC]: http://genome.ucsc.edu/cgi-bin/hgGateway
[NCBI]: http://www.ncbi.nlm.nih.gov/sites/genome
[Ensembl]: http://www.ensembl.org/

Aligning example reads
----------------------

Stay in the directory created in the previous step, which now contains the
`22_20-21M` index files.  Next, run:

    $HISAT2_HOME/hisat2 -f -x $HISAT2_HOME/example/index/22_20-21M_snp -U $HISAT2_HOME/example/reads/reads_1.fa -S eg1.sam

This runs the HISAT2 aligner, which aligns a set of unpaired reads to the
genome region using the index generated in the previous step.
The alignment results in SAM format are written to the file `eg1.sam`, and a
short alignment summary is written to the console.  (Actually, the summary is
written to the "standard error" or "stderr" filehandle, which is typically
printed to the console.)

To see the first few lines of the SAM output, run:

    head eg1.sam

You will see something like this:

    @HD     VN:1.0  SO:unsorted
    @SQ     SN:22:20000001-21000000 LN:1000000
    @PG     ID:hisat2       PN:hisat2       VN:2.0.0-beta
    1       0       22:20000001-21000000    397984  255     100M    *       0       0       GCCTGTGAGGGAGCCCCGGACCCGGTCAGAGCAGGAGCCTGGCCTGGGGCCAAGTTCACCTTATGGACTCTCTTCCCTGCCCTTCCAGGAGCAGCTCACT    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:100        YT:Z:UU NH:i:1
    2       16      22:20000001-21000000    398131  255     100M    *       0       0       ATGACACACTGTACACACCAGGGGCCCTGTGCTCCCCAGGAAGAGGGCCCTCACTTGAAGCGGGGCCCGATGGCCGCCACGTGCCGGTTCATGCTCCCCT    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:80A19      YT:Z:UU NH:i:1  Zs:Z:80|S|rs576159895
    3       16      22:20000001-21000000    398222  255     100M    *       0       0       TGCTCCCCTTGGCCCCGCCGATGTTCAGGGACATGGAGCGCTGCAGCAGGCTGGAGAAGATCTCCACTTGGTCAGAGCTGCAGTACTTGGCGATCTCAAA    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:16A83      YT:Z:UU NH:i:1  Zs:Z:16|S|rs2629364
    4       16      22:20000001-21000000    398247  255     90M200N10M      *       0       0       CAGGGACATGGAGCGCTGCAGCAGGCTGGAGAAGATCTCCACTTGGTCAGAGCTGCAGTACTTGGCGATCTCAAACCGCTGCACCAGGAAGTCGATCCAG    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:100        YT:Z:UU XS:A:-  NH:i:1
    5       16      22:20000001-21000000    398194  255     100M    *       0       0       GGCCCGATGGCCGCCACGTGCCGGTTCATGCTCCCCTTGGCCCCGCCGATGTTCAGGGACATGGAGCGCTGCAGCAGGCTGGAGAAGATCTCCACTTGGT    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:17A26A55   YT:Z:UU NH:i:1  Zs:Z:17|S|rs576159895,26|S|rs2629364
    6       0       22:20000001-21000000    398069  255     100M    *       0       0       CAGGAGCAGCTCACTGAAATGTGTTCCCCGTCTACAGAAGTACCGTGATACACAGACGCCCCATGACACACTGTACACACCAGGGGCCCTGTGCTCCCCA    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:100        YT:Z:UU NH:i:1
    7       0       22:20000001-21000000    397896  255     100M    *       0       0       GTGGAGTAGATCTTCTCGCGAAGCACATTGCAGATGGTTGCATTTGGAACCACATCGGCATGCAGGAGGGACAGCCCCAGGGTCAGCAGCCTGTGAGGGA    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:31G68      YT:Z:UU NH:i:1  Zs:Z:31|S|rs562662261
    8       0       22:20000001-21000000    398150  255     100M    *       0       0       AGGGGCCCTGTGCTCCCCAGGAAGAGGGCCCTCACTTGAAGCGGGGCCCGATGGCCGCCACGTGCCGGTTCATGCTCCCCTTGGCCCCGCCGATGTTCAG    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:61A26A11   YT:Z:UU NH:i:1  Zs:Z:61|S|rs576159895,26|S|rs2629364
    9       16      22:20000001-21000000    398329  255     8M200N92M       *       0       0       ACCAGGAAGTCGATCCAGATGTAGTGGGGGGTCACTTCGGGGGGACAGGGTTTGGGTTGACTTGCTTCCGAGGCAGCCAGGGGGTCTGCTTCCTTTATCT    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:100        YT:Z:UU XS:A:-  NH:i:1
    10      16      22:20000001-21000000    398184  255     100M    *       0       0       CTTGAAGCGGGGCCCGATGGCCGCCACGTGCCGGTTCATGCTCCCCTTGGCCCCGCCGATGTTCAGGGACATGGAGCGCTGCAGCAGGCTGGAGAAGATC    IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:27A26A45   YT:Z:UU NH:i:1  Zs:Z:27|S|rs576159895,26|S|rs2629364

