1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212 1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251 1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269 1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308 1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326 1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365 1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383 1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418 1419 1420 1421 1422 1423 1424 1425 1426 1427 1428 1429 1430 1431 1432 1433 1434 1435 1436 1437 1438 1439 1440 1441 1442 1443 1444 1445 1446 1447 1448 1449 1450 1451 1452 1453 1454 1455 1456 1457 1458 1459 1460 1461 1462 1463 1464 1465 1466 1467 1468 1469 1470 1471 1472 1473 1474 1475 1476 1477 1478 1479 1480 1481 1482 1483 1484 1485 1486 1487 1488 1489 1490 1491 1492 1493 1494 1495 1496 1497 1498 1499 1500 1501 1502 1503 1504 1505 1506 1507 1508 1509 1510 1511 1512 1513 1514 1515 1516 1517 1518 1519 1520 1521 1522 1523 1524 1525 1526 1527 1528 1529 1530 1531 1532 1533 1534 1535 1536 1537 1538 1539 1540 1541 1542 1543 1544 1545 1546 1547 1548 1549 1550 1551 1552 1553 1554 1555 1556 1557 1558 1559 1560 1561 1562 1563 1564 1565 1566 1567 1568 1569 1570 1571 1572 1573 1574 1575 1576 1577 1578 1579 1580 1581 1582 1583 1584 1585 1586 1587 1588 1589 1590 1591 1592 1593 1594 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606 1607 1608 1609 1610 1611 1612 1613 1614 1615 1616 1617 1618 1619 1620 1621 1622 1623 1624 1625 1626 1627 1628 1629 1630 1631 1632 1633 1634 1635 1636 1637 1638 1639 1640 1641 1642 1643 1644 1645 1646 1647 1648 1649 1650 1651 1652 1653 1654 1655 1656 1657 1658 1659 1660 1661 1662 1663 1664 1665 1666 1667 1668 1669 1670 1671 1672 1673 1674 1675 1676 1677 1678 1679 1680 1681 1682 1683 1684 1685 1686 1687 1688 1689 1690 1691 1692 1693 1694 1695 1696 1697 1698 1699 1700 1701 1702 1703 1704 1705 1706 1707 1708 1709 1710 1711 1712 1713 1714 1715 1716 1717 1718 1719 1720 1721 1722 1723 1724 1725 1726 1727 1728 1729 1730 1731 1732 1733 1734 1735 1736 1737 1738 1739 1740 1741 1742 1743 1744 1745 1746 1747 1748 1749 1750 1751 1752 1753 1754 1755 1756 1757 1758 1759 1760 1761 1762 1763 1764 1765 1766 1767 1768 1769 1770 1771 1772 1773 1774 1775 1776 1777 1778 1779 1780 1781 1782 1783 1784 1785 1786 1787 1788 1789 1790 1791 1792 1793 1794 1795 1796 1797 1798 1799 1800 1801 1802 1803 1804 1805 1806 1807 1808 1809 1810 1811 1812 1813 1814 1815 1816 1817 1818 1819 1820 1821 1822 1823 1824 1825 1826 1827 1828 1829 1830 1831 1832 1833 1834 1835 1836 1837 1838 1839 1840 1841 1842 1843 1844 1845 1846 1847 1848 1849 1850 1851 1852 1853 1854 1855 1856 1857 1858 1859 1860 1861 1862 1863 1864 1865 1866 1867 1868 1869 1870 1871 1872 1873 1874 1875 1876 1877 1878 1879 1880 1881 1882 1883 1884 1885 1886 1887 1888 1889 1890 1891 1892 1893 1894 1895 1896 1897 1898 1899 1900 1901 1902 1903 1904 1905 1906 1907 1908 1909 1910 1911 1912 1913 1914 1915 1916 1917 1918 1919 1920 1921 1922 1923 1924 1925 1926 1927 1928 1929 1930 1931 1932 1933 1934 1935 1936 1937 1938 1939 1940 1941 1942 1943 1944 1945 1946 1947 1948 1949 1950 1951 1952 1953 1954 1955 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 2030 2031 2032 2033 2034 2035 2036 2037 2038 2039 2040 2041 2042 2043 2044 2045 2046 2047 2048 2049 2050 2051 2052 2053 2054 2055 2056 2057 2058 2059 2060 2061 2062 2063 2064 2065 2066 2067 2068 2069 2070 2071 2072 2073 2074 2075 2076 2077 2078 2079 2080 2081 2082 2083 2084 2085 2086 2087 2088 2089 2090 2091 2092 2093 2094 2095 2096 2097 2098 2099 2100 2101 2102 2103 2104 2105 2106 2107 2108 2109 2110 2111 2112 2113 2114 2115 2116 2117 2118 2119 2120 2121 2122 2123 2124 2125 2126 2127 2128 2129 2130 2131 2132 2133 2134 2135 2136 2137 2138 2139 2140 2141 2142 2143 2144 2145 2146 2147 2148 2149 2150 2151 2152 2153 2154 2155 2156 2157 2158 2159 2160 2161 2162 2163 2164 2165 2166 2167 2168 2169 2170 2171 2172 2173 2174 2175 2176 2177 2178 2179 2180 2181 2182 2183 2184 2185 2186 2187 2188 2189 2190 2191 2192 2193 2194 2195 2196 2197 2198 2199 2200 2201 2202 2203 2204 2205 2206 2207 2208 2209 2210 2211 2212 2213 2214 2215 2216 2217 2218 2219 2220 2221 2222 2223 2224 2225 2226 2227 2228 2229 2230 2231 2232 2233 2234 2235 2236 2237 2238 2239 2240 2241 2242 2243 2244 2245 2246 2247 2248 2249 2250 2251 2252 2253 2254 2255 2256 2257 2258 2259 2260 2261 2262 2263 2264 2265 2266 2267 2268 2269 2270 2271 2272 2273 2274 2275 2276 2277 2278 2279 2280 2281 2282 2283 2284 2285 2286 2287 2288 2289 2290 2291 2292 2293 2294 2295 2296 2297 2298 2299 2300 2301 2302 2303 2304 2305 2306 2307 2308 2309 2310 2311 2312 2313 2314 2315 2316 2317 2318 2319 2320 2321 2322 2323 2324 2325 2326 2327 2328 2329 2330 2331 2332 2333 2334 2335 2336 2337 2338 2339 2340 2341 2342 2343 2344 2345 2346 2347 2348 2349 2350 2351 2352 2353 2354 2355 2356 2357 2358 2359 2360 2361 2362 2363 2364 2365 2366 2367 2368 2369 2370 2371 2372 2373 2374 2375 2376 2377 2378 2379 2380 2381 2382 2383 2384 2385 2386 2387 2388 2389 2390 2391 2392 2393 2394 2395 2396 2397 2398 2399 2400 2401 2402 2403 2404 2405 2406 2407 2408 2409 2410 2411 2412 2413 2414 2415 2416 2417 2418 2419 2420 2421 2422 2423 2424 2425 2426 2427 2428 2429 2430 2431 2432 2433 2434 2435 2436 2437 2438 2439 2440 2441 2442 2443 2444 2445 2446 2447 2448 2449 2450 2451 2452 2453 2454 2455 2456 2457 2458 2459 2460 2461 2462 2463 2464 2465 2466 2467 2468 2469 2470 2471 2472 2473 2474 2475 2476 2477 2478 2479 2480 2481 2482 2483 2484 2485 2486 2487 2488 2489 2490 2491 2492 2493 2494 2495 2496 2497 2498 2499 2500 2501 2502 2503 2504 2505 2506 2507 2508 2509 2510 2511 2512 2513 2514 2515 2516 2517 2518 2519 2520 2521 2522 2523 2524 2525 2526 2527 2528 2529 2530 2531 2532 2533 2534 2535 2536 2537 2538 2539 2540 2541 2542 2543 2544 2545 2546 2547 2548 2549 2550 2551 2552 2553 2554 2555 2556 2557 2558 2559 2560 2561 2562 2563 2564 2565 2566 2567 2568 2569 2570 2571 2572 2573 2574 2575 2576 2577 2578 2579 2580 2581 2582 2583 2584 2585 2586 2587 2588 2589 2590 2591 2592 2593 2594 2595 2596 2597 2598 2599 2600 2601 2602 2603 2604 2605 2606 2607 2608 2609 2610 2611 2612 2613 2614 2615 2616 2617 2618 2619 2620 2621 2622 2623 2624 2625 2626 2627 2628 2629 2630 2631 2632 2633 2634 2635 2636 2637 2638 2639 2640 2641 2642 2643 2644 2645 2646 2647 2648 2649 2650 2651 2652 2653 2654 2655 2656 2657 2658 2659 2660 2661 2662 2663 2664 2665 2666 2667 2668 2669 2670 2671 2672 2673 2674 2675 2676 2677 2678 2679 2680 2681 2682 2683 2684 2685 2686 2687 2688 2689 2690 2691 2692 2693 2694 2695 2696 2697 2698 2699 2700 2701 2702 2703 2704 2705 2706 2707 2708 2709 2710 2711 2712 2713 2714 2715 2716 2717 2718 2719 2720 2721 2722 2723 2724 2725 2726 2727 2728 2729 2730 2731 2732 2733 2734 2735 2736 2737 2738 2739 2740 2741 2742 2743 2744 2745 2746 2747 2748 2749 2750 2751 2752 2753 2754 2755 2756 2757 2758 2759 2760 2761 2762 2763 2764 2765 2766 2767 2768 2769 2770 2771 2772 2773 2774 2775 2776 2777 2778 2779 2780 2781 2782 2783 2784 2785 2786 2787 2788 2789 2790 2791 2792 2793 2794 2795 2796 2797 2798 2799 2800 2801 2802 2803 2804 2805 2806 2807 2808 2809 2810 2811 2812 2813 2814 2815 2816 2817 2818 2819 2820 2821 2822 2823 2824 2825 2826 2827 2828 2829 2830 2831 2832 2833 2834 2835 2836 2837 2838 2839 2840 2841 2842 2843 2844 2845 2846 2847 2848 2849 2850 2851 2852 2853 2854 2855 2856 2857 2858 2859 2860 2861 2862 2863 2864 2865 2866 2867 2868 2869 2870 2871 2872 2873 2874 2875 2876 2877 2878 2879 2880 2881 2882 2883 2884 2885 2886 2887 2888 2889 2890 2891 2892 2893 2894 2895 2896 2897 2898 2899 2900 2901 2902 2903 2904 2905 2906 2907 2908 2909 2910 2911 2912 2913 2914 2915 2916 2917 2918 2919 2920 2921 2922 2923 2924 2925 2926 2927 2928 2929 2930 2931 2932 2933 2934 2935 2936 2937 2938 2939 2940 2941 2942 2943 2944 2945 2946 2947 2948 2949 2950 2951 2952 2953 2954 2955 2956 2957 2958 2959 2960 2961 2962 2963 2964 2965 2966 2967 2968 2969 2970 2971 2972 2973 2974 2975 2976 2977 2978 2979 2980 2981 2982 2983 2984 2985 2986 2987 2988 2989 2990 2991 2992 2993 2994 2995 2996 2997 2998 2999 3000 3001 3002 3003 3004 3005 3006 3007 3008 3009 3010 3011 3012 3013 3014 3015 3016 3017 3018 3019 3020 3021 3022 3023 3024 3025 3026 3027 3028 3029 3030 3031 3032 3033 3034 3035 3036 3037 3038 3039 3040 3041 3042 3043 3044 3045 3046 3047 3048 3049 3050 3051 3052 3053 3054 3055 3056 3057 3058 3059 3060 3061 3062 3063 3064 3065 3066 3067 3068 3069 3070 3071 3072 3073 3074 3075 3076 3077 3078 3079 3080 3081 3082 3083 3084 3085 3086 3087 3088 3089 3090 3091 3092 3093 3094 3095 3096 3097 3098 3099 3100 3101 3102 3103 3104 3105 3106 3107 3108 3109 3110 3111 3112 3113 3114 3115 3116 3117 3118 3119 3120 3121 3122 3123 3124 3125 3126 3127 3128 3129 3130 3131 3132 3133 3134 3135 3136 3137 3138 3139 3140 3141 3142 3143 3144 3145 3146 3147 3148 3149 3150 3151 3152 3153 3154 3155 3156 3157 3158 3159 3160 3161 3162 3163 3164 3165 3166 3167 3168 3169 3170 3171 3172 3173 3174 3175 3176 3177 3178 3179 3180 3181 3182 3183 3184 3185 3186 3187 3188 3189 3190 3191 3192 3193 3194 3195 3196 3197 3198 3199 3200 3201 3202 3203 3204 3205 3206 3207 3208 3209 3210 3211 3212 3213 3214 3215 3216 3217 3218 3219 3220 3221 3222 3223 3224 3225 3226 3227 3228 3229 3230 3231 3232 3233 3234 3235 3236 3237 3238 3239 3240 3241 3242 3243 3244 3245 3246 3247 3248 3249 3250 3251 3252 3253 3254 3255 3256 3257 3258 3259 3260 3261 3262 3263 3264 3265 3266 3267 3268 3269 3270 3271 3272 3273 3274 3275 3276 3277 3278 3279 3280 3281 3282 3283 3284 3285 3286 3287 3288 3289 3290 3291 3292 3293 3294 3295 3296 3297 3298 3299 3300 3301 3302 3303 3304 3305 3306 3307 3308 3309 3310 3311 3312 3313 3314 3315 3316 3317 3318 3319 3320 3321 3322 3323 3324 3325 3326 3327 3328 3329 3330 3331 3332 3333 3334 3335 3336 3337 3338 3339 3340 3341 3342 3343 3344 3345 3346 3347 3348 3349 3350 3351 3352 3353 3354 3355 3356 3357 3358 3359 3360 3361 3362 3363 3364 3365 3366 3367 3368 3369 3370 3371 3372 3373 3374 3375 3376 3377 3378 3379 3380 3381 3382 3383 3384 3385 3386 3387 3388 3389 3390 3391 3392 3393 3394 3395 3396 3397 3398 3399 3400 3401 3402 3403 3404 3405 3406 3407 3408 3409 3410 3411 3412 3413 3414 3415 3416 3417 3418 3419 3420 3421 3422 3423 3424 3425 3426 3427 3428 3429 3430 3431 3432 3433 3434 3435 3436 3437 3438 3439 3440 3441 3442 3443 3444 3445 3446 3447 3448 3449 3450 3451 3452 3453 3454 3455 3456 3457 3458 3459 3460 3461 3462 3463 3464 3465 3466 3467 3468 3469 3470 3471 3472 3473 3474 3475 3476 3477 3478 3479 3480 3481 3482 3483 3484 3485 3486 3487 3488 3489 3490 3491 3492 3493 3494 3495 3496 3497 3498 3499 3500 3501 3502 3503 3504 3505 3506 3507 3508 3509 3510 3511 3512 3513 3514 3515 3516 3517 3518 3519 3520 3521 3522 3523 3524 3525 3526 3527 3528 3529 3530 3531 3532 3533 3534 3535 3536 3537 3538 3539 3540 3541 3542 3543 3544 3545 3546 3547 3548 3549 3550 3551 3552 3553 3554 3555 3556 3557 3558 3559 3560 3561 3562 3563 3564 3565 3566 3567 3568 3569 3570 3571 3572 3573 3574 3575 3576 3577 3578 3579 3580 3581 3582 3583 3584 3585 3586 3587 3588 3589 3590 3591 3592 3593 3594 3595 3596 3597 3598 3599 3600 3601 3602 3603 3604 3605 3606 3607 3608 3609 3610 3611 3612 3613 3614 3615 3616 3617 3618 3619 3620 3621 3622 3623 3624 3625 3626 3627 3628 3629 3630 3631 3632 3633 3634 3635 3636 3637 3638 3639 3640 3641 3642 3643 3644 3645 3646 3647 3648 3649 3650 3651 3652 3653 3654 3655 3656 3657 3658 3659 3660 3661 3662 3663 3664 3665 3666 3667 3668 3669 3670 3671 3672 3673 3674 3675 3676 3677 3678 3679 3680 3681 3682 3683 3684 3685 3686 3687 3688 3689 3690 3691 3692 3693 3694 3695 3696 3697 3698 3699 3700 3701 3702 3703 3704 3705 3706 3707 3708 3709 3710 3711 3712 3713 3714 3715 3716 3717 3718 3719 3720 3721 3722 3723 3724 3725 3726 3727 3728 3729 3730 3731 3732 3733 3734 3735 3736 3737 3738 3739 3740 3741 3742 3743 3744 3745 3746 3747 3748 3749 3750 3751 3752 3753 3754 3755 3756 3757 3758 3759 3760 3761 3762 3763 3764 3765 3766 3767 3768 3769 3770 3771 3772 3773 3774 3775 3776 3777 3778 3779 3780 3781 3782 3783 3784 3785 3786 3787 3788 3789 3790 3791 3792 3793 3794 3795 3796 3797 3798 3799 3800 3801 3802 3803 3804 3805 3806 3807 3808 3809 3810 3811 3812 3813 3814 3815 3816 3817 3818 3819 3820 3821 3822 3823 3824 3825 3826 3827 3828 3829 3830 3831 3832 3833 3834 3835 3836 3837 3838 3839 3840 3841 3842 3843 3844 3845 3846 3847 3848 3849 3850 3851 3852 3853 3854 3855 3856 3857 3858 3859 3860 3861 3862 3863 3864 3865 3866 3867 3868 3869 3870 3871 3872 3873 3874 3875 3876 3877 3878 3879 3880 3881 3882 3883 3884 3885 3886 3887 3888 3889 3890 3891 3892 3893 3894 3895 3896 3897 3898 3899 3900 3901 3902 3903 3904 3905 3906 3907 3908 3909 3910 3911 3912 3913 3914 3915 3916 3917 3918 3919 3920 3921 3922 3923 3924 3925 3926 3927 3928 3929 3930 3931 3932 3933 3934 3935 3936 3937 3938 3939 3940 3941 3942 3943 3944 3945 3946 3947 3948 3949 3950 3951 3952 3953 3954 3955 3956 3957 3958 3959 3960 3961 3962 3963 3964 3965 3966 3967 3968 3969 3970 3971 3972 3973 3974 3975 3976 3977 3978 3979 3980 3981 3982 3983 3984 3985 3986 3987 3988 3989 3990 3991 3992 3993 3994 3995 3996 3997 3998 3999 4000 4001 4002 4003 4004 4005 4006 4007 4008 4009 4010 4011 4012 4013 4014 4015 4016 4017 4018 4019 4020 4021 4022 4023 4024 4025 4026 4027 4028 4029 4030 4031 4032 4033 4034 4035 4036 4037 4038 4039 4040 4041 4042 4043 4044 4045 4046 4047 4048 4049 4050 4051 4052 4053 4054 4055 4056 4057 4058 4059 4060 4061 4062 4063 4064 4065 4066 4067 4068 4069 4070 4071 4072 4073 4074 4075 4076 4077 4078 4079 4080 4081 4082 4083 4084 4085 4086 4087 4088 4089 4090 4091 4092 4093 4094 4095 4096 4097 4098 4099 4100 4101 4102 4103 4104 4105 4106 4107 4108 4109 4110 4111 4112 4113 4114 4115 4116 4117 4118 4119 4120 4121 4122 4123 4124 4125 4126 4127 4128 4129 4130 4131 4132 4133 4134 4135 4136 4137 4138 4139 4140 4141 4142 4143 4144 4145 4146 4147 4148 4149 4150 4151 4152 4153 4154 4155 4156 4157 4158 4159 4160 4161 4162 4163 4164 4165 4166 4167 4168 4169 4170 4171 4172 4173 4174 4175 4176 4177 4178 4179 4180 4181 4182 4183 4184 4185 4186 4187 4188 4189 4190 4191 4192 4193 4194 4195 4196 4197 4198 4199 4200 4201 4202 4203 4204 4205 4206 4207 4208 4209 4210 4211 4212 4213 4214 4215 4216 4217 4218 4219 4220 4221 4222 4223 4224 4225 4226 4227 4228 4229 4230 4231 4232 4233 4234 4235 4236 4237 4238 4239 4240 4241 4242 4243 4244 4245 4246 4247 4248 4249 4250 4251 4252 4253 4254 4255 4256 4257 4258 4259 4260 4261 4262 4263 4264 4265 4266 4267 4268 4269 4270 4271 4272 4273 4274 4275 4276 4277 4278 4279 4280 4281 4282 4283 4284 4285 4286 4287 4288 4289 4290 4291
|
/*
* Copyright 2011, Ben Langmead <langmea@cs.jhu.edu>
*
* This file is part of Bowtie 2.