The first few lines (beginning with `@`) are SAM header lines, and the rest of
the lines are SAM alignments, one line per read or mate.  See the [HISAT2
manual section on SAM output] and the [SAM specification] for details about how
to interpret the SAM file format.

Paired-end example
------------------

To align paired-end reads included with HISAT2, stay in the same directory and
run:

    $HISAT2_HOME/hisat2 -f -x $HISAT2_HOME/example/index/22_20-21M_snp -1 $HISAT2_HOME/example/reads/reads_1.fa -2 $HISAT2_HOME/example/reads/reads_2.fa -S eg2.sam

This aligns a set of paired-end reads to the reference genome, with results
written to the file `eg2.sam`.

Using SAMtools/BCFtools downstream
----------------------------------

[SAMtools] is a collection of tools for manipulating and analyzing SAM and BAM
alignment files.  [BCFtools] is a collection of tools for calling variants and
manipulating VCF and BCF files, and it is typically distributed with [SAMtools].
Using these tools together allows you to get from alignments in SAM format to
variant calls in VCF format.  This example assumes that `samtools` and
`bcftools` are installed and that the directories containing these binaries are
in your [PATH environment variable].

Run the paired-end example:

    $HISAT2_HOME/hisat -f -x $HISAT2_HOME/example/index/22_20-21M_snp -1 $HISAT2_HOME/example/reads/reads_1.fa -2 $HISAT2_HOME/example/reads/reads_2.fa -S eg2.sam

Use `samtools view` to convert the SAM file into a BAM file.  BAM is a the
binary format corresponding to the SAM text format.  Run:

    samtools view -bS eg2.sam > eg2.bam

Use `samtools sort` to convert the BAM file to a sorted BAM file. The following command requires samtools version 1.2 or higher.

    samtools sort eg2.bam -o eg2.sorted.bam

We now have a sorted BAM file called `eg2.sorted.bam`. Sorted BAM is a useful
format because the alignments are (a) compressed, which is convenient for
long-term storage, and (b) sorted, which is convenient for variant discovery.
To generate variant calls in VCF format, run:

    samtools mpileup -uf $HISAT2_HOME/example/reference/22_20-21M.fa eg2.sorted.bam | bcftools view -bvcg - > eg2.raw.bcf

Then to view the variants, run:

    bcftools view eg2.raw.bcf

See the official SAMtools guide to [Calling SNPs/INDELs with SAMtools/BCFtools]
for more details and variations on this process.

[BCFtools]: http://samtools.sourceforge.net/mpileup.shtml
[Calling SNPs/INDELs with SAMtools/BCFtools]: http://samtools.sourceforge.net/mpileup.shtml