*
* Bowtie 2 is free software: you can redistribute it and/or modify
* it under the terms of the GNU General Public License as published by
* the Free Software Foundation, either version 3 of the License, or
* (at your option) any later version.
*
* Bowtie 2 is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with Bowtie 2. If not, see <http://www.gnu.org/licenses/>.
*/
#ifndef ALIGNER_SEED2_H_
#define ALIGNER_SEED2_H_
/**
* The user of the DescentDriver class specifies a collection of search roots.
* Logic for picking these search roots is located elsewhere, not in this
* module. The search roots are annotated with a priority score, which
*
* The heap is a min-heap over pairs, where the first element of each pair is
* the score associated with a descent and the second element of each pair is
* the descent ID.
*
* Weeding out redundant descents is key; otherwise we end up reporting slight
* variations on the same alignment repeatedly, including variations with poor
* scores. What criteria do we use to determine whether two paths are
* redundant?
*
* Here's an example where the same set of read characters have been aligned in
* all three cases:
*
* Alignment 1 (sc = 0):
* Rd: GCTATATAGCGCGCTCGCATCATTTTGTGT
* ||||||||||||||||||||||||||||||
* Rf: GCTATATAGCGCGCTCGCATCATTTTGTGT
*
* Alignment 2 (sc = -22):
* Rd: GCTATATAGCGCGCTCGCATCATTTTGTGT
* ||||||||||||||||||||||| | |||
* Rf: GCTATATAGCGCGCTCGCATCAT--TTTGT
*
* Alignment 3 (sc = -22):
* Rd: GCTATATAGCGCGCTCGCATCATT--TTGTGT
* |||||||||||||||||||||||| |||||
* Rf: GCTATATAGCGCGCTCGCATCATTTTGTGTGT
*
* Rf from aln 1: GCTATATAGCGCGCTCGCATCATTTTGTGT
* Rf from aln 2: GCTATATAGCGCGCTCGCATCATTTTGT
* Rf from aln 3: GCTATATAGCGCGCTCGCATCATTTTGTGTGT
*
* Are alignments 2 and 3 redundant with alignment 1? We can't totally say
* without knowing the associated SA ranges. Take alignments 1 and 2. Either
* the SA ranges are the same or the SA range for 2 contains the SA range for
* 1. If they're the same, then alignment 2 is redundant with alignment 1.
* Otherwise, *some* of the elements in the SA range for alignment 2 are not
* redundant.
*
* In that example, the same read characters are aligned in all three
* alignments. Is it possible and profitable to consider scenarios where an
* alignment might be redundant with another alignment
*
* Another question is *when* do we try to detect the redundancy? Before we
* try to extend through the matches, or after. After is easier, but less work
* has been avoided.
*
* What data structure do we query to determine whether there's redundancy?
* The situation is harder when we try to detect overlaps between SA ranges
* rather than identical SA ranges. Maybe: read intervals -> intersection tree -> penalties.
*
* 1. If we're introducing a gap and we could have introduced it deeper in the
* descent with the same effect w/r/t homopolymer length.
* 2. If we have Descent A with penalty B and Descent a with penalty b, and A
* aligns read characters [X, Y] to SA range [Z, W], and B aligns read
* characters [x, y] to SA range [z, w], then A is redundant with B if
* [x, y] is within [X, Y].
*
* Found an alignment with total penalty = 3
* GCAATATAGCGCGCTCGCATCATTTTGTGT
* || |||||||||||||||||||||||||||
* GCTATATAGCGCGCTCGCATCATTTTGTGT
*
* Found an alignment with total penalty = 27
* gCAATATAGCGCGCTCGCATCATTTTGTGT
* | ||||||||||||||||||||||||
* TATA-TAGCGCGCTCGCATCATTTTGTGT
*/
#include <stdint.h>
#include <math.h>
#include <utility>
#include <limits>
#include "assert_helpers.h"
#include "random_util.h"
#include "aligner_result.h"
#include "gfm.h"
#include "simple_func.h"
#include "scoring.h"
#include "edit.h"
#include "read.h"
#include "ds.h"
#include "group_walk.h"
#include "btypes.h"
typedef size_t TReadOff;
typedef int64_t TScore;
typedef float TRootPri;
typedef size_t TDescentId;
typedef size_t TRootId;
/**
* enum encapsulating a few different policies for how we might extend descents
* in the direction opposite from their primary direction.
*/
enum {
// Never extened in the direction opposite from the primary. Just go in
// the primary direction until the bounce.
DESC_EX_NONE = 1,
// When we're finished extending out the matches for a descent, try to
// extend in the opposite direction in a way that extends all branches
// simultaneously. The Descent.nex_ field contains the number of positions
// we were able to extend through in this way.
DESC_EX_FROM_1ST_BRANCH = 2,
// Each time we add an edge to the summary, extend it in the opposite
// direction. The DescentEdge.nex field contains the number of positions
// we were able to extend through, and this in turn gets propagated to
// Descent.nex_ if and when we branch from the DescentEdge.
DESC_EX_EACH_EDGE = 3
};
/**
* Counters to keep track of how much work is being done.
*/
struct DescentMetrics {
DescentMetrics() { reset(); }
void reset() {
bwops = bwops_1 = bwops_bi = recalc = branch = branch_mm =
branch_del = branch_ins = heap_max = descent_max = descentpos_max =
nex = 0;
}
uint64_t bwops; // # FM Index opbs
uint64_t bwops_1; // # LF1 FM Index opbs
uint64_t bwops_bi; // # BiEx FM Index opbs
uint64_t recalc; // # times outgoing edge summary was recalculated
uint64_t branch; // # times we descended from another descent
uint64_t branch_mm; // # times branch was on a mismatch
uint64_t branch_del; // # times branch was on a deletion
uint64_t branch_ins; // # times branch was on a insertion
uint64_t heap_max; // maximum size of Descent heap
uint64_t descent_max; // maximum size of Descent factory
uint64_t descentpos_max; // maximum size of DescentPos factory
uint64_t nex; // # extensions
};
/**
* Priority used to rank which descent we should branch from next. Right now,
* priority is governed by a 4-tuple. From higher to lower priority:
*
* 1. Penalty accumulated so far
* 2. Depth into the search space, including extensions
* 3. Width of the SA range (i.e. uniqueness)
* 4. Root priority
*/
struct DescentPriority {
DescentPriority() { reset(); }
DescentPriority(
TScore pen_,
size_t depth_,
TIndexOffU width_,
float rootpri_)
{
pen = pen_;
depth = depth_;
width = width_;
rootpri = rootpri_;
}
/**
* Initialize new DescentPriority.
*/
void init(TScore pen_, size_t depth_, TIndexOffU width_, float rootpri_) {
pen = pen_;
depth = depth_;
width = width_;
rootpri = rootpri_;
}
/**
* Reset to uninitialized state.
*/
void reset() {
width = 0;
}
/**
* Return true iff DescentPriority is initialized.
*/
bool inited() const {
return width > 0;
}
/**
* Return true iff this priority is prior to given priority.
*/
bool operator<(const DescentPriority& o) const {
assert(inited());
assert(o.inited());
// 1st priority: penalty accumulated so far
if(pen < o.pen) return true;
if(pen > o.pen) return false;
// 2nd priority: depth into the search space, including extensions
if(depth > o.depth) return true;
if(depth < o.depth) return false;
// 3rd priority: width of the SA range (i.e. uniqueness)
if(width < o.width) return true;
if(width > o.width) return false;
// 4th priority: root priority
if(rootpri > o.rootpri) return true;
return false;
}
/**
* Return true iff this priority is prior to or equal to given priority.
*/
bool operator<=(const DescentPriority& o) const {
assert(inited());
assert(o.inited());
// 1st priority: penalty accumulated so far
if(pen < o.pen) return true;
if(pen > o.pen) return false;
// 2nd priority: depth into the search space, including extensions
if(depth > o.depth) return true;
if(depth < o.depth) return false;
// 3rd priority: width of the SA range (i.e. uniqueness)
if(width < o.depth) return true;
if(width > o.width) return false;
// 4th priority: root priority
if(rootpri > o.rootpri) return true;
return true;
}
/**
* Return true iff this priority is prior to or equal to given priority.
*/
bool operator==(const DescentPriority& o) const {
assert(inited());
assert(o.inited());
return pen == o.pen && depth == o.depth && width == o.width && rootpri == o.rootpri;
}
TScore pen; // total penalty accumulated so far
size_t depth; // depth from root of descent
TIndexOffU width; // width of the SA range
float rootpri; // priority of the root
};
static inline std::ostream& operator<<(
std::ostream& os,
const DescentPriority& o)
{
os << "[" << o.pen << ", " << o.depth << ", " << o.width << ", " << o.rootpri << "]";
return os;
}
static inline std::ostream& operator<<(
std::ostream& os,
const std::pair<DescentPriority, TDescentId>& o)
{
os << "{[" << o.first.pen << ", " << o.first.depth << ", "
<< o.first.width << ", " << o.first.rootpri << "], " << o.second << "}";
return os;
}
typedef std::pair<DescentPriority, TDescentId> TDescentPair;
/**
* Encapsulates the constraints limiting which outgoing edges are permitted.
* Specifically, we constrain the total penalty accumulated so far so that some
* outgoing edges will exceed the limit and be pruned. The limit is set
* according to our "depth" into the search, as measured by the number of read
* characters aligned so far. We divide the depth domain into two pieces, a
* piece close to the root, where the penty is constrained to be 0, and the
* remainder, where the maximum penalty is an interpolation between 0 and the
* maximum penalty
*/
struct DescentConstraints {
DescentConstraints() { reset(); }
/**
* Initialize with new constraint function.
*/
DescentConstraints(size_t nzero, double exp) {
init(nzero, exp);
}
/**
* Initialize with given function.
*/
void init(size_t nzero_, double exp_) {
nzero = nzero_ > 0 ? nzero_ : 1;
exp = exp_;
#ifndef NDEBUG
for(size_t i = 1; i < nzero_ + 5; i++) {
assert_geq(get(i, nzero_ + 10, 100), get(i-1, nzero_ + 10, 100));
}
#endif
}
/**
* Reset to uninitialized state.
*/
void reset() {
nzero = 0;
exp = -1.0f;
}
/**
* Return true iff the DescentConstraints has been initialized.
*/
bool inited() const {
return exp >= 0.0f;
}
/**
* Get the maximum penalty total for depth 'off'.
*/
inline TScore get(TReadOff off, TReadOff rdlen, TAlScore maxpen) const {
if(off < nzero || nzero >= rdlen) {
return 0;
}
double frac = (double)(off - nzero) / (rdlen - nzero);
if(fabs(exp - 1.0f) > 0.00001) {
if(fabs(exp - 2.0f) < 0.00001) {
frac *= frac;
} else {
frac = pow(frac, exp);
}
}
return (TAlScore)(frac * maxpen + 0.5f);
}
size_t nzero;
double exp;
};
/**
* Encapsulates settings governing how we descent.
*/
struct DescentConfig {
DescentConfig() { reset(); }
/**
* Reset the DescentConfig to an uninitialized state.
*/
void reset() { expol = 0; }
/**
* Return true iff this DescentConfig is initialized.
*/
bool inited() const { return expol != 0; }
DescentConstraints cons; // constraints
int expol; // extend policy
};
/**
* Encapsulates the state of a Descent that allows us to determine whether it
* is redundant with another Descent. Two Descents are redundant if:
*
* 1. Both are aligning the same read orientation (fw or rc)
* 2. Both are growing the alignment in the same direction (left-to-right or
* right-to-left)
* 3. They have aligned exactly the same read characters (which are always
* consecutive in the read)
* 4. The corresponding reference strings are identical
*/
struct DescentRedundancyKey {
DescentRedundancyKey() { reset(); }
DescentRedundancyKey(
TReadOff al5pf_,
size_t rflen_,
TIndexOffU topf_,
TIndexOffU botf_)
{
init(al5pf_, rflen_, topf_, botf_);
}
void reset() {
al5pf = 0;
rflen = 0;
topf = botf = 0;
}
bool inited() const { return rflen > 0; }
void init(
TReadOff al5pf_,
size_t rflen_,
TIndexOffU topf_,
TIndexOffU botf_)
{
al5pf = al5pf_;
rflen = rflen_;
topf = topf_;
botf = botf_;
}
bool operator==(const DescentRedundancyKey& o) const {
return al5pf == o.al5pf && rflen == o.rflen && topf == o.topf && botf == o.botf;
}
bool operator<(const DescentRedundancyKey& o) const {
if(al5pf < o.al5pf) return true;
if(al5pf > o.al5pf) return false;
if(rflen < o.rflen) return true;
if(rflen > o.rflen) return false;
if(topf < o.topf) return true;
if(topf > o.topf) return false;
return botf < o.botf;
}
TReadOff al5pf; // 3'-most aligned char, as offset from 5' end
size_t rflen; // number of reference characters involved in alignment
TIndexOffU topf; // top w/r/t forward index
TIndexOffU botf; // bot w/r/t forward index
};
/**
* Map from pairs to top, bot, penalty triples.
*/
class DescentRedundancyChecker {
public:
DescentRedundancyChecker() { reset(); }
void clear() { reset(); }
/**
* Reset to uninitialized state.
*/
void reset() {
bits_.reset();
inited_ = false;
totsz_ = 0; // total size
totcap_ = 0; // total capacity
}
const static int NPARTS = 8;
const static int PART_MASK = 7;
const static int NBITS = (1 << 16);
/**
* Initialize using given read length.
*/
void init(TReadOff rdlen) {
reset();
// daehwan - for debugging purposes
#if 0
bits_.resize(NBITS);
maplist_fl_.resize(NPARTS);
maplist_fr_.resize(NPARTS);
maplist_rl_.resize(NPARTS);
maplist_rr_.resize(NPARTS);
for(int i = 0; i < NPARTS; i++) {
maplist_fl_[i].resize(rdlen);
maplist_fr_[i].resize(rdlen);
maplist_rl_[i].resize(rdlen);
maplist_rr_[i].resize(rdlen);
totcap_ += maplist_fl_[i].totalCapacityBytes();
totcap_ += maplist_fr_[i].totalCapacityBytes();
totcap_ += maplist_rl_[i].totalCapacityBytes();
totcap_ += maplist_rr_[i].totalCapacityBytes();
for(size_t j = 0; j < rdlen; j++) {
maplist_fl_[i][j].clear();
maplist_fr_[i][j].clear();
maplist_rl_[i][j].clear();
maplist_rr_[i][j].clear();
totcap_ += maplist_fl_[i][j].totalCapacityBytes();
totcap_ += maplist_fr_[i][j].totalCapacityBytes();
totcap_ += maplist_rl_[i][j].totalCapacityBytes();
totcap_ += maplist_rr_[i][j].totalCapacityBytes();
}
}
#endif
inited_ = true;
}
/**
* Return true iff the checker is initialized.
*/
bool inited() const {
return inited_;
}
/**
* Check if this partial alignment is redundant with one that we've already
* explored.
*/
bool check(
bool fw,
bool l2r,
TReadOff al5pi,
TReadOff al5pf,
size_t rflen,
TIndexOffU topf,
TIndexOffU botf,
TScore pen)
{
// daehwan - for debugging purposes
return true;
assert(inited_);
assert(topf > 0 || botf > 0);
DescentRedundancyKey k(al5pf, rflen, topf, botf);
size_t i = std::numeric_limits<size_t>::max();
size_t mask = topf & PART_MASK;
EMap<DescentRedundancyKey, TScore>& map =
(fw ? (l2r ? maplist_fl_[mask][al5pi] : maplist_fr_[mask][al5pi]) :
(l2r ? maplist_rl_[mask][al5pi] : maplist_rr_[mask][al5pi]));
size_t key = (topf & 255) | ((botf & 255) << 8);
if(bits_.test(key) && map.containsEx(k, i)) {
// Already contains the key
assert_lt(i, map.size());
assert_geq(pen, map[i].second);
return false;
}
assert(!map.containsEx(k, i));
size_t oldsz = map.totalSizeBytes();
size_t oldcap = map.totalCapacityBytes();
map.insert(make_pair(k, pen));
bits_.set(key);
totsz_ += (map.totalSizeBytes() - oldsz);
totcap_ += (map.totalCapacityBytes() - oldcap);
return true;
}
/**
* Check if this partial alignment is redundant with one that we've already
* explored using the Bw index SA range.
*/
bool contains(
bool fw,
bool l2r,
TReadOff al5pi,
TReadOff al5pf,
size_t rflen,
TIndexOffU topf,
TIndexOffU botf,
TScore pen)
{
// daehwan - for debugging purposes
return false;
assert(inited_);
size_t key = (topf & 255) | ((botf & 255) << 8);
if(!bits_.test(key)) {
return false;
}
DescentRedundancyKey k(al5pf, rflen, topf, botf);
size_t mask = topf & PART_MASK;
EMap<DescentRedundancyKey, TScore>& map =
(fw ? (l2r ? maplist_fl_[mask][al5pi] : maplist_fr_[mask][al5pi]) :
(l2r ? maplist_rl_[mask][al5pi] : maplist_rr_[mask][al5pi]));
return map.contains(k);
}
/**
* Return the total size of the redundancy map.
*/
size_t totalSizeBytes() const {
return totsz_;
}
/**
* Return the total capacity of the redundancy map.
*/
size_t totalCapacityBytes() const {
return totcap_;
}
protected:
bool inited_; // initialized?
size_t totsz_; // total size
size_t totcap_; // total capacity
// List of maps. Each entry is a map for all the DescentRedundancyKeys
// with al5pi equal to the offset into the list.
ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_fl_; // fw, l2r
ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_rl_; // !fw, l2r
ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_fr_; // fw, !l2r
ELList<EMap<DescentRedundancyKey, TScore>, NPARTS, 100> maplist_rr_; // !fw, !l2r
EBitList<128> bits_;
};
/**
* A search root. Consists of an offset from the 5' end read and flags
* indicating (a) whether we're initially heading left-to-right or
* right-to-left, and (b) whether we're examining the read or its reverse
* complement.
*
* A root also comes with a priority ("pri") score indicating how promising it
* is as a root. Promising roots have long stretches of high-quality,
* non-repetitive nucleotides in the first several ply of the search tree.
* Also, roots beginning at the 5' end of the read may receive a higher
* priority.
*/
struct DescentRoot {
DescentRoot() { reset(); }
DescentRoot(size_t off5p_, bool l2r_, bool fw_, size_t len, float pri_) {
init(off5p_, l2r_, fw_, len, pri_);
}
/**
* Reset this DescentRoot to uninitialized state.
*/
void reset() {
off5p = std::numeric_limits<size_t>::max();
}
/**
* Return true iff this DescentRoot is uninitialized.
*/
bool inited() const {
return off5p == std::numeric_limits<size_t>::max();
}
/**
* Initialize a new descent root.
*/
void init(size_t off5p_, bool l2r_, bool fw_, size_t len, float pri_) {
off5p = off5p_;
l2r = l2r_;
fw = fw_;
pri = pri_;
assert_lt(off5p, len);
}
TReadOff off5p; // root origin offset, expressed as offset from 5' end
bool l2r; // true -> move in left-to-right direction
bool fw; // true -> work with forward read, false -> revcomp
float pri; // priority of seed
};
/**
* Set of flags indicating outgoing edges we've tried from a DescentPos.
*/
struct DescentPosFlags {
DescentPosFlags() { reset(); }
/**
* Set all flags to 1, indicating all outgoing edges are yet to be
* explored.
*/
void reset() {
mm_a = mm_c = mm_g = mm_t = rdg_a = rdg_c = rdg_g = rdg_t = rfg = 1;
reserved = 0;
}
/**
* Return true iff all outgoing edges have already been explored.
*/
bool exhausted() const {
return ((uint16_t*)this)[0] == 0;
}
/**
* Return false iff the specified mismatch has already been explored.
*/
bool mmExplore(int c) {
assert_range(0, 3, c);
if(c == 0) {
return mm_a;
} else if(c == 1) {
return mm_c;
} else if(c == 2) {
return mm_g;
} else {
return mm_t;
}
}
/**
* Try to explore a mismatch. Return false iff it has already been
* explored.
*/
bool mmSet(int c) {
assert_range(0, 3, c);
if(c == 0) {
bool ret = mm_a; mm_a = 0; return ret;
} else if(c == 1) {
bool ret = mm_c; mm_c = 0; return ret;
} else if(c == 2) {
bool ret = mm_g; mm_g = 0; return ret;
} else {
bool ret = mm_t; mm_t = 0; return ret;
}
}
/**
* Return false iff specified read gap has already been explored.
*/
bool rdgExplore(int c) {
assert_range(0, 3, c);
if(c == 0) {
return rdg_a;
} else if(c == 1) {
return rdg_c;
} else if(c == 2) {
return rdg_g;
} else {
return rdg_t;
}
}
/**
* Try to explore a read gap. Return false iff it has already been
* explored.
*/
bool rdgSet(int c) {
assert_range(0, 3, c);
if(c == 0) {
bool ret = rdg_a; rdg_a = 0; return ret;
} else if(c == 1) {
bool ret = rdg_c; rdg_c = 0; return ret;
} else if(c == 2) {
bool ret = rdg_g; rdg_g = 0; return ret;
} else {
bool ret = rdg_t; rdg_t = 0; return ret;
}
}
/**
* Return false iff the reference gap has already been explored.
*/
bool rfgExplore() {
return rfg;
}
/**
* Try to explore a reference gap. Return false iff it has already been
* explored.
*/
bool rfgSet() {
bool ret = rfg; rfg = 0; return ret;
}
uint16_t mm_a : 1;
uint16_t mm_c : 1;
uint16_t mm_g : 1;
uint16_t mm_t : 1;
uint16_t rdg_a : 1;
uint16_t rdg_c : 1;
uint16_t rdg_g : 1;
uint16_t rdg_t : 1;
uint16_t rfg : 1;
uint16_t reserved : 7;
};
/**
* FM Index state associated with a single position in a descent. For both the
* forward and backward indexes, it stores the four SA ranges corresponding to
* the four nucleotides.
*/
struct DescentPos {
/**
* Reset all tops and bots to 0.
*/
void reset() {
topf[0] = topf[1] = topf[2] = topf[3] = 0;
botf[0] = botf[1] = botf[2] = botf[3] = 0;
topb[0] = topb[1] = topb[2] = topb[3] = 0;
botb[0] = botb[1] = botb[2] = botb[3] = 0;
c = -1;
flags.reset();
}
/**
* Return true iff DescentPos has been initialized.
*/
bool inited() const {
return c >= 0;
}
#ifndef NDEBUG
/**
* Check that DescentPos is internally consistent.
*/
bool repOk() const {
assert_range(0, 3, (int)c);
return true;
}
#endif
TIndexOffU topf[4]; // SA range top indexes in fw index
TIndexOffU botf[4]; // SA range bottom indexes (exclusive) in fw index
TIndexOffU topb[4]; // SA range top indexes in bw index
TIndexOffU botb[4]; // SA range bottom indexes (exclusive) in bw index
char c; // read char that would yield match
DescentPosFlags flags; // flags
};
/**
* Encapsulates an edge outgoing from a descent.
*/
struct DescentEdge {
DescentEdge() { reset(); }
DescentEdge(
Edit e_,
TReadOff off5p_,
DescentPriority pri_,
size_t posFlag_,
TReadOff nex_
#ifndef NDEBUG
,
size_t d_,
TIndexOffU topf_,
TIndexOffU botf_,
TIndexOffU topb_,
TIndexOffU botb_
#endif
)
{
init(e_, off5p_, pri_, posFlag_
#ifndef NDEBUG
, d_, topf_, botf_, topb_, botb_
#endif
);
}
/**
* Return true iff edge is initialized.
*/
bool inited() const { return e.inited(); }
/**
* Reset to uninitialized state.
*/
void reset() { e.reset(); }
/**
* Initialize DescentEdge given 5' offset, nucleotide, and priority.
*/
void init(
Edit e_,
TReadOff off5p_,
DescentPriority pri_,
size_t posFlag_
#ifndef NDEBUG
,
size_t d_,
TIndexOffU topf_,
TIndexOffU botf_,
TIndexOffU topb_,
TIndexOffU botb_
#endif
)
{
e = e_;
off5p = off5p_;
pri = pri_;
posFlag = posFlag_;
#ifndef NDEBUG
d = d_;
topf = topf_;
botf = botf_;
topb = topb_;
botb = botb_;
#endif
}
/**
* Update flags to show this edge as visited.
*/
void updateFlags(EFactory<DescentPos>& pf) {
if(inited()) {
if(e.isReadGap()) {
assert_neq('-', e.chr);
pf[posFlag].flags.rdgSet(asc2dna[e.chr]);
} else if(e.isRefGap()) {
pf[posFlag].flags.rfgSet();
} else {
assert_neq('-', e.chr);
pf[posFlag].flags.mmSet(asc2dna[e.chr]);
}
}
}
/**
* Return true iff this edge has higher priority than the given edge.
*/
bool operator<(const DescentEdge& o) const {
if(inited() && !o.inited()) {
return true;
} else if(!inited()) {
return false;
}
return pri < o.pri;
}
DescentPriority pri; // priority of the edge
//TReadOff nex; // # extends possible from this edge
size_t posFlag; // depth of DescentPos where flag should be set
#ifndef NDEBUG
// This can be recreated by looking at the edit, the paren't descent's
// len_, al5pi_, al5pf_. I have it here so we can sanity check.
size_t d;
TIndexOffU topf, botf, topb, botb;
#endif
Edit e;
TReadOff off5p;
};
/**
* Encapsulates an incomplete summary of the outgoing edges from a descent. We
* don't try to store information about all outgoing edges, because doing so
* will generally be wasteful. We'll typically only try a handful of them per
* descent.
*/
class DescentOutgoing {
public:
/**
* Return the best edge and rotate in preparation for next call.
*/
DescentEdge rotate() {
DescentEdge tmp = best1;
assert(!(best2 < tmp));
best1 = best2;
assert(!(best3 < best2));
best2 = best3;
assert(!(best4 < best3));
best3 = best4;
assert(!(best5 < best4));
best4 = best5;
best5.reset();
return tmp;
}
/**
* Given a potental outgoing edge, place it where it belongs in the running
* list of best 5 outgoing edges from this descent.
*/
void update(DescentEdge e) {
if(!best1.inited()) {
best1 = e;
} else if(e < best1) {
best5 = best4;
best4 = best3;
best3 = best2;
best2 = best1;
best1 = e;
} else if(!best2.inited()) {
best2 = e;
} else if(e < best2) {
best5 = best4;
best4 = best3;
best3 = best2;
best2 = e;
} else if(!best3.inited()) {
best3 = e;
} else if(e < best3) {
best5 = best4;
best4 = best3;
best3 = e;
} else if(!best4.inited()) {
best4 = e;
} else if(e < best4) {
best5 = best4;
best4 = e;
} else if(!best5.inited() || e < best5) {
best5 = e;
}
}
/**
* Clear all the outgoing edges stored here.
*/
void clear() {
best1.reset();
best2.reset();
best3.reset();
best4.reset();
best5.reset();
}
/**
* Return true iff there are no outgoing edges currently represented in
* this summary. There may still be outgoing edges, they just haven't
* been added to the summary.
*/
bool empty() const {
return !best1.inited();
}
/**
* Return the DescentPriority of the best outgoing edge.
*/
DescentPriority bestPri() const {
assert(!empty());
return best1.pri;
}
DescentEdge best1; // best
DescentEdge best2; // 2nd-best
DescentEdge best3; // 3rd-best
DescentEdge best4; // 4th-best
DescentEdge best5; // 5th-best
};
template <typename index_t>
class DescentAlignmentSink;
/**
* Encapsulates a descent through a search tree, along a path of matches.
* Descents that are part of the same alignment form a chain. Two aligments
* adjacent in the chain are connected either by an edit, or by a switch in
* direction. Because a descent might have a different direction from the
* DescentRoot it ultimately came from, it has its own 'l2r' field, which might
* differ from the root's.
*/
template <typename index_t>
class Descent {
public:
Descent() { reset(); }
/**
* Initialize a new descent branching from the given descent via the given
* edit. Return false if the Descent has no outgoing edges (and can
* therefore have its memory freed), true otherwise.
*/
bool init(
const Read& q, // query
TRootId rid, // root id
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
TReadOff al5pi, // offset from 5' of 1st aligned char
TReadOff al5pf, // offset from 5' of last aligned char
TIndexOffU topf, // SA range top in FW index
TIndexOffU botf, // SA range bottom in FW index
TIndexOffU topb, // SA range top in BW index
TIndexOffU botb, // SA range bottom in BW index
bool l2r, // direction this descent will go in
size_t descid, // my ID
TDescentId parent, // parent ID
TScore pen, // total penalties so far
const Edit& e, // edit for incoming edge
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
/**
* Initialize a new descent beginning at the given root. Return false if
* the Descent has no outgoing edges (and can therefore have its memory
* freed), true otherwise.
*/
bool init(
const Read& q, // query
TRootId rid, // root id
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
size_t descid, // id of this Descent
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
/**
* Return true iff this Descent has been initialized.
*/
bool inited() const {
return descid_ != std::numeric_limits<size_t>::max();
}
/**
* Reset to uninitialized state.
*/
void reset() {
lastRecalc_ = true;
descid_ = std::numeric_limits<size_t>::max();
}
/**
* Return true iff this Descent is a search root.
*/
bool root() const {
return parent_ == std::numeric_limits<TDescentId>::max();
}
/**
* Return the edit.
*/
const Edit& edit() const {
return edit_;
}
/**
* Return id of parent.
*/
TDescentId parent() const {
return parent_;
}
/**
* Take the best outgoing edge and follow it.
*/
void followBestOutgoing(
const Read& q, // read
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap of descents
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
/**
* Return true iff no outgoing edges from this descent remain unexplored.
*/
bool empty() const { return lastRecalc_ && out_.empty(); }
#ifndef NDEBUG
/**
* Return true iff the Descent is internally consistent.
*/
bool repOk(const Read *q) const {
// A non-root can have an uninitialized edit_ if it is from a bounce
//assert( root() || edit_.inited());
assert(!root() || !edit_.inited());
assert_eq(botf_ - topf_, botb_ - topb_);
if(q != NULL) {
assert_leq(len_, q->length());
}
return true;
}
#endif
size_t al5pi() const { return al5pi_; }
size_t al5pf() const { return al5pf_; }
bool l2r() const { return l2r_; }
/**
* Print a stacked representation of this descent and all its parents. Assumes that
*/
void print(
std::ostream* os,
const char *prefix,
const Read& q,
size_t trimLf,
size_t trimRg,
bool fw,
const EList<Edit>& edits,
size_t ei,
size_t en,
BTDnaString& rf) const;
/**
* Collect all the edits
*/
void collectEdits(
EList<Edit>& edits,
const Edit *e,
EFactory<Descent>& df)
{
// Take just the portion of the read that has aligned up until this
// point
size_t nuninited = 0;
size_t ei = edits.size();
size_t en = 0;
if(e != NULL && e->inited()) {
edits.push_back(*e);
en++;
}
size_t cur = descid_;
while(cur != std::numeric_limits<TDescentId>::max()) {
if(!df[cur].edit().inited()) {
nuninited++;
assert_leq(nuninited, 2);
} else {
edits.push_back(df[cur].edit());
en++;
}
cur = df[cur].parent();
}
// Sort just the edits we just added
edits.sortPortion(ei, en);
}
protected:
/**
*
*/
bool bounce(
const Read& q, // query string
TIndexOffU topf, // SA range top in fw index
TIndexOffU botf, // SA range bottom in fw index
TIndexOffU topb, // SA range top in bw index
TIndexOffU botb, // SA range bottom in bw index
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap of descents
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
/**
* Given the forward and backward indexes, and given topf/botf/topb/botb,
* get tloc, bloc ready for the next step.
*/
void nextLocsBi(
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
SideLocus<index_t>& tloc, // top locus
SideLocus<index_t>& bloc, // bot locus
index_t topf, // top in BWT
index_t botf, // bot in BWT
index_t topb, // top in BWT'
index_t botb); // bot in BWT'
/**
* Advance this descent by following read matches as far as possible.
*/
bool followMatches(
const Read& q, // query string
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm, // per-read metrics
bool& branches, // out: true -> there are > 0 ways to branch
bool& hitEnd, // out: true -> hit read end with non-empty range
bool& done, // out: true -> we made a full alignment
TReadOff& off5p_i, // out: initial 5' offset
TIndexOffU& topf_bounce, // out: top of SA range for fw idx for bounce
TIndexOffU& botf_bounce, // out: bot of SA range for fw idx for bounce
TIndexOffU& topb_bounce, // out: top of SA range for bw idx for bounce
TIndexOffU& botb_bounce); // out: bot of SA range for bw idx for bounce
/**
* Recalculate our summary of the outgoing edges from this descent. When
* deciding what outgoing edges are legal, we abide by constraints.
* Typically, they limit the total of the penalties accumulated so far, as
* a function of distance from the search root. E.g. a constraint might
* disallow any gaps or mismatches within 20 ply of the search root, then
* allow 1 mismatch within 30 ply, then allow up to 1 mismatch or 1 gap
* within 40 ply, etc.
*/
size_t recalcOutgoing(
const Read& q, // query string
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
PerReadMetrics& prm); // per-read metrics
TRootId rid_; // root id
TReadOff al5pi_; // lo offset from 5' end of aligned read char
TReadOff al5pf_; // hi offset from 5' end of aligned read char
bool l2r_; // left-to-right?
int gapadd_; // net ref characters additional
TReadOff off5p_i_; // offset we started out at for this descent
TIndexOffU topf_, botf_; // incoming SA range w/r/t forward index
TIndexOffU topb_, botb_; // incoming SA range w/r/t forward index
size_t descid_; // ID of this descent
TDescentId parent_; // ID of parent descent
TScore pen_; // total penalties accumulated so far
size_t posid_; // ID of 1st elt of the DescentPos factory w/
// descent pos info for this descent
size_t len_; // length of stretch of matches
DescentOutgoing out_; // summary of outgoing edges
Edit edit_; // edit joining this descent with parent
bool lastRecalc_; // set by recalcOutgoing if out edges empty
};
/**
* An alignment result from a Descent.
*/
struct DescentAlignment {
DescentAlignment() { reset(); }
/**
* Reset DescentAlignment to be uninitialized.
*/
void reset() {
topf = botf = 0;
pen = 0;
fw = false;
ei = en = 0;
}
/**
* Initialize this DescentAlignment.
*/
void init(
TScore pen_,
bool fw_,
TIndexOffU topf_,
TIndexOffU botf_,
size_t ei_,
size_t en_)
{
assert_gt(botf_, topf_);
pen = pen_;
fw = fw_;
topf = topf_;
botf = botf_;
ei = ei_;
en = en_;
}
/**
* Return true iff DescentAlignment is initialized.
*/
bool inited() const {
return botf > topf;
}
/**
* Return true iff the alignment is perfect (has no edits)
*/
bool perfect() const {
return pen == 0;
}
/**
* Return the number of elements in this range.
*/
size_t size() const {
return botf - topf;
}
TScore pen; // score
bool fw; // forward or revcomp aligned?
TIndexOffU topf; // top in forward index
TIndexOffU botf; // bot in forward index
size_t ei; // First edit in DescentAlignmentSink::edits_ involved in aln
size_t en; // # edits in DescentAlignmentSink::edits_ involved in aln
};
/**
* A partial alignment result from a Descent where the reference offset has
* been resolved.
*/
struct DescentPartialResolvedAlignment {
DescentPartialResolvedAlignment() { reset(); }
/**
* Reset DescentAlignment to be uninitialized.
*/
void reset() {
topf = botf = 0;
pen = 0;
fw = false;
ei = en = 0;
refcoord.reset();
}
/**
* Initialize this DescentAlignment.
*/
void init(
TScore pen_,
bool fw_,
TIndexOffU topf_,
TIndexOffU botf_,
size_t ei_,
size_t en_,
const Coord& refcoord_)
{
assert_gt(botf_, topf_);
pen = pen_;
fw = fw_;
topf = topf_;
botf = botf_;
ei = ei_;
en = en_;
refcoord = refcoord_;
}
/**
* Return true iff DescentAlignment is initialized.
*/
bool inited() const {
return botf > topf;
}
/**
* Return the number of elements in this range.
*/
size_t size() const {
return botf - topf;
}
TScore pen; // score
bool fw; // forward or revcomp aligned?
TIndexOffU topf; // top in forward index
TIndexOffU botf; // bot in forward index
size_t ei; // First edit in DescentAlignmentSink::edits_ involved in aln
size_t en; // # edits in DescentAlignmentSink::edits_ involved in aln
Coord refcoord; // reference coord of leftmost ref char involved
};
/**
* Class that accepts alignments found during descent and maintains the state
* required to dispense them to consumers in an appropriate order.
*
* As for order in which they are dispensed, in order to maintain uniform
* distribution over equal-scoring alignments, a good policy may be not to
* dispense alignments at a given score stratum until *all* alignments at that
* stratum have been accumulated (i.e. until our best-first search has moved on
* to a worse stratum). This also has the advantage that, for each alignment,
* we can also report the number of other alignments in that cost stratum.
*
* A lazier alternative is to assume that the order in which alignments in a
* given stratum arrive is already pseudo-random, which frees us from having to
* wait until the entire stratum has been explored. But there is reason to
* think that this order is not truly pseudo-random, since our root placement
* and root priorities will tend to first lead us to alignments with certain
* patterns of edits.
*/
template <typename index_t>
class DescentAlignmentSink {
public:
/**
* If this is the final descent in a complete end-to-end alignment, report
* the alignment.
*/
bool reportAlignment(
const Read& q, // query string
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
TIndexOffU topf, // SA range top in forward index
TIndexOffU botf, // SA range bottom in forward index
TIndexOffU topb, // SA range top in backward index
TIndexOffU botb, // SA range bottom in backward index
TDescentId id, // id of leaf Descent
TRootId rid, // id of search root
const Edit& e, // final edit, if needed
TScore pen, // total penalty
EFactory<Descent<index_t> >& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs); // configs
/**
* Reset to uninitialized state.
*/
void reset() {
edits_.clear();
als_.clear();
lhs_.clear();
rhs_.clear();
nelt_ = 0;
bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
}
/**
* Return the total size occupued by the Descent driver and all its
* constituent parts.
*/
size_t totalSizeBytes() const {
return edits_.totalSizeBytes() +
als_.totalSizeBytes() +
lhs_.totalSizeBytes() +
rhs_.totalSizeBytes() +
sizeof(size_t);
}
/**
* Return the total capacity of the Descent driver and all its constituent
* parts.
*/
size_t totalCapacityBytes() const {
return edits_.totalCapacityBytes() +
als_.totalCapacityBytes() +
lhs_.totalCapacityBytes() +
rhs_.totalCapacityBytes() +
sizeof(size_t);
}
/**
* Return the number of SA ranges involved in hits.
*/
size_t nrange() const {
return als_.size();
}
/**
* Return the number of SA elements involved in hits.
*/
size_t nelt() const {
return nelt_;
}
/**
* The caller provides 'i', which is an offset of a particular element in
* one of the SA ranges in the current stratum. This function returns, in
* 'al' and 'off', information about the element in terms of the range it's
* part of and its offset into that range.
*/
void elt(size_t i, DescentAlignment& al, size_t& ri, size_t& off) const {
assert_lt(i, nelt());
for(size_t j = 0; j < als_.size(); j++) {
if(i < als_[j].size()) {
al = als_[j];
ri = j;
off = i;
return;
}
i -= als_[j].size();
}
assert(false);
}
/**
* Get a particular alignment.
*/
const DescentAlignment& operator[](size_t i) const {
return als_[i];
}
/**
* Return true iff (a) we found an alignment since the sink was initialized
* or since the last time advanceStratum() was called, and (b) the penalty
* associated with the current-best task on the heap ('best') is worse
* (higher) than the penalty associated with the alignments found most
* recently (worstPen_).
*/
bool stratumDone(TAlScore bestPen) const {
if(nelt_ > 0 && bestPen > worstPen_) {
return true;
}
return false;
}
/**
* The alignment consumer calls this to indicate that they are done with
* all the alignments in the current best non-empty stratum. We can
* therefore mark all those alignments as "reported" and start collecting
* results for the next stratum.
*/
void advanceStratum() {
assert_gt(nelt_, 0);
edits_.clear();
als_.clear();
// Don't reset lhs_ or rhs_
nelt_ = 0;
bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
}
#ifndef NDEBUG
/**
* Check that alignment sink is internally consistent.
*/
bool repOk() const {
assert_geq(nelt_, als_.size());
for(size_t i = 1; i < als_.size(); i++) {
assert_geq(als_[i].pen, als_[i-1].pen);
}
assert(bestPen_ == std::numeric_limits<TAlScore>::max() || worstPen_ >= bestPen_);
return true;
}
#endif
TAlScore bestPenalty() const { return bestPen_; }
TAlScore worstPenalty() const { return worstPen_; }
size_t editsSize() const { return edits_.size(); }
size_t alsSize() const { return als_.size(); }
size_t lhsSize() const { return lhs_.size(); }
size_t rhsSize() const { return rhs_.size(); }
const EList<Edit>& edits() const { return edits_; }
protected:
EList<Edit> edits_;
EList<DescentAlignment> als_;
ESet<Triple<TIndexOffU, TIndexOffU, size_t> > lhs_;
ESet<Triple<TIndexOffU, TIndexOffU, size_t> > rhs_;
size_t nelt_;
TAlScore bestPen_; // best (smallest) penalty among as-yet-unreported alns
TAlScore worstPen_; // worst (greatest) penalty among as-yet-unreported alns
#ifndef NDEBUG
BTDnaString tmprfdnastr_;
#endif
};
/**
* Class that aggregates partial alignments taken from a snapshot of the
* DescentDriver heap.
*/
class DescentPartialResolvedAlignmentSink {
public:
/**
* Reset to uninitialized state.
*/
void reset() {
edits_.clear();
als_.clear();
nelt_ = 0;
bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
}
/**
* Return the total size occupued by the Descent driver and all its
* constituent parts.
*/
size_t totalSizeBytes() const {
return edits_.totalSizeBytes() +
als_.totalSizeBytes() +
sizeof(size_t);
}
/**
* Return the total capacity of the Descent driver and all its constituent
* parts.
*/
size_t totalCapacityBytes() const {
return edits_.totalCapacityBytes() +
als_.totalCapacityBytes() +
sizeof(size_t);
}
/**
* Return the number of SA ranges involved in hits.
*/
size_t nrange() const {
return als_.size();
}
/**
* Return the number of SA elements involved in hits.
*/
size_t nelt() const {
return nelt_;
}
/**
* The caller provides 'i', which is an offset of a particular element in
* one of the SA ranges in the current stratum. This function returns, in
* 'al' and 'off', information about the element in terms of the range it's
* part of and its offset into that range.
*/
void elt(size_t i, DescentPartialResolvedAlignment& al, size_t& ri, size_t& off) const {
assert_lt(i, nelt());
for(size_t j = 0; j < als_.size(); j++) {
if(i < als_[j].size()) {
al = als_[j];
ri = j;
off = i;
return;
}
i -= als_[j].size();
}
assert(false);
}
/**
* Get a particular alignment.
*/
const DescentPartialResolvedAlignment& operator[](size_t i) const {
return als_[i];
}
/**
* Return true iff (a) we found an alignment since the sink was initialized
* or since the last time advanceStratum() was called, and (b) the penalty
* associated with the current-best task on the heap ('best') is worse
* (higher) than the penalty associated with the alignments found most
* recently (worstPen_).
*/
bool stratumDone(TAlScore bestPen) const {
if(nelt_ > 0 && bestPen > worstPen_) {
return true;
}
return false;
}
/**
* The alignment consumer calls this to indicate that they are done with
* all the alignments in the current best non-empty stratum. We can
* therefore mark all those alignments as "reported" and start collecting
* results for the next stratum.
*/
void advanceStratum() {
assert_gt(nelt_, 0);
edits_.clear();
als_.clear();
nelt_ = 0;
bestPen_ = worstPen_ = std::numeric_limits<TAlScore>::max();
}
#ifndef NDEBUG
/**
* Check that partial alignment sink is internally consistent.
*/
bool repOk() const {
assert_geq(nelt_, als_.size());
//for(size_t i = 1; i < als_.size(); i++) {
// assert_geq(als_[i].pen, als_[i-1].pen);
//}
assert(bestPen_ == std::numeric_limits<TAlScore>::max() || worstPen_ >= bestPen_);
return true;
}
#endif
TAlScore bestPenalty() const { return bestPen_; }
TAlScore worstPenalty() const { return worstPen_; }
size_t editsSize() const { return edits_.size(); }
size_t alsSize() const { return als_.size(); }
const EList<Edit>& edits() const { return edits_; }
protected:
EList<Edit> edits_;
EList<DescentPartialResolvedAlignment> als_;
size_t nelt_;
TAlScore bestPen_; // best (smallest) penalty among as-yet-unreported alns
TAlScore worstPen_; // worst (greatest) penalty among as-yet-unreported alns
};
/**
* Abstract parent for classes that select descent roots and descent
* configurations given information about the read.
*/
class DescentRootSelector {
public:
virtual ~DescentRootSelector() { }
virtual void select(
const Read& q, // read that we're selecting roots for
const Read* qo, // opposite mate, if applicable
bool nofw, // don't add roots for fw read
bool norc, // don't add roots for rc read
EList<DescentConfig>& confs, // put DescentConfigs here
EList<DescentRoot>& roots) = 0; // put DescentRoot here
};
/**
* Encapsulates a set of conditions governing when the DescentDriver should
* stop.
*/
struct DescentStoppingConditions {
DescentStoppingConditions() { reset(); }
DescentStoppingConditions(
size_t totsz_,
size_t nfound_,
bool stra_,
size_t nbwop_)
{
init(totsz_, nfound_, stra_, nbwop_);
}
/**
* Reset to uninitialized state.
*/
void reset() {
totsz = nfound = nbwop = std::numeric_limits<size_t>::max();
stra = false;
assert(!inited());
}
/**
* Initialize this DescentStoppingConditions.
*/
void init(
size_t totsz_,
size_t nfound_,
bool stra_,
size_t nbwop_)
{
totsz = totsz_;
nfound = nfound_;
stra = stra_;
nbwop = nbwop_;
assert(inited());
}
/**
* Return true iff this instance is initialized.
*/
bool inited() const {
return totsz != std::numeric_limits<size_t>::max();
}
size_t totsz; // total size of all the expandable data structures in bytes
size_t nfound; // # alignments found
bool stra; // stop after each non-empty stratum
size_t nbwop; // # Burrows-Wheeler (rank) operations performed
};
enum {
DESCENT_DRIVER_ALN = 1,
DESCENT_DRIVER_STRATA = 2,
DESCENT_DRIVER_MEM = 4,
DESCENT_DRIVER_BWOPS = 8,
DESCENT_DRIVER_DONE = 16
};
/**
* Class responsible for advancing all the descents. The initial descents may
* emanate from several different locations in the read. Note that descents
* may become redundant with each other, and should then be eliminated.
*/
template <typename index_t>
class DescentDriver {
public:
DescentDriver(bool veryVerbose) :
veryVerbose_(veryVerbose)
{
reset();
}
/**
* Initialize driver with respect to a new read. If a DescentRootSelector
* is specified, then it is used to obtain roots as well.
*/
void initRead(
const Read& q,
bool nofw,
bool norc,
TAlScore minsc,
TAlScore maxpen,
const Read* qu = NULL,
DescentRootSelector *sel = NULL)
{
reset();
q_ = q;
minsc_ = minsc;
maxpen_ = maxpen;
if(sel != NULL) {
sel->select(q_, qu, nofw, norc, confs_, roots_);
}
re_.init(q.length());
}
/**
* Add a new search root, which might (a) prefer to move in a left-to-right
* direction, and might (b) be with respect to the read or its reverse
* complement.
*/
void addRoot(
const DescentConfig& conf,
TReadOff off,
bool l2r,
bool fw,
float pri)
{
confs_.push_back(conf);
assert_lt(off, q_.length());
if(l2r && off == q_.length()-1) {
l2r = !l2r;
} else if(!l2r && off == 0) {
l2r = !l2r;
}
roots_.push_back(DescentRoot(off, l2r, fw, q_.length(), pri));
}
/**
* Clear out the DescentRoots currently configured.
*/
void clearRoots() {
confs_.clear();
roots_.clear();
}
/**
* Clear the Descent driver so that we're ready to re-start seed alignment
* for the current read.
*/
void resetRead() {
df_.clear(); // clear Descents
assert_leq(df_.totalSizeBytes(), 100);
pf_.clear(); // clear DescentPoss
assert_leq(pf_.totalSizeBytes(), 100);
heap_.clear(); // clear Heap
assert_leq(heap_.totalSizeBytes(), 100);
roots_.clear(); // clear roots
assert_leq(roots_.totalSizeBytes(), 100);
confs_.clear(); // clear confs
assert_leq(confs_.totalSizeBytes(), 100);
alsink_.reset(); // clear alignment sink
assert_leq(alsink_.totalSizeBytes(), 100);
re_.reset();
assert_leq(re_.totalSizeBytes(), 100);
rootsInited_ = 0; // haven't yet created initial descents
curPen_ = 0; //
}
/**
* Clear the Descent driver so that we're ready to re-start seed alignment
* for the current read.
*/
void reset() {
resetRead();
}
/**
* Perform seed alignment.
*/
void go(
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
/**
* Perform seed alignment until some stopping condition is satisfied.
*/
int advance(
const DescentStoppingConditions& stopc, // stopping conditions
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentMetrics& met, // metrics
PerReadMetrics& prm); // per-read metrics
#ifndef NDEBUG
/**
* Return true iff this DescentDriver is well formed. Throw an assertion
* otherwise.
*/
bool repOk() const {
return true;
}
#endif
/**
* Return the number of end-to-end alignments reported.
*/
size_t numAlignments() const {
return alsink_.nelt();
}
/**
* Return the associated DescentAlignmentSink object.
*/
const DescentAlignmentSink<index_t>& sink() const {
return alsink_;
}
/**
* Return the associated DescentAlignmentSink object.
*/
DescentAlignmentSink<index_t>& sink() {
return alsink_;
}
/**
* Return the total size occupued by the Descent driver and all its
* constituent parts.
*/
size_t totalSizeBytes() const {
return df_.totalSizeBytes() +
pf_.totalSizeBytes() +
heap_.totalSizeBytes() +
roots_.totalSizeBytes() +
confs_.totalSizeBytes() +
alsink_.totalSizeBytes() +
re_.totalSizeBytes();
}
/**
* Return the total capacity of the Descent driver and all its constituent
* parts.
*/
size_t totalCapacityBytes() const {
return df_.totalCapacityBytes() +
pf_.totalCapacityBytes() +
heap_.totalCapacityBytes() +
roots_.totalCapacityBytes() +
confs_.totalCapacityBytes() +
alsink_.totalCapacityBytes() +
re_.totalCapacityBytes();
}
/**
* Return a const ref to the query.
*/
const Read& query() const {
return q_;
}
/**
* Return the minimum score that must be achieved by an alignment in order
* for it to be considered "valid".
*/
TAlScore minScore() const {
return minsc_;
}
protected:
Read q_; // query nucleotide and quality strings
TAlScore minsc_; // minimum score
TAlScore maxpen_; // maximum penalty
EFactory<Descent<index_t> > df_; // factory holding all the Descents, which
// must be referred to by ID
EFactory<DescentPos> pf_; // factory holding all the DescentPoss, which
// must be referred to by ID
EList<DescentRoot> roots_; // search roots
EList<DescentConfig> confs_; // configuration params for each root
size_t rootsInited_; // # initial Descents already created
EHeap<TDescentPair> heap_; // priority queue of Descents
DescentAlignmentSink<index_t> alsink_; // alignment sink
DescentRedundancyChecker re_; // redundancy checker
TAlScore curPen_; // current penalty
bool veryVerbose_; // print lots of partial alignments
EList<Edit> tmpedit_;
BTDnaString tmprfdnastr_;
};
/**
* Selects alignments to report from a complete non-empty stratum of
* alignments stored in the DescentAlignmentSink.
*/
template <typename index_t>
class DescentAlignmentSelector {
public:
DescentAlignmentSelector() : gwstate_(GW_CAT) { reset(); }
/**
* Initialize a new selector w/r/t a DescentAlignmentSink holding a
* non-empty alignment stratum.
*/
void init(
const Read& q,
const DescentAlignmentSink<index_t>& sink,
const GFM<index_t>& gfmFw, // forward Bowtie index for walking left
const BitPairReference& ref, // bitpair-encoded reference
RandomSource& rnd, // pseudo-random generator for sampling rows
WalkMetrics& met)
{
// We're going to sample from space of *alignments*, not ranges. So
// when we extract a sample, we'll have to do a little extra work to
// convert it to a <range, offset> coordinate.
rnd_.init(
sink.nelt(), // # elements to choose from
true); // without replacement
offs_.resize(sink.nelt());
offs_.fill(std::numeric_limits<TIndexOffU>::max());
sas_.resize(sink.nrange());
gws_.resize(sink.nrange());
size_t ei = 0;
for(size_t i = 0; i < sas_.size(); i++) {
size_t en = sink[i].botf - sink[i].topf;
sas_[i].init(sink[i].topf, q.length(), EListSlice<TIndexOffU, 16>(offs_, ei, en));
gws_[i].init(gfmFw, ref, sas_[i], rnd, met);
ei += en;
}
}
/**
* Reset the selector.
*/
void reset() {
rnd_.reset();
}
/**
* Return true iff the selector is currently initialized.
*/
bool inited() const {
return rnd_.size() > 0;
}
/**
* Get next alignment and convert it to an AlnRes.
*/
bool next(
const DescentDriver<index_t>& dr,
const GFM<index_t>& gfmFw, // forward Bowtie index for walking left
const BitPairReference& ref, // bitpair-encoded reference
RandomSource& rnd,
AlnRes& rs,
WalkMetrics& met,
PerReadMetrics& prm)
{
// Sample one alignment randomly from pool of remaining alignments
size_t ri = (size_t)rnd_.next(rnd);
size_t off = 0;
DescentAlignment al;
size_t rangei = 0;
// Convert random alignment index into a <range, offset> coordinate
dr.sink().elt(ri, al, rangei, off);
assert_lt(off, al.size());
Coord refcoord;
WalkResult<index_t> wr;
TIndexOffU tidx = 0, toff = 0, tlen = 0;
gws_[rangei].advanceElement(
(TIndexOffU)off,
gfmFw, // forward Bowtie index for walking left
ref, // bitpair-encoded reference
sas_[rangei], // SA range with offsets
gwstate_, // GroupWalk state; scratch space
wr, // put the result here
met, // metrics
prm); // per-read metrics
assert_neq(OFF_MASK, wr.toff);
bool straddled = false;
gfmFw.joinedToTextOff(
wr.elt.len,
wr.toff,
tidx,
toff,
tlen,
true, // reject straddlers?
straddled); // straddled?
if(tidx == OFF_MASK) {
// The seed hit straddled a reference boundary so the seed
// hit isn't valid
return false;
}
// Coordinate of the seed hit w/r/t the pasted reference string
refcoord.init(tidx, (int64_t)toff, dr.sink()[rangei].fw);
const EList<Edit>& edits = dr.sink().edits();
size_t ns = 0, ngap = 0, nrefn = 0;
for(size_t i = al.ei; i < al.ei + al.en; i++) {
if(edits[i].qchr == 'N' || edits[i].chr == 'N') ns++;
if(edits[i].chr == 'N') nrefn++;
if(edits[i].isGap()) ngap++;
}
AlnScore asc(
-dr.sink().bestPenalty(), // numeric score
ns, // # Ns
ngap); // # gaps
rs.init(
dr.query().length(), // # chars after hard trimming
asc, // alignment score
&dr.sink().edits(), // nucleotide edits array
al.ei, // nucleotide edits first pos
al.en, // nucleotide edits last pos
NULL, // ambig base array
0, // ambig base first pos
0, // ambig base last pos
refcoord, // coord of leftmost aligned char in ref
tlen, // length of reference aligned to
-1, // # seed mms allowed
-1, // seed length
-1, // seed interval
dr.minScore(), // minimum score for valid alignment
-1, // nuc5p (for colorspace)
-1, // nuc3p (for colorspace)
false, // soft pre-trimming?
0, // 5p pre-trimming
0, // 3p pre-trimming
false, // soft trimming?
0, // 5p trimming
0); // 3p trimming
rs.setRefNs(nrefn);
return true;
}
/**
* Return true iff all elements have been reported.
*/
bool done() const {
return rnd_.done();
}
/**
* Return the total size occupued by the Descent driver and all its
* constituent parts.
*/
size_t totalSizeBytes() const {
return rnd_.totalSizeBytes() +
offs_.totalSizeBytes() +
sas_.totalSizeBytes() +
gws_.totalSizeBytes();
}
/**
* Return the total capacity of the Descent driver and all its constituent
* parts.
*/
size_t totalCapacityBytes() const {
return rnd_.totalCapacityBytes() +
offs_.totalCapacityBytes() +
sas_.totalCapacityBytes() +
gws_.totalCapacityBytes();
}
protected:
Random1toN rnd_;
EList<TIndexOffU, 16> offs_;
EList<SARangeWithOffs<EListSlice<TIndexOffU, 16>, index_t> > sas_;
EList<GroupWalk2S<index_t, EListSlice<TIndexOffU, 16>, 16> > gws_;
GroupWalkState<index_t> gwstate_;
};
/**
* Selects and prioritizes partial alignments from the heap of the
* DescentDriver. We assume that the heap is no longer changing (i.e. that the
* DescentDriver is done). Usually, the user will then attempt to extend the
* partial alignments into full alignments. This can happen incrementally;
* that is, the user might ask for the partial alignments one "batch" at a
* time, and the selector will only do as much work is necessary to supply each
* requesteded batch.
*
* The actual work done here includes: (a) scanning the heap for high-priority
* partial alignments, (b) setting up the rnd_, offs_, sas_, gws_, and gwstate_
* fields and resolving offsets of partial alignments, (c) packaging and
* delivering batches of results to the caller.
*
* How to prioritize partial alignments? One idea is to use the same
* penalty-based prioritization used in the heap. This has pros: (a) maintains
* the guarantee that we're visiting alignments in best-to-worst order in
* end-to-end alignment mode, (b) the heap is already prioritized this way, so
* it's easier for us to compile high-priority partial alignments. But the con
* is that it doesn't take depth into account, which could mean that we're
* extending a lot of very short partial alignments first.
*
* A problem we should keep in mind is that some
*/
template <typename index_t>
class DescentPartialAlignmentSelector {
public:
DescentPartialAlignmentSelector() : gwstate_(GW_CAT) { reset(); }
/**
* Initialize a new selector w/r/t a read, index and heap of partial
* alignments.
*/
void init(
const Read& q, // read
const EHeap<TDescentPair>& heap, // the heap w/ the partial alns
TAlScore depthBonus, // use depth when prioritizing
size_t nbatch, // # of alignments in a batch
const GFM<index_t>& gfmFw, // forward Bowtie index for walk-left
const BitPairReference& ref, // bitpair-encoded reference
RandomSource& rnd, // pseudo-randoms for sampling rows
WalkMetrics& met) // metrics re: offset resolution
{
// Make our internal heap
if(depthBonus > 0) {
heap_.clear();
for(size_t i = 0; i < heap.size(); i++) {
TDescentPair p = heap[i];
p.first.pen += depthBonus * p.first.depth;
heap_.insert(p);
}
} else {
heap_ = heap;
}
#if 0
// We're going to sample from space of *alignments*, not ranges. So
// when we extract a sample, we'll have to do a little extra work to
// convert it to a <range, offset> coordinate.
rnd_.init(
sink.nelt(), // # elements to choose from
true); // without replacement
offs_.resize(sink.nelt());
offs_.fill(std::numeric_limits<TIndexOff>::max());
sas_.resize(sink.nrange());
gws_.resize(sink.nrange());
size_t ei = 0;
for(size_t i = 0; i < sas_.size(); i++) {
size_t en = sink[i].botf - sink[i].topf;
sas_[i].init(sink[i].topf, q.length(), EListSlice<TIndexOff, 16>(offs_, ei, en));
gws_[i].init(gfmFw, ref, sas_[i], rnd, met);
ei += en;
}
#endif
}
/**
*
*/
void compileBatch() {
}
/**
* Reset the selector.
*/
void reset() {
heap_.clear();
}
/**
* Return true iff the selector is currently initialized.
*/
bool inited() const {
return !heap_.empty();
}
/**
* Get next alignment and convert it to an AlnRes.
*/
bool next(
const DescentDriver<index_t>& dr,
const GFM<index_t>& gfmFw, // forward Bowtie index for walking left
const BitPairReference& ref, // bitpair-encoded reference
RandomSource& rnd,
AlnRes& rs,
WalkMetrics& met,
PerReadMetrics& prm)
{
// Sample one alignment randomly from pool of remaining alignments
size_t ri = (size_t)rnd_.next(rnd);
size_t off = 0;
DescentAlignment al;
size_t rangei = 0;
// Convert random alignment index into a <range, offset> coordinate
dr.sink().elt(ri, al, rangei, off);
assert_lt(off, al.size());
Coord refcoord;
WalkResult<index_t> wr;
uint32_t tidx = 0, toff = 0, tlen = 0;
gws_[rangei].advanceElement(
(uint32_t)off,
gfmFw, // forward Bowtie index for walking left
ref, // bitpair-encoded reference
sas_[rangei], // SA range with offsets
gwstate_, // GroupWalk state; scratch space
wr, // put the result here
met, // metrics
prm); // per-read metrics
assert_neq(0xffffffff, wr.toff);
bool straddled = false;
gfmFw.joinedToTextOff(
wr.elt.len,
wr.toff,
tidx,
toff,
tlen,
true, // reject straddlers?
straddled); // straddled?
if(tidx == 0xffffffff) {
// The seed hit straddled a reference boundary so the seed
// hit isn't valid
return false;
}
// Coordinate of the seed hit w/r/t the pasted reference string
refcoord.init(tidx, (int64_t)toff, dr.sink()[rangei].fw);
const EList<Edit>& edits = dr.sink().edits();
size_t ns = 0, ngap = 0, nrefn = 0;
for(size_t i = al.ei; i < al.ei + al.en; i++) {
if(edits[i].qchr == 'N' || edits[i].chr == 'N') ns++;
if(edits[i].chr == 'N') nrefn++;
if(edits[i].isGap()) ngap++;
}
return true;
}
/**
* Return true iff all elements have been reported.
*/
bool done() const {
return rnd_.done();
}
/**
* Return the total size occupued by the Descent driver and all its
* constituent parts.
*/
size_t totalSizeBytes() const {
return heap_.totalSizeBytes() +
rnd_.totalSizeBytes() +
offs_.totalSizeBytes() +
sas_.totalSizeBytes() +
gws_.totalSizeBytes();
}
/**
* Return the total capacity of the Descent driver and all its constituent
* parts.
*/
size_t totalCapacityBytes() const {
return heap_.totalCapacityBytes() +
rnd_.totalCapacityBytes() +
offs_.totalCapacityBytes() +
sas_.totalCapacityBytes() +
gws_.totalCapacityBytes();
}
protected:
// This class's working heap. This might simply be a copy of the original
// heap, or it might be re-prioritized in some way.
EHeap<TDescentPair> heap_;
Random1toN rnd_;
EList<TIndexOff, 16> offs_;
EList<SARangeWithOffs<EListSlice<TIndexOff, 16>, index_t> > sas_;
EList<GroupWalk2S<index_t, EListSlice<TIndexOff, 16>, 16> > gws_;
GroupWalkState<index_t> gwstate_;
};
/**
* Drive the process of descending from all search roots.
*/
template <typename index_t>
void DescentDriver<index_t>::go(
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
assert(q_.repOk());
// Convert DescentRoots to the initial Descents
for(size_t i = 0; i < roots_.size(); i++) {
size_t dfsz = df_.size();
size_t pfsz = pf_.size();
TDescentId id = df_.alloc();
Edit e_null;
assert(!e_null.inited());
bool succ = df_[id].init(
q_, // read
i, // root and conf id
sc, // scoring scheme
minsc_, // minimum score
maxpen_, // maximum penalty
id, // new Descent's id
gfmFw, // forward index
gfmBw, // mirror index
re_, // redundancy checker
df_, // Descent factory
pf_, // DescentPos factory
roots_, // DescentRoots
confs_, // DescentConfs
heap_, // heap
alsink_, // alignment sink
met, // metrics
prm); // per-read metrics
if(veryVerbose_) {
bool fw = roots_[i].fw;
tmpedit_.clear();
df_[id].print(
&cerr,
"",
q_,
0,
0,
fw,
tmpedit_,
0,
tmpedit_.size(),
tmprfdnastr_);
}
if(!succ) {
// Reclaim memory we had used for this descent and its DescentPos info
df_.resize(dfsz);
pf_.resize(pfsz);
}
}
// Advance until some stopping condition
bool stop = heap_.empty();
while(!stop) {
// Pop off the highest-priority descent. Note that some outgoing edges
// might have since been explored, which could reduce the priority of
// the descent once we .
TDescentPair p = heap_.pop();
df_.alloc(); df_.pop();
df_[p.second].followBestOutgoing(
q_, // read
gfmFw, // index over text
gfmBw, // index over reverse text
sc, // scoring scheme
minsc_, // minimum score
maxpen_, // maximum penalty
re_, // redundancy checker
df_, // Descent factory
pf_, // DescentPos factory
roots_, //
confs_, //
heap_, // priority queue for Descents
alsink_, // alignment sink
met, // metrics
prm); // per-read metrics
stop = heap_.empty();
}
}
/**
* Perform seed alignment until some stopping condition is satisfied.
*/
template <typename index_t>
int DescentDriver<index_t>::advance(
const DescentStoppingConditions& stopc, // stopping conditions
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
size_t nbwop_i = met.bwops;
while(rootsInited_ < roots_.size()) {
size_t dfsz = df_.size();
size_t pfsz = pf_.size();
TDescentId id = df_.alloc();
Edit e_null;
assert(!e_null.inited());
bool succ = df_[id].init(
q_, // query
rootsInited_, // root and conf id
sc, // scoring scheme
minsc_, // minimum score
maxpen_, // maximum penalty
id, // new Descent's id
gfmFw, // forward index
gfmBw, // mirror index
re_, // redundancy checker
df_, // Descent factory
pf_, // DescentPos factory
roots_, // DescentRoots
confs_, // DescentConfs
heap_, // heap
alsink_, // alignment sink
met, // metrics
prm); // per-read metrics
if(!succ) {
// Reclaim memory we had used for this descent and its DescentPos info
df_.resize(dfsz);
pf_.resize(pfsz);
}
rootsInited_++;
TAlScore best = std::numeric_limits<TAlScore>::max();
if(!heap_.empty()) {
best = heap_.top().first.pen;
}
if(stopc.nfound > 0 && alsink_.nelt() > stopc.nfound) {
return DESCENT_DRIVER_ALN;
}
if(alsink_.stratumDone(best)) {
return DESCENT_DRIVER_STRATA;
}
if(stopc.nbwop > 0 && (met.bwops - nbwop_i) > stopc.nbwop) {
return DESCENT_DRIVER_BWOPS;
}
if(stopc.totsz > 0 && totalSizeBytes() > stopc.totsz) {
return DESCENT_DRIVER_MEM;
}
}
// Advance until some stopping condition
bool stop = heap_.empty();
while(!stop) {
// Pop off the highest-priority descent. Note that some outgoing edges
// might have since been explored, which could reduce the priority of
// the descent once we .
TDescentPair p = heap_.pop();
df_.alloc(); df_.pop();
df_[p.second].followBestOutgoing(
q_,
gfmFw,
gfmBw,
sc,
minsc_, // minimum score
maxpen_, // maximum penalty
re_, // redundancy checker
df_, // Descent factory
pf_, // DescentPos factory
roots_,
confs_,
heap_,
alsink_,
met,
prm); // per-read metrics
TAlScore best = std::numeric_limits<TAlScore>::max();
if(!heap_.empty()) {
best = heap_.top().first.pen;
}
if(stopc.nfound > 0 && alsink_.nelt() > stopc.nfound) {
return DESCENT_DRIVER_ALN;
}
if(alsink_.stratumDone(best)) {
return DESCENT_DRIVER_STRATA;
}
if(stopc.nbwop > 0 && (met.bwops - nbwop_i) > stopc.nbwop) {
return DESCENT_DRIVER_BWOPS;
}
if(stopc.totsz > 0 && totalSizeBytes() > stopc.totsz) {
return DESCENT_DRIVER_MEM;
}
stop = heap_.empty();
}
return DESCENT_DRIVER_DONE;
}
/**
* If this is the final descent in a complete end-to-end alignment, report
* the alignment.
*/
template <typename index_t>
bool DescentAlignmentSink<index_t>::reportAlignment(
const Read& q, // query string
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
TIndexOffU topf, // SA range top in forward index
TIndexOffU botf, // SA range bottom in forward index
TIndexOffU topb, // SA range top in backward index
TIndexOffU botb, // SA range bottom in backward index
TDescentId id, // id of leaf Descent
TRootId rid, // id of search root
const Edit& e, // final edit, if needed
TScore pen, // total penalty
EFactory<Descent<index_t> >& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs) // configs
{
TDescentId cur = id;
ASSERT_ONLY(const Descent<index_t>& desc = df[id]);
const bool fw = rs[rid].fw;
ASSERT_ONLY(size_t len = q.length());
assert(q.repOk());
assert_lt(desc.al5pf(), len);
// Adjust al5pi and al5pf to take the final edit into account (if
// there is one)
// Check if this is redundant with a previous reported alignment
Triple<TIndexOffU, TIndexOffU, size_t> lhs(topf, botf, 0);
Triple<TIndexOffU, TIndexOffU, size_t> rhs(topb, botb, q.length()-1);
if(!lhs_.insert(lhs)) {
rhs_.insert(rhs);
return false; // Already there
}
if(!rhs_.insert(rhs)) {
return false; // Already there
}
size_t ei = edits_.size();
df[cur].collectEdits(edits_, &e, df);
size_t en = edits_.size() - ei;
#ifndef NDEBUG
{
for(size_t i = 1; i < en; i++) {
assert_geq(edits_[ei+i].pos, edits_[ei+i-1].pos);
}
// Now figure out how much we refrained from aligning on either
// side.
size_t trimLf = 0;
size_t trimRg = 0;
BTDnaString& rf = tmprfdnastr_;
rf.clear();
if(!fw) {
// Edit offsets are w/r/t 5' end, but desc.print wants them w/r/t
// the *left* end of the read sequence that aligned
Edit::invertPoss(edits_, len, ei, en, true);
}
desc.print(NULL, "", q, trimLf, trimRg, fw, edits_, ei, en, rf);
if(!fw) {
// Invert them back to how they were before
Edit::invertPoss(edits_, len, ei, en, true);
}
ASSERT_ONLY(TIndexOffU toptmp = 0);
ASSERT_ONLY(TIndexOffU bottmp = 0);
// Check that the edited string occurs in the reference
if(!gfmFw.contains(rf, &toptmp, &bottmp)) {
std::cerr << rf << std::endl;
assert(false);
}
}
#endif
als_.expand();
als_.back().init(pen, fw, topf, botf, ei, en);
nelt_ += (botf - topf);
if(bestPen_ == std::numeric_limits<TAlScore>::max() || pen < bestPen_) {
bestPen_ = pen;
}
if(worstPen_ == std::numeric_limits<TAlScore>::max() || pen > worstPen_) {
worstPen_ = pen;
}
return true;
}
/**
* Initialize a new descent branching from the given descent via the given
* edit. Return false if the Descent has no outgoing edges (and can
* therefore have its memory freed), true otherwise.
*/
template <typename index_t>
bool Descent<index_t>::init(
const Read& q, // query
TRootId rid, // root id
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
TReadOff al5pi, // offset from 5' of 1st aligned char
TReadOff al5pf, // offset from 5' of last aligned char
TIndexOffU topf, // SA range top in FW index
TIndexOffU botf, // SA range bottom in FW index
TIndexOffU topb, // SA range top in BW index
TIndexOffU botb, // SA range bottom in BW index
bool l2r, // direction this descent will go in
size_t descid, // my ID
TDescentId parent, // parent ID
TScore pen, // total penalties so far
const Edit& e, // edit for incoming edge
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent>& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
assert(q.repOk());
rid_ = rid;
al5pi_ = al5pi;
al5pf_ = al5pf;
l2r_ = l2r;
topf_ = topf;
botf_ = botf;
topb_ = topb;
botb_ = botb;
descid_ = descid;
parent_ = parent;
pen_ = pen;
posid_ = std::numeric_limits<size_t>::max();
len_ = 0;
out_.clear();
edit_ = e;
lastRecalc_ = true;
gapadd_ = df[parent].gapadd_;
if(e.inited()) {
if(e.isReadGap()) {
gapadd_++;
} else if(e.isRefGap()) {
gapadd_--;
}
}
bool branches = false, hitEnd = false, done = false;
TIndexOffU topf_new = 0, botf_new = 0, topb_new = 0, botb_new = 0;
off5p_i_ = 0;
#ifndef NDEBUG
size_t depth = al5pf_ - al5pi_ + 1;
TAlScore maxpend = cs[rid_].cons.get(depth, q.length(), maxpen);
assert_geq(maxpend, pen_); // can't have already exceeded max penalty
#endif
bool matchSucc = followMatches(
q,
sc,
gfmFw,
gfmBw,
re,
df,
pf,
rs,
cs,
heap,
alsink,
met,
prm,
branches,
hitEnd,
done,
off5p_i_,
topf_new,
botf_new,
topb_new,
botb_new);
bool bounceSucc = false;
if(matchSucc && hitEnd && !done) {
assert(topf_new > 0 || botf_new > 0);
bounceSucc = bounce(
q,
topf_new,
botf_new,
topb_new,
botb_new,
gfmFw,
gfmBw,
sc,
minsc, // minimum score
maxpen, // maximum penalty
re,
df,
pf,
rs,
cs,
heap,
alsink,
met, // descent metrics
prm); // per-read metrics
}
if(matchSucc) {
// Calculate info about outgoing edges
recalcOutgoing(q, sc, minsc, maxpen, re, pf, rs, cs, prm);
if(!empty()) {
heap.insert(make_pair(out_.bestPri(), descid)); // Add to heap
}
}
return !empty() || bounceSucc;
}
/**
* Initialize a new descent beginning at the given root. Return false if
* the Descent has no outgoing edges (and can therefore have its memory
* freed), true otherwise.
*/
template <typename index_t>
bool Descent<index_t>::init(
const Read& q, // query
TRootId rid, // root id
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
size_t descid, // id of this Descent
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent<index_t> >& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
rid_ = rid;
al5pi_ = rs[rid].off5p;
al5pf_ = rs[rid].off5p;
assert_lt(al5pi_, q.length());
assert_lt(al5pf_, q.length());
l2r_ = rs[rid].l2r;
topf_ = botf_ = topb_ = botb_ = 0;
descid_ = descid;
parent_ = std::numeric_limits<size_t>::max();
pen_ = 0;
posid_ = std::numeric_limits<size_t>::max();
len_ = 0;
out_.clear();
edit_.reset();
lastRecalc_ = true;
gapadd_ = 0;
bool branches = false, hitEnd = false, done = false;
TIndexOffU topf_new = 0, botf_new = 0, topb_new = 0, botb_new = 0;
off5p_i_ = 0;
bool matchSucc = followMatches(
q,
sc,
gfmFw,
gfmBw,
re,
df,
pf,
rs,
cs,
heap,
alsink,
met,
prm,
branches,
hitEnd,
done,
off5p_i_,
topf_new,
botf_new,
topb_new,
botb_new);
bool bounceSucc = false;
if(matchSucc && hitEnd && !done) {
assert(topf_new > 0 || botf_new > 0);
bounceSucc = bounce(
q,
topf_new,
botf_new,
topb_new,
botb_new,
gfmFw,
gfmBw,
sc,
minsc, // minimum score
maxpen, // maximum penalty
re,
df,
pf,
rs,
cs,
heap,
alsink,
met, // descent metrics
prm); // per-read metrics
}
// Calculate info about outgoing edges
assert(empty());
if(matchSucc) {
recalcOutgoing(q, sc, minsc, maxpen, re, pf, rs, cs, prm);
if(!empty()) {
heap.insert(make_pair(out_.bestPri(), descid)); // Add to heap
}
}
return !empty() || bounceSucc;
}
/**
* Recalculate our summary of the outgoing edges from this descent. When
* deciding what outgoing edges are legal, we abide by constraints.
* Typically, they limit the total of the penalties accumulated so far, as
* a function of distance from the search root. E.g. a constraint might
* disallow any gaps or mismatches within 20 ply of the search root, then
* allow 1 mismatch within 30 ply, then allow up to 1 mismatch or 1 gap
* within 40 ply, etc.
*
* Return the total number of valid outgoing edges found.
*
* TODO: Eliminate outgoing gap edges that are redundant with others owing to
* the DNA sequence and the fact that we don't care to distinguish among
* "equivalent" homopolymer extensinos and retractions.
*/
template <typename index_t>
size_t Descent<index_t>::recalcOutgoing(
const Read& q, // query string
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
PerReadMetrics& prm) // per-read metrics
{
assert_eq(botf_ - topf_, botb_ - topb_);
assert(out_.empty());
assert(repOk(&q));
// Get initial 5' and 3' offsets
bool fw = rs[rid_].fw;
float rootpri = rs[rid_].pri;
bool toward3p = (l2r_ == fw);
size_t off5p = off5p_i_;
assert_geq(al5pf_, al5pi_);
size_t off3p = q.length() - off5p - 1;
// By "depth" we essentially mean the number of characters already aligned
size_t depth, extrai = 0, extraf = 0;
size_t cur5pi = al5pi_, cur5pf = al5pf_;
if(toward3p) {
// Toward 3'
cur5pf = off5p;
depth = off5p - al5pi_;
// Failed to match out to the end?
if(al5pf_ < q.length() - 1) {
extraf = 1; // extra
}
} else {
// Toward 5'
cur5pi = off5p;
depth = al5pf_ - off5p;
if(al5pi_ > 0) {
extrai = 1;
}
}
// Get gap penalties
TScore pen_rdg_ex = sc.readGapExtend(), pen_rfg_ex = sc.refGapExtend();
TScore pen_rdg_op = sc.readGapOpen(), pen_rfg_op = sc.refGapOpen();
// Top and bot in the direction of the descent
TIndexOffU top = l2r_ ? topb_ : topf_;
TIndexOffU bot = l2r_ ? botb_ : botf_;
// Top and bot in the opposite direction
TIndexOffU topp = l2r_ ? topf_ : topb_;
TIndexOffU botp = l2r_ ? botf_ : botb_;
assert_eq(botp - topp, bot - top);
DescentEdge edge;
size_t nout = 0;
// Enumerate all outgoing edges, starting at the root and going out
size_t d = posid_;
// At first glance, we might think we should be bounded by al5pi_ and
// al5pf_, but those delimit the positions that matched between reference
// and read. If we hit a position that failed to match as part of
// followMatches, then we also want to evaluate ways of leaving that
// position, which adds one more position to viist.
while(off5p >= al5pi_ - extrai && off5p <= al5pf_ + extraf) {
assert_lt(off5p, q.length());
assert_lt(off3p, q.length());
TScore maxpend = cs[rid_].cons.get(depth, q.length(), maxpen);
assert(depth > 0 || maxpend == 0);
assert_geq(maxpend, pen_); // can't have already exceeded max penalty
TScore diff = maxpend - pen_; // room we have left
// Get pointer to SA ranges in the direction of descent
const TIndexOffU *t = l2r_ ? pf[d].topb : pf[d].topf;
const TIndexOffU *b = l2r_ ? pf[d].botb : pf[d].botf;
const TIndexOffU *tp = l2r_ ? pf[d].topf : pf[d].topb;
const TIndexOffU *bp = l2r_ ? pf[d].botf : pf[d].botb;
assert_eq(pf[d].botf - pf[d].topf, pf[d].botb - pf[d].topb);
// What are the read char / quality?
std::pair<int, int> p = q.get(off5p, fw);
int c = p.first;
assert_range(0, 4, c);
// Only entertain edits if there is at least one type of edit left and
// there is some penalty budget left
if(!pf[d].flags.exhausted() && diff > 0) {
// What would the penalty be if we mismatched at this position?
// This includes the case where the mismatch is for an N in the
// read.
int qq = p.second;
assert_geq(qq, 0);
TScore pen_mm = sc.mm(c, qq);
if(pen_mm <= diff) {
for(int j = 0; j < 4; j++) {
if(j == c) continue; // Match, not mismatch
if(b[j] <= t[j]) {
continue; // No outgoing edge with this nucleotide
}
if(!pf[d].flags.mmExplore(j)) {
continue; // Already been explored
}
TIndexOffU topf = pf[d].topf[j], botf = pf[d].botf[j];
ASSERT_ONLY(TIndexOffU topb = pf[d].topb[j], botb = pf[d].botb[j]);
if(re.contains(fw, l2r_, cur5pi, cur5pf, cur5pf - cur5pi + 1 + gapadd_, topf, botf, pen_ + pen_mm)) {
prm.nRedSkip++;
continue; // Redundant with a path already explored
}
prm.nRedFail++;
TIndexOffU width = b[j] - t[j];
Edit edit((uint32_t)off5p, (int)("ACGTN"[j]), (int)("ACGTN"[c]), EDIT_TYPE_MM);
DescentPriority pri(pen_ + pen_mm, depth, width, rootpri);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
assert_eq(botb - topb, botf - topf);
edge.init(edit, off5p, pri, d
#ifndef NDEBUG
, d, topf, botf, topb, botb
#endif
);
out_.update(edge);
nout++;
}
}
bool gapsAllowed = (off5p >= (size_t)sc.gapbar && off3p >= (size_t)sc.gapbar);
if(gapsAllowed) {
assert_gt(depth, 0);
// An easy redundancy check is: if all ways of proceeding are
// matches, then there's no need to entertain gaps here.
// Shifting the gap one position further downstream is
// guarnteed not to be worse.
size_t totwidth = (b[0] - t[0]) +
(b[1] - t[1]) +
(b[2] - t[2]) +
(b[3] - t[3]);
assert(c > 3 || b[c] - t[c] <= totwidth);
bool allmatch = c < 4 && (totwidth == (b[c] - t[c]));
bool rdex = false, rfex = false;
size_t cur5pi_i = cur5pi, cur5pf_i = cur5pf;
if(toward3p) {
cur5pf_i--;
} else {
cur5pi_i++;
}
if(off5p == off5p_i_ && edit_.inited()) {
// If we're at the root of the descent, and the descent
// branched on a gap, then this could be scored as an
// extension of that gap.
if(pen_rdg_ex <= diff && edit_.isReadGap()) {
// Extension of a read gap
rdex = true;
for(int j = 0; j < 4; j++) {
if(b[j] <= t[j]) {
continue; // No outgoing edge with this nucleotide
}
if(!pf[d].flags.rdgExplore(j)) {
continue; // Already been explored
}
TIndexOffU topf = pf[d].topf[j], botf = pf[d].botf[j];
ASSERT_ONLY(TIndexOffU topb = pf[d].topb[j], botb = pf[d].botb[j]);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
if(re.contains(fw, l2r_, cur5pi_i, cur5pf_i, cur5pf - cur5pi + 1 + gapadd_, topf, botf, pen_ + pen_rdg_ex)) {
prm.nRedSkip++;
continue; // Redundant with a path already explored
}
prm.nRedFail++;
TIndexOffU width = b[j] - t[j];
// off5p holds the offset from the 5' of the next
// character we were trying to align when we decided to
// introduce a read gap (before that character). If we
// were walking toward the 5' end, we need to increment
// by 1.
uint32_t off = (uint32_t)off5p + (toward3p ? 0 : 1);
Edit edit(off, (int)("ACGTN"[j]), '-', EDIT_TYPE_READ_GAP);
assert(edit.pos2 != std::numeric_limits<uint32_t>::max());
edit.pos2 = edit_.pos2 + (toward3p ? 1 : -1);
DescentPriority pri(pen_ + pen_rdg_ex, depth, width, rootpri);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
assert_eq(botb - topb, botf - topf);
edge.init(edit, off5p, pri, d
#ifndef NDEBUG
, d,
topf, botf, topb, botb
#endif
);
out_.update(edge);
nout++;
}
}
if(pen_rfg_ex <= diff && edit_.isRefGap()) {
// Extension of a reference gap
rfex = true;
if(pf[d].flags.rfgExplore()) {
TIndexOffU topf = l2r_ ? topp : top;
TIndexOffU botf = l2r_ ? botp : bot;
ASSERT_ONLY(TIndexOffU topb = l2r_ ? top : topp);
ASSERT_ONLY(TIndexOffU botb = l2r_ ? bot : botp);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
size_t nrefal = cur5pf - cur5pi + gapadd_;
if(!re.contains(fw, l2r_, cur5pi, cur5pf, nrefal, topf, botf, pen_ + pen_rfg_ex)) {
TIndexOffU width = bot - top;
Edit edit((uint32_t)off5p, '-', (int)("ACGTN"[c]), EDIT_TYPE_REF_GAP);
DescentPriority pri(pen_ + pen_rfg_ex, depth, width, rootpri);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
edge.init(edit, off5p, pri, d
#ifndef NDEBUG
// It's a little unclear what the depth ought to be.
// Is it the depth we were at when we did the ref
// gap? I.e. the depth of the flags where rfgExplore()
// returned true? Or is it the depth where we can
// retrieve the appropriate top/bot? We make it the
// latter, might wrap around, indicating we should get
// top/bot from the descent's topf_, ... fields.
, (d == posid_) ? std::numeric_limits<size_t>::max() : (d - 1),
topf, botf, topb, botb
#endif
);
out_.update(edge);
nout++;
prm.nRedFail++;
} else {
prm.nRedSkip++;
}
}
}
}
if(!allmatch && pen_rdg_op <= diff && !rdex) {
// Opening a new read gap
for(int j = 0; j < 4; j++) {
if(b[j] <= t[j]) {
continue; // No outgoing edge with this nucleotide
}
if(!pf[d].flags.rdgExplore(j)) {
continue; // Already been explored
}
TIndexOffU topf = pf[d].topf[j], botf = pf[d].botf[j];
ASSERT_ONLY(TIndexOffU topb = pf[d].topb[j], botb = pf[d].botb[j]);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
if(re.contains(fw, l2r_, cur5pi_i, cur5pf_i, cur5pf - cur5pi + 1 + gapadd_, topf, botf, pen_ + pen_rdg_op)) {
prm.nRedSkip++;
continue; // Redundant with a path already explored
}
prm.nRedFail++;
TIndexOffU width = b[j] - t[j];
// off5p holds the offset from the 5' of the next
// character we were trying to align when we decided to
// introduce a read gap (before that character). If we
// were walking toward the 5' end, we need to increment
// by 1.
uint32_t off = (uint32_t)off5p + (toward3p ? 0 : 1);
Edit edit(off, (int)("ACGTN"[j]), '-', EDIT_TYPE_READ_GAP);
assert(edit.pos2 != std::numeric_limits<uint32_t>::max());
DescentPriority pri(pen_ + pen_rdg_op, depth, width, rootpri);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
assert_eq(botb - topb, botf - topf);
edge.init(edit, off5p, pri, d
#ifndef NDEBUG
, d, topf, botf, topb, botb
#endif
);
out_.update(edge);
nout++;
}
}
if(!allmatch && pen_rfg_op <= diff && !rfex) {
// Opening a new reference gap
if(pf[d].flags.rfgExplore()) {
TIndexOffU topf = l2r_ ? topp : top;
TIndexOffU botf = l2r_ ? botp : bot;
ASSERT_ONLY(TIndexOffU topb = l2r_ ? top : topp);
ASSERT_ONLY(TIndexOffU botb = l2r_ ? bot : botp);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
size_t nrefal = cur5pf - cur5pi + gapadd_;
if(!re.contains(fw, l2r_, cur5pi, cur5pf, nrefal, topf, botf, pen_ + pen_rfg_op)) {
TIndexOffU width = bot - top;
Edit edit((uint32_t)off5p, '-', (int)("ACGTN"[c]), EDIT_TYPE_REF_GAP);
DescentPriority pri(pen_ + pen_rfg_op, depth, width, rootpri);
assert(topf != 0 || botf != 0);
assert(topb != 0 || botb != 0);
edge.init(edit, off5p, pri, d
#ifndef NDEBUG
// It's a little unclear what the depth ought to be.
// Is it the depth we were at when we did the ref
// gap? I.e. the depth of the flags where rfgExplore()
// returned true? Or is it the depth where we can
// retrieve the appropriate top/bot? We make it the
// latter, might wrap around, indicating we should get
// top/bot from the descent's topf_, ... fields.
, (d == posid_) ? std::numeric_limits<size_t>::max() : (d - 1),
topf, botf, topb, botb
#endif
);
out_.update(edge);
nout++;
prm.nRedFail++;
} else {
prm.nRedSkip++;
}
}
}
}
}
// Update off5p, off3p, depth
d++;
depth++;
assert_leq(depth, al5pf_ - al5pi_ + 2);
if(toward3p) {
if(off3p == 0) {
break;
}
off5p++;
off3p--;
cur5pf++;
} else {
if(off5p == 0) {
break;
}
off3p++;
off5p--;
cur5pi--;
}
// Update top and bot
if(off5p >= al5pi_ - extrai && off5p <= al5pf_ + extraf) {
assert_range(0, 3, c);
top = t[c], topp = tp[c];
bot = b[c], botp = bp[c];
assert_eq(bot-top, botp-topp);
}
}
lastRecalc_ = (nout <= 5);
out_.best1.updateFlags(pf);
out_.best2.updateFlags(pf);
out_.best3.updateFlags(pf);
out_.best4.updateFlags(pf);
out_.best5.updateFlags(pf);
return nout;
}
template <typename index_t>
void Descent<index_t>::print(
std::ostream *os,
const char *prefix,
const Read& q,
size_t trimLf,
size_t trimRg,
bool fw,
const EList<Edit>& edits,
size_t ei,
size_t en,
BTDnaString& rf) const
{
const BTDnaString& read = fw ? q.patFw : q.patRc;
size_t eidx = ei;
if(os != NULL) { *os << prefix; }
// Print read
for(size_t i = 0; i < read.length(); i++) {
if(i < trimLf || i >= read.length() - trimRg) {
if(os != NULL) { *os << (char)tolower(read.toChar(i)); }
continue;
}
bool del = false, mm = false;
while(eidx < ei + en && edits[eidx].pos == i) {
if(edits[eidx].isReadGap()) {
if(os != NULL) { *os << '-'; }
} else if(edits[eidx].isRefGap()) {
del = true;
assert_eq((int)edits[eidx].qchr, read.toChar(i));
if(os != NULL) { *os << read.toChar(i); }
} else {
mm = true;
assert(edits[eidx].isMismatch());
assert_eq((int)edits[eidx].qchr, read.toChar(i));
if(os != NULL) { *os << (char)edits[eidx].qchr; }
}
eidx++;
}
if(!del && !mm) {
// Print read character
if(os != NULL) { *os << read.toChar(i); }
}
}
if(os != NULL) {
*os << endl;
*os << prefix;
}
eidx = ei;
// Print match bars
for(size_t i = 0; i < read.length(); i++) {
if(i < trimLf || i >= read.length() - trimRg) {
if(os != NULL) { *os << ' '; }
continue;
}
bool del = false, mm = false;
while(eidx < ei + en && edits[eidx].pos == i) {
if(edits[eidx].isReadGap()) {
if(os != NULL) { *os << ' '; }
} else if(edits[eidx].isRefGap()) {
del = true;
if(os != NULL) { *os << ' '; }
} else {
mm = true;
assert(edits[eidx].isMismatch());
if(os != NULL) { *os << ' '; }
}
eidx++;
}
if(!del && !mm && os != NULL) { *os << '|'; }
}
if(os != NULL) {
*os << endl;
*os << prefix;
}
eidx = ei;
// Print reference
for(size_t i = 0; i < read.length(); i++) {
if(i < trimLf || i >= read.length() - trimRg) {
if(os != NULL) { *os << ' '; }
continue;
}
bool del = false, mm = false;
while(eidx < ei + en && edits[eidx].pos == i) {
if(edits[eidx].isReadGap()) {
rf.appendChar((char)edits[eidx].chr);
if(os != NULL) { *os << (char)edits[eidx].chr; }
} else if(edits[eidx].isRefGap()) {
del = true;
if(os != NULL) { *os << '-'; }
} else {
mm = true;
assert(edits[eidx].isMismatch());
rf.appendChar((char)edits[eidx].chr);
if(os != NULL) { *os << (char)edits[eidx].chr; }
}
eidx++;
}
if(!del && !mm) {
rf.append(read[i]);
if(os != NULL) { *os << read.toChar(i); }
}
}
if(os != NULL) { *os << endl; }
}
/**
* Create a new Descent
*/
template <typename index_t>
bool Descent<index_t>::bounce(
const Read& q, // query string
TIndexOffU topf, // SA range top in fw index
TIndexOffU botf, // SA range bottom in fw index
TIndexOffU topb, // SA range top in bw index
TIndexOffU botb, // SA range bottom in bw index
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent<index_t> >& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap of descents
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
assert_gt(botf, topf);
assert(al5pi_ == 0 || al5pf_ == q.length()-1);
assert(!(al5pi_ == 0 && al5pf_ == q.length()-1));
size_t dfsz = df.size();
size_t pfsz = pf.size();
TDescentId id = df.alloc();
Edit e_null;
assert(!e_null.inited());
// Follow matches
bool succ = df[id].init(
q, // query
rid_, // root id
sc, // scoring scheme
minsc, // minimum score
maxpen, // maximum penalty
al5pi_, // new near-5' extreme
al5pf_, // new far-5' extreme
topf, // SA range top in FW index
botf, // SA range bottom in FW index
topb, // SA range top in BW index
botb, // SA range bottom in BW index
!l2r_, // direction this descent will go in; opposite from parent
id, // my ID
descid_, // parent ID
pen_, // total penalties so far - same as parent
e_null, // edit for incoming edge; uninitialized if bounced
gfmFw, // forward index
gfmBw, // mirror index
re, // redundancy checker
df, // Descent factory
pf, // DescentPos factory
rs, // DescentRoot list
cs, // DescentConfig list
heap, // heap
alsink, // alignment sink
met, // metrics
prm); // per-read metrics
if(!succ) {
// Reclaim memory we had used for this descent and its DescentPos info
df.resize(dfsz);
pf.resize(pfsz);
}
return succ;
}
/**
* Take the best outgoing edge and place it in the heap. When deciding what
* outgoing edges exist, abide by constraints in DescentConfig. These
* constraints limit total penalty accumulated so far versus distance from
* search root. E.g. a constraint might disallow any gaps or mismatches within
* 20 ply of the root, then allow 1 mismatch within 30 ply, 1 mismatch or 1 gap
* within 40 ply, etc.
*/
template <typename index_t>
void Descent<index_t>::followBestOutgoing(
const Read& q, // query string
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
const Scoring& sc, // scoring scheme
TAlScore minsc, // minimum score
TAlScore maxpen, // maximum penalty
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent<index_t> >& df, // factory with Descent
EFactory<DescentPos>& pf, // factory with DescentPoss
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap of descents
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm) // per-read metrics
{
// We assume this descent has been popped off the heap. We'll re-add it if
// it hasn't been exhausted.
assert(q.repOk());
assert(!empty());
assert(!out_.empty());
while(!out_.empty()) {
DescentPriority best = out_.bestPri();
DescentEdge e = out_.rotate();
TReadOff al5pi_new = al5pi_, al5pf_new = al5pf_;
bool fw = rs[rid_].fw;
bool toward3p = (l2r_ == fw);
TReadOff edoff = e.off5p; // 5' offset of edit
assert_leq(edoff, al5pf_ + 1);
assert_geq(edoff + 1, al5pi_);
if(out_.empty()) {
if(!lastRecalc_) {
// This might allocate new Descents
recalcOutgoing(q, sc, minsc, maxpen, re, pf, rs, cs, prm);
if(empty()) {
// Could happen, since some outgoing edges may have become
// redundant in the meantime.
break;
}
} else {
assert(empty());
}
}
TReadOff doff; // edit's offset into this descent
int chr = asc2dna[e.e.chr];
// hitEnd is set to true iff this edit pushes us to the extreme 5' or 3'
// end of the alignment
bool hitEnd = false;
// done is set to true iff this edit aligns the only remaining character of
// the read
bool done = false;
if(toward3p) {
// The 3' extreme of the new Descent is further in (away from the 3'
// end) than the parent's.
al5pf_new = doff = edoff;
if(e.e.isReadGap()) {
// We didn't actually consume the read character at 'edoff', so
// retract al5pf_new by one position. This doesn't effect the
// "depth" (doff) of the SA range we took, though.
assert_gt(al5pf_new, 0);
al5pf_new--;
}
assert_lt(al5pf_new, q.length());
hitEnd = (al5pf_new == q.length() - 1);
done = (hitEnd && al5pi_new == 0);
assert_geq(doff, off5p_i_);
doff = doff - off5p_i_;
assert_leq(doff, len_);
} else {
// The 5' extreme of the new Descent is further in (away from the 5'
// end) than the parent's.
al5pi_new = doff = edoff;
if(e.e.isReadGap()) {
// We didn't actually consume the read character at 'edoff', so
// move al5pi_new closer to the 3' end by one position. This
// doesn't effect the "depth" (doff) of the SA range we took,
// though.
al5pi_new++;
}
hitEnd = (al5pi_new == 0);
done = (hitEnd && al5pf_new == q.length() - 1);
assert_geq(off5p_i_, doff);
doff = off5p_i_ - doff;
assert_leq(doff, len_);
}
// Check if this is redundant with an already-explored path
bool l2r = l2r_; // gets overridden if we bounce
if(!done && hitEnd) {
// Alignment finsihed extending in one direction
l2r = !l2r;
}
size_t dfsz = df.size();
size_t pfsz = pf.size();
TIndexOffU topf, botf, topb, botb;
size_t d = posid_ + doff;
if(e.e.isRefGap()) {
d--; // might underflow
if(doff == 0) {
topf = topf_;
botf = botf_;
topb = topb_;
botb = botb_;
d = std::numeric_limits<size_t>::max();
assert_eq(botf-topf, botb-topb);
} else {
assert_gt(al5pf_new, 0);
assert_gt(d, 0);
chr = pf[d].c;
assert(pf[d].inited());
assert_range(0, 3, chr);
topf = pf[d].topf[chr];
botf = pf[d].botf[chr];
topb = pf[d].topb[chr];
botb = pf[d].botb[chr];
assert_eq(botf-topf, botb-topb);
}
} else {
// A read gap or a mismatch
assert(pf[d].inited());
topf = pf[d].topf[chr];
botf = pf[d].botf[chr];
topb = pf[d].topb[chr];
botb = pf[d].botb[chr];
assert_eq(botf-topf, botb-topb);
}
assert_eq(d, e.d);
assert_eq(topf, e.topf);
assert_eq(botf, e.botf);
assert_eq(topb, e.topb);
assert_eq(botb, e.botb);
if(done) {
// Aligned the entire read end-to-end. Presumably there's no need to
// create a new Descent object. We just report the alignment.
alsink.reportAlignment(
q, // query
gfmFw, // forward index
gfmBw, // backward index
topf, // top of SA range in forward index
botf, // bottom of SA range in forward index
topb, // top of SA range in backward index
botb, // bottom of SA range in backward index
descid_, // Descent at the leaf
rid_, // root id
e.e, // extra edit, if necessary
best.pen, // penalty
df, // factory with Descent
pf, // factory with DescentPoss
rs, // roots
cs); // configs
assert(alsink.repOk());
return;
}
assert(al5pi_new != 0 || al5pf_new != q.length() - 1);
TDescentId id = df.alloc();
bool succ = df[id].init(
q, // query
rid_, // root id
sc, // scoring scheme
minsc, // minimum score
maxpen, // maximum penalty
al5pi_new, // new near-5' extreme
al5pf_new, // new far-5' extreme
topf, // SA range top in FW index
botf, // SA range bottom in FW index
topb, // SA range top in BW index
botb, // SA range bottom in BW index
l2r, // direction this descent will go in
id, // my ID
descid_, // parent ID
best.pen, // total penalties so far
e.e, // edit for incoming edge; uninitialized if bounced
gfmFw, // forward index
gfmBw, // mirror index
re, // redundancy checker
df, // Descent factory
pf, // DescentPos factory
rs, // DescentRoot list
cs, // DescentConfig list
heap, // heap
alsink, // alignment sink
met, // metrics
prm); // per-read metrics
if(!succ) {
// Reclaim memory we had used for this descent and its DescentPos info
df.resize(dfsz);
pf.resize(pfsz);
}
break;
}
if(!empty()) {
// Re-insert this Descent with its new priority
heap.insert(make_pair(out_.bestPri(), descid_));
}
}
/**
* Given the forward and backward indexes, and given topf/botf/topb/botb, get
* tloc, bloc ready for the next step.
*/
template <typename index_t>
void Descent<index_t>::nextLocsBi(
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
SideLocus<index_t>& tloc, // top locus
SideLocus<index_t>& bloc, // bot locus
index_t topf, // top in BWT
index_t botf, // bot in BWT
index_t topb, // top in BWT'
index_t botb) // bot in BWT'
{
assert_gt(botf, 0);
// Which direction are we going in next?
if(l2r_) {
// Left to right; use BWT'
if(botb - topb == 1) {
// Already down to 1 row; just init top locus
tloc.initFromRow(topb, gfmBw.gh(), gfmBw.gfm());
bloc.invalidate();
} else {
SideLocus<index_t>::initFromTopBot(
topb, botb, gfmBw.gh(), gfmBw.gfm(), tloc, bloc);
assert(bloc.valid());
}
} else {
// Right to left; use BWT
if(botf - topf == 1) {
// Already down to 1 row; just init top locus
tloc.initFromRow(topf, gfmFw.gh(), gfmFw.gfm());
bloc.invalidate();
} else {
SideLocus<index_t>::initFromTopBot(
topf, botf, gfmFw.gh(), gfmFw.gfm(), tloc, bloc);
assert(bloc.valid());
}
}
// Check if we should update the tracker with this refinement
assert(botf - topf == 1 || bloc.valid());
assert(botf - topf > 1 || !bloc.valid());
}
/**
* Advance this descent by following read matches as far as possible.
*
* This routine doesn't have to consider the whole gamut of constraints on
* which outgoing edges can be followed. If it is a root descent, it does have
* to know how deep the no-edit constraint goes, though, so we can decide
* whether using the ftab would potentially jump over relevant branch points.
* Apart from that, though, we simply proceed as far as it can go by matching
* characters in the query, irrespective of the constraints.
* recalcOutgoing(...) and followBestOutgoing(...) do have to consider these
* constraints, though.
*
* Conceptually, as we make descending steps, we have:
* 1. Before each step, a single range indicating how we departed the previous
* step
* 2. As part of each step, a quad of ranges indicating what range would result
* if we proceeded on an a, c, g ot t
*
* Return true iff it is possible to branch from this descent. If we haven't
* exceeded the no-branch depth.
*/
template <typename index_t>
bool Descent<index_t>::followMatches(
const Read& q, // query string
const Scoring& sc, // scoring scheme
const GFM<index_t>& gfmFw, // forward index
const GFM<index_t>& gfmBw, // mirror index
DescentRedundancyChecker& re, // redundancy checker
EFactory<Descent<index_t> >& df, // Descent factory
EFactory<DescentPos>& pf, // DescentPos factory
const EList<DescentRoot>& rs, // roots
const EList<DescentConfig>& cs, // configs
EHeap<TDescentPair>& heap, // heap
DescentAlignmentSink<index_t>& alsink, // alignment sink
DescentMetrics& met, // metrics
PerReadMetrics& prm, // per-read metrics
bool& branches, // out: true -> there are > 0 ways to branch
bool& hitEnd, // out: true -> hit read end with non-empty range
bool& done, // out: true -> we made a full alignment
TReadOff& off5p_i, // out: initial 5' offset
TIndexOffU& topf_bounce, // out: top of SA range for fw idx for bounce
TIndexOffU& botf_bounce, // out: bot of SA range for fw idx for bounce
TIndexOffU& topb_bounce, // out: top of SA range for bw idx for bounce
TIndexOffU& botb_bounce) // out: bot of SA range for bw idx for bounce
{
// TODO: make these full-fledged parameters
size_t nobranchDepth = 20;
bool stopOnN = true;
assert(q.repOk());
assert(repOk(&q));
assert_eq(gfmFw.eh().ftabChars(), gfmBw.gh().ftabChars());
#ifndef NDEBUG
for(int i = 0; i < 4; i++) {
assert_eq(gfmFw.fchr()[i], gfmBw.fchr()[i]);
}
#endif
SideLocus<index_t> tloc, bloc;
TIndexOffU topf = topf_, botf = botf_, topb = topb_, botb = botb_;
bool fw = rs[rid_].fw;
bool toward3p;
size_t off5p;
assert_lt(al5pi_, q.length());
assert_lt(al5pf_, q.length());
while(true) {
toward3p = (l2r_ == fw);
assert_geq(al5pf_, al5pi_);
assert(al5pi_ != 0 || al5pf_ != q.length() - 1);
if(toward3p) {
if(al5pf_ == q.length()-1) {
l2r_ = !l2r_;
continue;
}
if(al5pi_ == al5pf_ && root()) {
off5p = off5p_i = al5pi_;
} else {
off5p = off5p_i = (al5pf_ + 1);
}
} else {
if(al5pi_ == 0) {
l2r_ = !l2r_;
continue;
}
assert_gt(al5pi_, 0);
if(al5pi_ == al5pf_ && root()) {
off5p = off5p_i = al5pi_;
} else {
off5p = off5p_i = (al5pi_ - 1);
}
}
break;
}
size_t off3p = q.length() - off5p - 1;
assert_lt(off5p, q.length());
assert_lt(off3p, q.length());
bool firstPos = true;
assert_eq(0, len_);
// Number of times pf.alloc() is called. So we can sanity check it.
size_t nalloc = 0;
// Set to true as soon as we encounter a branch point along this descent.
branches = false;
// hitEnd is set to true iff this edit pushes us to the extreme 5' or 3'
// end of the alignment
hitEnd = false;
// done is set to true iff this edit aligns the only remaining character of
// the read
done = false;
if(root()) {
assert_eq(al5pi_, al5pf_);
// Check whether/how far we can jump using ftab
int ftabLen = gfmFw.gh().ftabChars();
bool ftabFits = true;
if(toward3p && ftabLen + off5p > q.length()) {
ftabFits = false;
} else if(!toward3p && off5p < (size_t)ftabLen) {
ftabFits = false;
}
bool useFtab = ftabLen > 1 && (size_t)ftabLen <= nobranchDepth && ftabFits;
bool ftabFailed = false;
if(useFtab) {
prm.nFtabs++;
// Forward index: right-to-left
size_t off_r2l = fw ? off5p : q.length() - off5p - 1;
if(l2r_) {
//
} else {
assert_geq((int)off_r2l, ftabLen - 1);
off_r2l -= (ftabLen - 1);
}
bool ret = gfmFw.ftabLoHi(fw ? q.patFw : q.patRc, off_r2l,
false, // reverse
topf, botf);
if(!ret) {
// Encountered an N or something else that made it impossible
// to use the ftab
ftabFailed = true;
} else {
if(botf - topf == 0) {
return false;
}
int c_r2l = fw ? q.patFw[off_r2l] : q.patRc[off_r2l];
// Backward index: left-to-right
size_t off_l2r = fw ? off5p : q.length() - off5p - 1;
if(l2r_) {
//
} else {
assert_geq((int)off_l2r, ftabLen - 1);
off_l2r -= (ftabLen - 1);
}
ASSERT_ONLY(bool ret2 = )
gfmBw.ftabLoHi(fw ? q.patFw : q.patRc, off_l2r,
false, // don't reverse
topb, botb);
assert(ret == ret2);
int c_l2r = fw ? q.patFw[off_l2r + ftabLen - 1] :
q.patRc[off_l2r + ftabLen - 1];
assert_eq(botf - topf, botb - topb);
if(toward3p) {
assert_geq((int)off3p, ftabLen - 1);
off5p += ftabLen; off3p -= ftabLen;
} else {
assert_geq((int)off5p, ftabLen - 1);
off5p -= ftabLen; off3p += ftabLen;
}
len_ += ftabLen;
if(toward3p) {
// By convention, al5pf_ and al5pi_ start out equal, so we only
// advance al5pf_ by ftabLen - 1 (not ftabLen)
al5pf_ += (ftabLen - 1); // -1 accounts for inclusive al5pf_
if(al5pf_ == q.length() - 1) {
hitEnd = true;
done = (al5pi_ == 0);
}
} else {
// By convention, al5pf_ and al5pi_ start out equal, so we only
// advance al5pi_ by ftabLen - 1 (not ftabLen)
al5pi_ -= (ftabLen - 1);
if(al5pi_ == 0) {
hitEnd = true;
done = (al5pf_ == q.length()-1);
}
}
// Allocate DescentPos data structures and leave them empty. We
// jumped over them by doing our lookup in the ftab, so we have no
// info about outgoing edges from them, besides the matching
// outgoing edge from the last pos which is in topf/botf and
// topb/botb.
size_t id = 0;
if(firstPos) {
posid_ = pf.alloc();
pf[posid_].reset();
firstPos = false;
for(int i = 1; i < ftabLen; i++) {
id = pf.alloc();
pf[id].reset();
}
} else {
for(int i = 0; i < ftabLen; i++) {
id = pf.alloc();
pf[id].reset();
}
}
assert_eq(botf-topf, botb-topb);
pf[id].c = l2r_ ? c_l2r : c_r2l;
pf[id].topf[l2r_ ? c_l2r : c_r2l] = topf;
pf[id].botf[l2r_ ? c_l2r : c_r2l] = botf;
pf[id].topb[l2r_ ? c_l2r : c_r2l] = topb;
pf[id].botb[l2r_ ? c_l2r : c_r2l] = botb;
assert(pf[id].inited());
nalloc += ftabLen;
}
}
if(!useFtab || ftabFailed) {
// Can't use ftab, use fchr instead
int rdc = q.getc(off5p, fw);
// If rdc is N, that's pretty bad! That means we placed a root
// right on an N. The only thing we can reasonably do is to pick a
// nucleotide at random and proceed.
if(rdc > 3) {
return false;
}
assert_range(0, 3, rdc);
topf = topb = gfmFw.fchr()[rdc];
botf = botb = gfmFw.fchr()[rdc+1];
if(botf - topf == 0) {
return false;
}
if(toward3p) {
off5p++; off3p--;
} else {
off5p--; off3p++;
}
len_++;
if(toward3p) {
if(al5pf_ == q.length()-1) {
hitEnd = true;
done = (al5pi_ == 0);
}
} else {
if(al5pi_ == 0) {
hitEnd = true;
done = (al5pf_ == q.length()-1);
}
}
// Allocate DescentPos data structure. We could fill it with the
// four ranges from fchr if we wanted to, but that will never be
// relevant.
size_t id = 0;
if(firstPos) {
posid_ = id = pf.alloc();
firstPos = false;
} else {
id = pf.alloc();
}
assert_eq(botf-topf, botb-topb);
pf[id].c = rdc;
pf[id].topf[rdc] = topf;
pf[id].botf[rdc] = botf;
pf[id].topb[rdc] = topb;
pf[id].botb[rdc] = botb;
assert(pf[id].inited());
nalloc++;
}
assert_gt(botf, topf);
assert_eq(botf - topf, botb - topb);
// Check if this is redundant with an already-explored path
if(!re.check(fw, l2r_, al5pi_, al5pf_, al5pf_ - al5pi_ + 1 + gapadd_,
topf, botf, pen_))
{
prm.nRedSkip++;
return false;
}
prm.nRedFail++; // not pruned by redundancy list
prm.nRedIns++; // inserted into redundancy list
}
if(done) {
Edit eempty;
alsink.reportAlignment(
q, // query
gfmFw, // forward index
gfmBw, // backward index
topf, // top of SA range in forward index
botf, // bottom of SA range in forward index
topb, // top of SA range in backward index
botb, // bottom of SA range in backward index
descid_, // Descent at the leaf
rid_, // root id
eempty, // extra edit, if necessary
pen_, // penalty
df, // factory with Descent
pf, // factory with DescentPoss
rs, // roots
cs); // configs
assert(alsink.repOk());
return true;
} else if(hitEnd) {
assert(botf > 0 || topf > 0);
assert_gt(botf, topf);
topf_bounce = topf;
botf_bounce = botf;
topb_bounce = topb;
botb_bounce = botb;
return true; // Bounced
}
// We just advanced either ftabLen characters, or 1 character,
// depending on whether we used ftab or fchr.
nextLocsBi(gfmFw, gfmBw, tloc, bloc, topf, botf, topb, botb);
assert(tloc.valid());
assert(botf - topf == 1 || bloc.valid());
assert(botf - topf > 1 || !bloc.valid());
TIndexOffU t[4], b[4]; // dest BW ranges
TIndexOffU tp[4], bp[4]; // dest BW ranges for "prime" index
ASSERT_ONLY(TIndexOff lasttot = botf - topf);
bool fail = false;
while(!fail && !hitEnd) {
assert(!done);
int rdc = q.getc(off5p, fw);
int rdq = q.getq(off5p);
assert_range(0, 4, rdc);
assert_gt(botf, topf);
assert(botf - topf == 1 || bloc.valid());
assert(botf - topf > 1 || !bloc.valid());
assert(tloc.valid());
TIndexOffU width = botf - topf;
bool ltr = l2r_;
const GFM<index_t>& gfm = ltr ? gfmBw : gfmFw;
t[0] = t[1] = t[2] = t[3] = b[0] = b[1] = b[2] = b[3] = 0;
int only = -1; // if we only get 1 non-empty range, this is the char
size_t nopts = 1;
if(bloc.valid()) {
// Set up initial values for the primes
if(ltr) {
tp[0] = tp[1] = tp[2] = tp[3] = topf;
bp[0] = bp[1] = bp[2] = bp[3] = botf;
} else {
tp[0] = tp[1] = tp[2] = tp[3] = topb;
bp[0] = bp[1] = bp[2] = bp[3] = botb;
}
// Range delimited by tloc/bloc has size >1. If size == 1,
// we use a simpler query (see if(!bloc.valid()) blocks below)
met.bwops++;
met.bwops_bi++;
prm.nSdFmops++;
if(prm.doFmString) {
prm.fmString.add(false, pen_, 1);
}
gfm.mapBiLFEx(tloc, bloc, t, b, tp, bp);
// t, b, tp and bp now filled
ASSERT_ONLY(TIndexOffU tot = (b[0]-t[0])+(b[1]-t[1])+(b[2]-t[2])+(b[3]-t[3]));
ASSERT_ONLY(TIndexOffU totp = (bp[0]-tp[0])+(bp[1]-tp[1])+(bp[2]-tp[2])+(bp[3]-tp[3]));
assert_eq(tot, totp);
assert_leq(tot, lasttot);
ASSERT_ONLY(lasttot = tot);
fail = (rdc > 3 || b[rdc] <= t[rdc]);
size_t nopts = 0;
if(b[0] > t[0]) { nopts++; only = 0; }
if(b[1] > t[1]) { nopts++; only = 1; }
if(b[2] > t[2]) { nopts++; only = 2; }
if(b[3] > t[3]) { nopts++; only = 3; }
if(!fail && b[rdc] - t[rdc] < width) {
branches = true;
}
} else {
tp[0] = tp[1] = tp[2] = tp[3] = bp[0] = bp[1] = bp[2] = bp[3] = 0;
// Range delimited by tloc/bloc has size 1
TIndexOffU ntop = ltr ? topb : topf;
met.bwops++;
met.bwops_1++;
prm.nSdFmops++;
if(prm.doFmString) {
prm.fmString.add(false, pen_, 1);
}
int cc = gfm.mapLF1(ntop, tloc);
assert_range(-1, 3, cc);
fail = (cc != rdc);
if(fail) {
branches = true;
}
if(cc >= 0) {
only = cc;
t[cc] = ntop; b[cc] = ntop+1;
tp[cc] = ltr ? topf : topb;
bp[cc] = ltr ? botf : botb;
}
}
// Now figure out what to do with our N.
int origRdc = rdc;
if(rdc == 4) {
fail = true;
} else {
topf = ltr ? tp[rdc] : t[rdc];
botf = ltr ? bp[rdc] : b[rdc];
topb = ltr ? t[rdc] : tp[rdc];
botb = ltr ? b[rdc] : bp[rdc];
assert_eq(botf - topf, botb - topb);
}
// The trouble with !stopOnN is that we don't have a way to store the N
// edits. There could be several per Descent.
if(rdc == 4 && !stopOnN && nopts == 1) {
fail = false;
rdc = only;
int pen = sc.n(rdq);
assert_gt(pen, 0);
pen_ += pen;
}
assert_range(0, 4, origRdc);
assert_range(0, 4, rdc);
// If 'fail' is true, we failed to align this read character. We still
// install the SA ranges into the DescentPos and increment len_ in this
// case.
// Convert t, tp, b, bp info tf, bf, tb, bb
TIndexOffU *tf = ltr ? tp : t;
TIndexOffU *bf = ltr ? bp : b;
TIndexOffU *tb = ltr ? t : tp;
TIndexOffU *bb = ltr ? b : bp;
// Allocate DescentPos data structure.
if(firstPos) {
posid_ = pf.alloc();
firstPos = false;
} else {
pf.alloc();
}
nalloc++;
pf[posid_ + len_].reset();
pf[posid_ + len_].c = origRdc;
for(size_t i = 0; i < 4; i++) {
pf[posid_ + len_].topf[i] = tf[i];
pf[posid_ + len_].botf[i] = bf[i];
pf[posid_ + len_].topb[i] = tb[i];
pf[posid_ + len_].botb[i] = bb[i];
assert_eq(pf[posid_ + len_].botf[i] - pf[posid_ + len_].topf[i],
pf[posid_ + len_].botb[i] - pf[posid_ + len_].topb[i]);
}
if(!fail) {
// Check if this is redundant with an already-explored path
size_t al5pf = al5pf_, al5pi = al5pi_;
if(toward3p) {
al5pf++;
} else {
al5pi--;
}
fail = !re.check(fw, l2r_, al5pi, al5pf,
al5pf - al5pi + 1 + gapadd_, topf, botf, pen_);
if(fail) {
prm.nRedSkip++;
} else {
prm.nRedFail++; // not pruned by redundancy list
prm.nRedIns++; // inserted into redundancy list
}
}
if(!fail) {
len_++;
if(toward3p) {
al5pf_++;
off5p++;
off3p--;
if(al5pf_ == q.length() - 1) {
hitEnd = true;
done = (al5pi_ == 0);
}
} else {
assert_gt(al5pi_, 0);
al5pi_--;
off5p--;
off3p++;
if(al5pi_ == 0) {
hitEnd = true;
done = (al5pf_ == q.length() - 1);
}
}
}
if(!fail && !hitEnd) {
nextLocsBi(gfmFw, gfmBw, tloc, bloc, tf[rdc], bf[rdc], tb[rdc], bb[rdc]);
}
}
assert_geq(al5pf_, al5pi_);
assert(!root() || al5pf_ - al5pi_ + 1 == nalloc || al5pf_ - al5pi_ + 2 == nalloc);
assert_geq(pf.size(), nalloc);
if(done) {
Edit eempty;
alsink.reportAlignment(
q, // query
gfmFw, // forward index
gfmBw, // backward index
topf, // top of SA range in forward index
botf, // bottom of SA range in forward index
topb, // top of SA range in backward index
botb, // bottom of SA range in backward index
descid_, // Descent at the leaf
rid_, // root id
eempty, // extra edit, if necessary
pen_, // penalty
df, // factory with Descent
pf, // factory with DescentPoss
rs, // roots
cs); // configs
assert(alsink.repOk());
return true;
} else if(hitEnd) {
assert(botf > 0 || topf > 0);
assert_gt(botf, topf);
topf_bounce = topf;
botf_bounce = botf;
topb_bounce = topb;
botb_bounce = botb;
return true; // Bounced
}
assert(repOk(&q));
assert(!hitEnd || topf_bounce > 0 || botf_bounce > 0);
return true;
}
#endif
|